<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">ABB</journal-id><journal-title-group><journal-title>Advances in Bioscience and Biotechnology</journal-title></journal-title-group><issn pub-type="epub">2156-8456</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/abb.2018.91005</article-id><article-id pub-id-type="publisher-id">ABB-82120</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Molecular Cloning and Phylogenetic Analysis of a Chitin Deacetylase Isolated from the Epidermis of the Red Snow Crab &lt;i&gt;Chionoecetes japonicas&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Kakeru</surname><given-names>Fujimori</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hideto</surname><given-names>Fukushima</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Masahiro</surname><given-names>Matsumiya</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Marine Science and Resources, College of Bioresource Sciences, Nihon University, Fujisawa, Japan</addr-line></aff><pub-date pub-type="epub"><day>19</day><month>01</month><year>2018</year></pub-date><volume>09</volume><issue>01</issue><fpage>52</fpage><lpage>62</lpage><history><date date-type="received"><day>26,</day>	<month>December</month>	<year>2017</year></date><date date-type="rev-recd"><day>27,</day>	<month>January</month>	<year>2018</year>	</date><date date-type="accepted"><day>30,</day>	<month>January</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Chitin deacetylase (CDA; EC 3. 5. 1. 41) catalyzes the deacetylation of chitin. In this study, we successfully cloned and sequenced a chitin deacetylase gene from 
  the red snow crab 
  &lt;i&gt;
  Chionoecetes japonicas
  &lt;/i&gt;
  . By using reverse transcription-polymerase chain reaction (RT-PCR) and 5
  ' 
  and 3
  '
   rapid amplification of cDNA ends, we obtained a 2141-bp amplicon containing a chitin deacetylase gene (
  &lt;i&gt;
  CjCDA
  &lt;/i&gt;
  ) from the epidermis of 
  &lt;i&gt;
  C. japonicas
  &lt;/i&gt;
  . The amplicon
   
  contains a 1575-bp open reading frame that is predicted to encode a 525-amino acid protein. The structure predicted from the deduced amino acid sequence included an N-terminal signal peptide, chitin-binding domain (CBD), low-density lipoprotein receptor class A domain (LDL-A), and catalytic domain. Comparative analysis of the deduced amino acid sequence of 
  &lt;i&gt;
  CjCDA
  &lt;/i&gt;
   revealed the highest homology (74%) to gastrolith protein 59 of 
  &lt;i&gt;
  Cherax quadricarinatus
  &lt;/i&gt;
  . We used RT-PCR to evaluate the expression of 
  &lt;i&gt;
  CjCDA
  &lt;/i&gt;
   in various tissues of 
  &lt;i&gt;
  C. japonicas
  &lt;/i&gt;
  , and we observed that 
  &lt;i&gt;
  CjCDA
  &lt;/i&gt;
   was expressed only in the epidermis. A phylogenetic analysis, using the amino acid sequences of CjCDA and other known chitin deacetylases, showed that CjCDA belonged to a group of crustacean chitin deacetylases. To our knowledge, this is the first study reporting the cDNA cloning of a chitin deacetylase from a crab.
 
</p></abstract><kwd-group><kwd>Chitin Deacetylase</kwd><kwd> Molecular Cloning</kwd><kwd> &lt;i&gt;Chionoecetes japonicas&lt;/i&gt;</kwd><kwd> Phylogenetic Analysis</kwd><kwd> Expression Analysis</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Chitin is a β-1,4-linked linear polysaccharide of N-acetyl-D-glucosamine (GlcNAc). Chitin is widespread in nature, and is present in the cell walls of fungi, the exoskeletons of insects and crustaceans, and the cuttlebones of mollusks, and it is the second most abundant component of biomass after cellulose [<xref ref-type="bibr" rid="scirp.82120-ref1">1</xref>] . Chitosan, which is deacetylated chitin [<xref ref-type="bibr" rid="scirp.82120-ref2">2</xref>] , is a β-1,4-linked polymer of glucosamine (GlcN) that is soluble in dilute acids and viscous [<xref ref-type="bibr" rid="scirp.82120-ref3">3</xref>] and is widely used in textile goods, cosmetics, as food additives, and in medical applications [<xref ref-type="bibr" rid="scirp.82120-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.82120-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.82120-ref6">6</xref>] because of its antibacterial effects, biodegradability, and biocompatibility [<xref ref-type="bibr" rid="scirp.82120-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.82120-ref8">8</xref>] . Chitosan is produced industrially via deacetylation of chitin obtained from the shells of crustaceans, such as shrimp and crab, by heat-treating chitin in a concentrated alkaline solution [<xref ref-type="bibr" rid="scirp.82120-ref9">9</xref>] . This alkali treatment does not lead to complete deacetylation but yields chitosan containing about 30% of GlcNAc at random [<xref ref-type="bibr" rid="scirp.82120-ref3">3</xref>] . In addition, chitosan production from 1 kg of chitin requires not only 6.3 kg of HCl and 1 - 8 kg of NaOH but also nitrogen, 0.5 t of process water, and 0.9 t of cooling water [<xref ref-type="bibr" rid="scirp.82120-ref10">10</xref>] . In contrast, enzymatic deacetylation proceeds under mild conditions and can either completely deacetylate or partially deacetylate chitin at specific sites [<xref ref-type="bibr" rid="scirp.82120-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.82120-ref12">12</xref>] . Therefore, chitosan production using enzymes is expected to replace alkaline production.</p><p>Chitin deacetylase (CDA) is an enzyme that catalyzes the hydrolysis of the acetamido groups of GlcNAc in chitin, producing GlcN and acetic acid [<xref ref-type="bibr" rid="scirp.82120-ref13">13</xref>] . CDA is a member of carbohydrate esterase family 4 (CE4). Members of CE4 share a conserved region called the NodB homology domain or polysaccharide deacetylase domain [<xref ref-type="bibr" rid="scirp.82120-ref14">14</xref>] . CDA was first discovered in the fungus Mucor rouxii [<xref ref-type="bibr" rid="scirp.82120-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.82120-ref16">16</xref>] , and was subsequently found in various fungi and characterized. This enzyme was shown to play important roles in various physiological processes, including cell wall formation, spore formation, and fruiting body growth [<xref ref-type="bibr" rid="scirp.82120-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.82120-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.82120-ref19">19</xref>] . In insects, a CDA was discovered in Mamestra configurata [<xref ref-type="bibr" rid="scirp.82120-ref20">20</xref>] , and was subsequently identified in the peritrophic membranes of numerous insects. In addition, in beetles, chitin is converted to chitosan when the trachea is extended, which suggests the involvement of CDA in this process [<xref ref-type="bibr" rid="scirp.82120-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.82120-ref21">21</xref>] .</p><p>There have been a limited number of reports on CDA genes in crustaceans; specifically, in two varieties of shrimp, red claw shrimp (Cherax quadricarinatus) [<xref ref-type="bibr" rid="scirp.82120-ref22">22</xref>] and black tiger shrimp (Penaeus monodon) [<xref ref-type="bibr" rid="scirp.82120-ref23">23</xref>] . The CDA in P. monodon is reported to be expressed mainly in the gills and play a role in pathogen defense [<xref ref-type="bibr" rid="scirp.82120-ref23">23</xref>] . We attempted, for the first time, to amplify full-length CDA genes from crabs, which has not been often reported, and to determine the structure and phylogenetic relationships among CDAs.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Materials</title><p>Red snow crab Chionoecetes japonicas (male, carapace width; 12 cm, weight; 725 g, collected at Ishikawa prefecture Japan on November in 2015) was purchased from Nakagawa Co., Ltd. (Japan). Sample was transported living and then stored at −80˚C.</p></sec><sec id="s2_2"><title>2.2. Cloning of the Chitin Deacetylase cDNA from C. japonicus</title><p>The sequences of all primers used are presented in <xref ref-type="table" rid="table1">Table 1</xref>. Total RNA was extracted from the epidermis of the leg muscle of C. japonicus using ISOGEN II reagent (Nippon Gene, Tokyo, Japan) according to the manufacturer’s instructions. First-strand cDNA was synthesized using 500 ng of total RNA and oligo dT primers with PrimeScript II Reverse Transcriptase (RNase H-free) (Takara Bio, Shiga, Japan) according to the manufacturer’s instructions. Degenerate primers were designed for the reverse transcriptase-polymerase chain reaction (RT-PCR) from conserved sequences in insect and crustacean chitin deacetylases. In the first PCR, C. japonicus cDNA was used as a template and CDA F-1 and CDA R-1 were used as primers. The PCR conditions were as follows: 95˚C for 2 min, followed by 30 cycles of 95˚C for 30 s, 55˚C for 30 s, and 72˚C for 50 s. The primers used are listed in <xref ref-type="table" rid="table1">Table 1</xref>, and the primer combinations are shown in <xref ref-type="fig" rid="fig1">Figure 1</xref>.</p><p>For the 3' rapid amplification of cDNA ends (RACE), we designed primers specific to CjCDA (CjCDA 3'-1 and CjCDA 3'-2; <xref ref-type="table" rid="table1">Table 1</xref>) based on the detected sequences. We amplified cDNA fragments encoding the 3' region of CjCDA using</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used for PCR, RACE, and tissue expression</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Sequence</th><th align="center" valign="middle" >Number of bases (bp)</th><th align="center" valign="middle" >Annealing temperatures (˚C)</th><th align="center" valign="middle" >Uses</th></tr></thead><tr><td align="center" valign="middle" >CDA F-1</td><td align="center" valign="middle" >TGYMGNGAYGTNATHCARTGYAC</td><td align="center" valign="middle" >23</td><td align="center" valign="middle" >58.4</td><td align="center" valign="middle" >Primary PCR</td></tr><tr><td align="center" valign="middle" >CDA F-2</td><td align="center" valign="middle" >GGNYTNCARGCNHTNMGNTGYCC</td><td align="center" valign="middle" >23</td><td align="center" valign="middle" >63.7</td><td align="center" valign="middle" >Primary PCR</td></tr><tr><td align="center" valign="middle" >CDA F-3</td><td align="center" valign="middle" >GAYTGYWSNGAYGGNWSNGAYGA</td><td align="center" valign="middle" >23</td><td align="center" valign="middle" >61.3</td><td align="center" valign="middle" >Primary PCR</td></tr><tr><td align="center" valign="middle" >CDA F-4</td><td align="center" valign="middle" >ACNTTYGAYGAYGCNATHAA</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >51.3</td><td align="center" valign="middle" >Primary PCR</td></tr><tr><td align="center" valign="middle" >CDA R-1</td><td align="center" valign="middle" >CCAYTGDATNACYTGNGTCATNGT</td><td align="center" valign="middle" >24</td><td align="center" valign="middle" >58.5</td><td align="center" valign="middle" >Primary PCR</td></tr><tr><td align="center" valign="middle" >CDA R-2</td><td align="center" valign="middle" >GCNGTDATNGTNSWRTCRTANAARAA</td><td align="center" valign="middle" >26</td><td align="center" valign="middle" >57.1</td><td align="center" valign="middle" >Primary PCR</td></tr><tr><td align="center" valign="middle" >CDA R-3</td><td align="center" valign="middle" >AAYTGNBWRTTNCCNCCNACNCKNA</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >60.8</td><td align="center" valign="middle" >Primary PCR</td></tr><tr><td align="center" valign="middle" >CDA R-4</td><td align="center" valign="middle" >TAYTTRTGNSWNACRAARAANGT</td><td align="center" valign="middle" >23</td><td align="center" valign="middle" >52.4</td><td align="center" valign="middle" >Primary PCR</td></tr><tr><td align="center" valign="middle" >CjCDA 5'-1</td><td align="center" valign="middle" >GCAGCGGCTTTACTTTCTTTCG</td><td align="center" valign="middle" >22</td><td align="center" valign="middle" >58.6</td><td align="center" valign="middle" >5' RACE</td></tr><tr><td align="center" valign="middle" >CjCDA 5'-2</td><td align="center" valign="middle" >TCTGCAGCTCCAGGTCAAAG</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >58.4</td><td align="center" valign="middle" >5' RACE</td></tr><tr><td align="center" valign="middle" >AAP</td><td align="center" valign="middle" >GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG</td><td align="center" valign="middle" >36</td><td align="center" valign="middle" >76.5</td><td align="center" valign="middle" >5' RACE</td></tr><tr><td align="center" valign="middle" >AUAP</td><td align="center" valign="middle" >GGCCACGCGTCGACTAGTAC</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >62.5</td><td align="center" valign="middle" >5' RACE</td></tr><tr><td align="center" valign="middle" >CjCDA 3'-1</td><td align="center" valign="middle" >ACAACCCCAACGGCTGCTC</td><td align="center" valign="middle" >19</td><td align="center" valign="middle" >60.4</td><td align="center" valign="middle" >3' RACE</td></tr><tr><td align="center" valign="middle" >CjCDA 3'-2</td><td align="center" valign="middle" >GGCTGCTCCATCAAGTCCAC</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >60.4</td><td align="center" valign="middle" >3' RACE</td></tr><tr><td align="center" valign="middle" >3' RACE</td><td align="center" valign="middle" >CTGTGAATGCTGCGACTACGAT</td><td align="center" valign="middle" >22</td><td align="center" valign="middle" >58.6</td><td align="center" valign="middle" >3' RACE</td></tr><tr><td align="center" valign="middle" >CjCDA Full F</td><td align="center" valign="middle" >CGATCAGACCGGGAAACAAC</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >58.4</td><td align="center" valign="middle" >Full length PCR</td></tr><tr><td align="center" valign="middle" >CjCDA Full R</td><td align="center" valign="middle" >CTGGACACAATCATGTATAC</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >52.2</td><td align="center" valign="middle" >Full length PCR</td></tr><tr><td align="center" valign="middle" >β-actin F</td><td align="center" valign="middle" >ATGTACGTGGCCATCCAGG</td><td align="center" valign="middle" >19</td><td align="center" valign="middle" >58.2</td><td align="center" valign="middle" >Tissue expression</td></tr><tr><td align="center" valign="middle" >β-actin R</td><td align="center" valign="middle" >CTCGTTGCCGATGGTGATG</td><td align="center" valign="middle" >19</td><td align="center" valign="middle" >58.2</td><td align="center" valign="middle" >Tissue expression</td></tr><tr><td align="center" valign="middle" >CjCDA F</td><td align="center" valign="middle" >GCCCAACATTACCGACTCTTCG</td><td align="center" valign="middle" >22</td><td align="center" valign="middle" >60.4</td><td align="center" valign="middle" >Tissue expression</td></tr><tr><td align="center" valign="middle" >CjCDA R</td><td align="center" valign="middle" >ATCACCTGCGTCATGGTCACG</td><td align="center" valign="middle" >21</td><td align="center" valign="middle" >60.4</td><td align="center" valign="middle" >Tissue expression</td></tr></tbody></table></table-wrap><p>C. japonicus cDNA as the template and the primer pairs CjCDA 3'-1, 3' RACE and CjCDA 3'-2, 3' RACE. The PCR conditions were as follows: 95˚C for 2 min, followed by 30 cycles of 95˚C for 30 s, 58˚C for 30 s, and 72˚C for 80 s. For the 5' RACE, specific primers (CjCDA 5'-1 and CjCDA 5'-2; <xref ref-type="table" rid="table1">Table 1</xref>) were designed based on the nucleotide sequences obtained from the RT-PCR. Then, the cDNA fragments encoding the 5' regions of CjCDA were amplified by PCR. In the first PCR, the newly synthesized first-strand cDNA was used as a template, and AAP and CjCDA 5'-1 were used as the primers. In the nested PCR, the first PCR products were used as templates and AUAP and CjCDA 5'-2 were used as primers. The PCR conditions were as follows: 95˚C for 2 min, followed by 30 cycles of 95˚C for 30 s, 56˚C for 30 s, and 72˚C for 20 s. The nucleotide sequences of cDNA fragments containing a full-length open reading frame (ORF) were confirmed by PCR using the specific primers CjCDA Full F and CjCDA Full R (<xref ref-type="table" rid="table1">Table 1</xref>) and Platinum Pfx DNA Polymerase (Invitrogen, Carlsbad, CA).</p></sec><sec id="s2_3"><title>2.3. Nucleotide Sequence Analysis</title><p>The RT-PCR and 3' and 5' RACE amplification products as well as the full-length amplification products were subcloned into the pGEM-T Easy Vector (Promega, Madison, WI), according to the manufacturer’s instructions. The sequences were determined on an ABI PRISM 3130 genetic analyzer (Applied Biosystems, Foster City, CA) using the Big Dye Terminator v3.1 cycle sequencing kit (Applied Biosystems).</p></sec><sec id="s2_4"><title>2.4. Expression Analysis</title><p>Total RNA was prepared from the muscle, epidermis, hepatopancreas, gills, shell, tendon, and intersegmental membrane as described in Section 2.2. Then, first-strand cDNA was amplified from the RNA isolated from each tissue as described above. For tissue-specific expression, we designed primers specific to CjCDA (CjCDA F and CjCDA R; <xref ref-type="table" rid="table1">Table 1</xref>) based on the detected sequences. Then, CjCDA was amplified using the first-strand cDNA as template and primers CjCDA F and CjCDA R (<xref ref-type="table" rid="table1">Table 1</xref>). The PCR conditions were as follows: 95˚C for 2 min, followed by 30 cycles of 95˚C for 30 s, 50˚C for 30 s, and 72˚C for 30 s. To determine the amount of total RNA in each tissue, we amplified β-actin mRNA using a specific primer pair as a control for normalization (<xref ref-type="table" rid="table1">Table 1</xref>).</p></sec><sec id="s2_5"><title>2.5. Phylogenetic Analysis</title><p>To determine the relationship between the CDA isolated from the epidermis of C. japonicus and other CDAs from insects, crustaceans, and mollusks, we constructed a phylogenetic tree based on the sequences of enzyme precursors by the neighbor-joining method using ClustalW2 (http://www.ebi.ac.uk/Tools/msa/clustalw2/). A fungal CDA (GenBank: XM_007272808.1) was used as an outgroup.</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><sec id="s3_1"><title>3.1. cDNA Cloning</title><p>From the epidermis of the leg muscle of red snow crab (Chionoecetes japonicas), we obtained a 2141-bp chitin deacetylase (CDA) gene containing a 1575-bp open reading frame (ORF) that encodes 525 amino acids. The sequence determined for the cDNA encoding the chitin deacetylase CjCDA was registered with the DNA Data Bank of Japan (DDBJ) database (accession no. LC342072). A poly(A) tail specific to eukaryotes was found at the 3'-terminus of CjCDA. Comparison of the deduced amino acid sequence of CjCDA (CjCDA) to CDAs in other organisms by BLAST showed the highest similarity (74%) with gastrolith protein 59 of C. quadricarinatus (CqCDA) [<xref ref-type="bibr" rid="scirp.82120-ref22">22</xref>] and the second highest similarity (72%) with chitin deacetylase1 of P. monodon (PmCDA) [<xref ref-type="bibr" rid="scirp.82120-ref23">23</xref>] . In addition, CjCDAshowed ~60% similarity was known CDAs in insects. The structural prediction for CjCDA showed an N-terminal signal peptide (amino acids 1 - 18), chitin-binding domain (CBD; amino acids 31 - 90), low-density lipoprotein receptor class A domain (LDL-A; amino acids 103 - 142), and glycoside hydrolase/deacetylase, beta/alpha-barrel (Glyco_hydro/deAcase_b/a-brl; amino acids 145 - 461) (<xref ref-type="fig" rid="fig2">Figure 2</xref>). Because amino acids 183 - 293 in the Glyco_hydro/deAcase_b/a-brl are presumed to be the NodB homology domain (NODB_dom) and several characteristic motifs, including TFDD, H[S/T]xxHP, RxP[Y/F], DxxDW, and GxxxFxx [<xref ref-type="bibr" rid="scirp.82120-ref13">13</xref>] , are present, CjCDA is considered to be a member of carbohydrate esterases family 4 (CE4). Comparison of CjCDA to the deduced amino acid sequences of CqCDA, PmCDA, and known CDAs in insects showed that CjCDA shares a very similar domain structure with these proteins (<xref ref-type="fig" rid="fig3">Figure 3</xref>). The CDAs in insects have been classified into five groups based on their structure (<xref ref-type="fig" rid="fig4">Figure 4</xref>) [<xref ref-type="bibr" rid="scirp.82120-ref24">24</xref>] . Groups I and II contain a signal peptide, CBD, LDL-A, and catalytic domain. Groups III and IV contain a signal peptide, CBD, and catalytic domain but no LDL-A. Group V contains only a signal peptide and catalytic domain, and these CDAs are specific to the midgut [<xref ref-type="bibr" rid="scirp.82120-ref24">24</xref>] . Because CjCDA contains a CBD, LDL-A, and catalytic domain, it can be classified into Group I. CqCDA and PmCDA share similar domain structure, and all crustacean</p><p>CDAs that have been discovered to date appear to belong to Group I.</p></sec><sec id="s3_2"><title>3.2. Tissue Expression</title><p>Tissue expression analysis of CjCDA in C. japonicus by RT-PCR using the β-actin gene as a control revealed that CjCDA is expressed only in the epidermis of muscle (<xref ref-type="fig" rid="fig5">Figure 5</xref>), and no expression was observed in gills, muscle, or other examined tissues. Previous studies revealed that PmCDA in P. monodon is mainly expressed in the gills and functions in the immune response to the pathogen that causes white spot disease [<xref ref-type="bibr" rid="scirp.82120-ref23">23</xref>] and the CDA in the fruit fly Drosophila</p><p>melanogaster is involved in the control of trachea extension [<xref ref-type="bibr" rid="scirp.82120-ref21">21</xref>] . In addition, the CDAs of D. melanogaster and a species of locust, Locusta migratoria, are expressed in the cuticle [<xref ref-type="bibr" rid="scirp.82120-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.82120-ref25">25</xref>] . Because inhibition of CDA expression in a species of beetle (Tribolium castaneum) prevented ecdysis, CDA is thought to play an important role in ecdysis [<xref ref-type="bibr" rid="scirp.82120-ref24">24</xref>] . When arthropods molt, the epidermis separates from the cuticle and a new cuticle is secreted on the surface of the epidermis. Thus, we hypothesize that CjCDA has some function during C. japonicus molting.</p></sec><sec id="s3_3"><title>3.3. Phylogenetic Analysis</title><p>As a result of phylogenetic analysis based on the deduced amino acid sequences of CDAs from various arthropods, including insects and crustaceans, as well as mollusks and the fungus Colletotrichum gloeosporioides, which was used as an outgroup, CDAs in arthropods were shown to belong in Groups I-V, as reported previously [<xref ref-type="bibr" rid="scirp.82120-ref24">24</xref>] . However, the CDAs from mollusks were not in Groups I-V. All CDAs from crustaceans, including CjCDA, belonged to Group I (<xref ref-type="fig" rid="fig6">Figure 6</xref>).</p><p>There are no reports of CDAs from crustaceans belonging to any Group other than Group I. However, because some species have multiple CDA isozymes, like T. castaneum, there is a possibility that C. japonicus may contain multiple isozymes with different structures, like T. castaneum.</p></sec></sec><sec id="s4"><title>4. Conclusion</title><p>From the epidermis of the red snow crab, we obtained a full-length CDA gene, CjCDA, which contained a 1575-bp ORF encoding a 525-amino acid protein. CjCDA had a Group I domain structure, as it contained a signal peptide, CBD, LDL-A, and catalytic domain. Because CjCDA was expressed only in the epidermis, we hypothesize that it is involved in ecdysis. This study is the first report of the cloning of a full-length CDA gene from a crab.</p></sec><sec id="s5"><title>Cite this paper</title><p>Fujimori, K. Fukushima, H. and Matsumiya, M. (2018) Molecular Cloning and Phylogenetic Analysis of a Chitin Deacetylase Isolated from the Epidermis of the Red Snow Crab Chionoecetes japonicus. Advances in Bioscience and Biotechnology, 9, 52-62. https://doi.org/10.4236/abb.2018.91005</p></sec></body><back><ref-list><title>References</title><ref id="scirp.82120-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Islam, S., Rahman Bhuiyan, M.A. and Islam, M.N. (2017) Chitin and Chitosan: Structure, Properties and Applications in Biomedical Engineering. Journal of Polymers and the Environment, 25, 854-866. https://doi.org/10.1007/s10924-016-0865-5</mixed-citation></ref><ref id="scirp.82120-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">El-Nesr, E.M., Raafat, A.I., Nasef, S.M., Soliman, E.A. and El-Sayed, A.H. (2013) Chitin and Chitosan Extracted from Irradiated and non-Irradiated Shrimp Wastes (Comparative Analysis Study). Arab Journal of Nuclear Science and Applications, 46, 53-66.</mixed-citation></ref><ref id="scirp.82120-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Majeti, N.V. and Kumar, R. (2000) A Review of Chitin and Chitosan Applications. Reactive &amp; Functional Polymers, 46, 1-27. https://doi.org/10.1016/S1381-5148(00)00038-9</mixed-citation></ref><ref id="scirp.82120-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Kanimozhi, S., Ramya, D. and Menaga, G.M.R. (2014) Production and Optimization of Chitosan from Aspergillus niger by Solid State and Submerged Fermentation and Evaluation of its Antibacterial and Antioxidant Activity. Drug Invention Today, 6, 141-148.</mixed-citation></ref><ref id="scirp.82120-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Abdou, E.S., Elkholy, S.S., Elsabee, M.Z. and Mohamed, E. (2008) Improved Antimicrobial Activity of Polypropylene and Cotton Nonwoven Fabrics by Surface Treatment and Modification with Chitosan. Journal of Applied Polymer Science, 108, 2290-2296. https://doi.org/10.1002/app.25937</mixed-citation></ref><ref id="scirp.82120-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Dutta, P.K., Tripathi, S., Mehrotra, G.K. and Dutta, J. (2009) Perspectives for Chitosan Based Antimicrobial Films in Food Applications. Food Chemistry, 114, 1173-1182. https://doi.org/10.1016/j.foodchem.2008.11.047</mixed-citation></ref><ref id="scirp.82120-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Zheng, L.Y. and Zhu, J.F. (2003) Study on Antimicrobial Activity of Chitosan with Different Molecular Weights. Carbohydrate Polymers, 54, 527-530. https://doi.org/10.1016/j.carbpol.2003.07.009</mixed-citation></ref><ref id="scirp.82120-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Nishimura, S., Kohgo, O., Kurita, K. and Kuzuhara, H. (1991) Chemospecific Manipulations of a Rigid Polysaccharide: Syntheses of Novel Chitosan Derivatives with Excellent Solubility in Common Organic Solvents by Regioselective Chemical Modifications. Macromolecules, 24, 4745-4748. https://doi.org/10.1021/ma00017a003</mixed-citation></ref><ref id="scirp.82120-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Aam, B.B., Heggset, E.B., Norberg, A.L., S&amp;oslash;rlie, M., Varum, K.M. and Eijsink, V.G.H. (2010) Production of Chitooligosaccharides and Their Potential Applications in Medicine. Marine Drugs, 8, 1482-1517. https://doi.org/10.3390/md8051482</mixed-citation></ref><ref id="scirp.82120-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Kumar, M.N.V.R. (1999) Chitin and Chitosan Fibres: A Review. Bulletin of Materials Science, 22, 905-915. https://doi.org/10.1007/BF02745552</mixed-citation></ref><ref id="scirp.82120-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Shrestha, B., Blondeau, K., Stevens, W.F. and Hegarat, F.L. (2004) Expression of Chitin Deacetylase from Colletotrichum lindemuthianum in Pichia pastoris: Purification and Characterization. Protein Expression and Purification, 38, 196-204. https://doi.org/10.1016/j.pep.2004.08.012</mixed-citation></ref><ref id="scirp.82120-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Naqvi, S., Cord-Landwehr, S., Singh, R., Bernard, F., Kolkenbrock, S., Gueddari, N.E.E. and Moerschbacher, B.M. (2016) A Recombinant Fungal Chitin Deacetylase Produces Fully Defined Chitosan Oligomers with Novel Patterns of Acetylation. American Society for Microbiology, 82, 6645-6655. https://doi.org/10.1128/AEM.01961-16</mixed-citation></ref><ref id="scirp.82120-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Zhao, Y., Park, R. and Muzzarelli, R.A.A. (2010) Chitin Deacetylases: Properties and Applications. Marine Drugs, 8, 24-46. https://doi.org/10.3390/md8010024</mixed-citation></ref><ref id="scirp.82120-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">John, M., R&amp;ouml;hrig, H., Schmidt, J., Wieneke, U. and Schell, J. (1993) Rhizobium NodB Protein Involved in Nodulation Signal Synthesis Is a Chitooligosaccharide Deacetylase. Biochemistry, 90, 625-629. https://doi.org/10.1073/pnas.90.2.625</mixed-citation></ref><ref id="scirp.82120-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Davis, L.L. and Bartnicki-Garcia, S. (1984) Chitosan Synthesis by the Tandem Action of Chitin Synthetase and Chitin Deacetylase from Mucor rouxii. Biochemistry, 23, 1065-1073. https://doi.org/10.1021/bi00301a005</mixed-citation></ref><ref id="scirp.82120-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Araki, Y. and Ito, E. (1974) A Pathway of Chitosan Formation in Mucor rouxii: Enzymatic Deacetylation of Chitin. Biochemicaland Biophysical Research Communications, 56, 669-675. https://doi.org/10.1016/0006-291X(74)90657-3</mixed-citation></ref><ref id="scirp.82120-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Christodoulidou, A., Briza, P., Ellinger, A. and Bouriotis, V. (1999) Yeast Ascospore Wall Assembly Requires Two Chitin Deacetylase Isozymes. Federation of European Biochemical Societies, 460, 275-279. https://doi.org/10.1016/S0014-5793(99)01334-4</mixed-citation></ref><ref id="scirp.82120-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Baker, L.G., Specht, C.A., Donlin, M.J. and Lodge, J.K. (2007) Chitosan, the Deacetylated Form of Chitin, Is Necessary for Cell Wall Integrity in Cryptococcus neoformans. Eukaryotic Cell, 6, 855-867. https://doi.org/10.1128/EC.00399-06</mixed-citation></ref><ref id="scirp.82120-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Yamada, M., Kurano, M., Inatomi, S., Taguchi, G., Okazaki, M. and Shimosaka, M. (2008) Isolation and Characterization of a Gene Coding for Chitin Deacetylase Specifically Expressed during Fruiting Body Development in the Basidiomycete Flammulina velutipes and Its Expression in the Yeast Pichia pastoris. Federation of European Microbiological Societies, 289, 130-137. https://doi.org/10.1111/j.1574-6968.2008.01361.x</mixed-citation></ref><ref id="scirp.82120-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Toprak, U., Baldwin, D., Erlandson, M., Gillott, C., Hou, X., Coutu, C. and Hegedus, D.D. (2008) A Chitin Deacetylase and Putative Insect Intestinal Lipases Are Components of the Mamestra configurata (Lepidoptera: Noctuidae) Peritrophic Matrix. Insect Molecular Biology, 17, 573-585. https://doi.org/10.1111/j.1365-2583.2008.00829.x</mixed-citation></ref><ref id="scirp.82120-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Luschnig, S., B&amp;auml;tz, T., Armbruster, K. and Krasnow, M.A. (2006) serpentine and vermiform Encode Matrix Proteins with Chitin Binding and Deacetylation Domains That Limit Tracheal Tube Length in Drosophila. Current Biology, 16, 186-194. https://doi.org/10.1016/j.cub.2005.11.072</mixed-citation></ref><ref id="scirp.82120-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Yudkovski, Y., Glazer, L., Shechter, A., Reinhardt, R., Chalifa-Caspi, V., Sagi, A. and Tom, M. (2010) Multi-Transcript Expression Patterns in the Gastrolith Disk and the Hypodermis of the Crayfish Cherax quadricarinatus at Premolt. Comparative Biochemistry and Physiology Part D, 5, 171-177. https://doi.org/10.1016/j.cbd.2010.03.010</mixed-citation></ref><ref id="scirp.82120-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Sarmiento, K.P., Panes, V.A. and Santos, M.D. (2016) Molecular Cloning and Expression of Chitin Deacetylase 1 Gene from the Gills of Penaeus monodon (Black Tiger Shrimp). Fish &amp; Shellfish Immunology, 55, 484-489. https://doi.org/10.1016/j.fsi.2016.06.025</mixed-citation></ref><ref id="scirp.82120-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Dixit, R., Arakane, Y., Specht, C.A., Richard, C., Kramer, K.J., Beeman, R.W. and Muthukrishnan, S. (2008) Domain Organization and Phylogenetic Analysis of Proteins from the Chitin Deacetylase Gene Family of Tribolium castaneum and Three Other Species of Insects. Insect Biochemistry and Molecular Biology, 38, 440-451. https://doi.org/10.1016/j.ibmb.2007.12.002</mixed-citation></ref><ref id="scirp.82120-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Yu, R., Liu, W., Li, D., Zhao, X., Ding, G., Zhang, M., Ma, E., Zhu, K.Y., Li, S., Moussian, B. and Zhang, J. (2016) Helicoidal Organization of Chitin in the Cuticle of the Migratory Locust Requires the Function of the Chitin Deacetylase2 Enzyme (LmCDA2). Journal of Biological Chemistry, 291, 24352-24363. https://doi.org/10.1074/jbc.M116.720581</mixed-citation></ref></ref-list></back></article>