<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">ABB</journal-id><journal-title-group><journal-title>Advances in Bioscience and Biotechnology</journal-title></journal-title-group><issn pub-type="epub">2156-8456</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/abb.2018.91004</article-id><article-id pub-id-type="publisher-id">ABB-82114</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Distribution of Chitinolytic Enzyme in the Organs and Molecular Cloning of a Novel Chitinase Gene from the Kidney of Marbled Rockfish &lt;i&gt;Sebastiscus marmoratus&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Miku</surname><given-names>Watanabe</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hiromi</surname><given-names>Kakizaki</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Taro</surname><given-names>Tsukamoto</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Miku</surname><given-names>Fujiwara</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hideto</surname><given-names>Fukushima</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mitsuhiro</surname><given-names>Ueda</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Masahiro</surname><given-names>Matsumiya</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Department of Applied Biological Chemistry, College of Agriculture, Osaka Prefecture University, Osaka, Japan</addr-line></aff><aff id="aff1"><addr-line>Department of Marine Science and Resources, College of Bioresource Sciences, Nihon University, Kanagawa, Japan</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>wm02162017@gmail.com(MW)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>19</day><month>01</month><year>2018</year></pub-date><volume>09</volume><issue>01</issue><fpage>36</fpage><lpage>51</lpage><history><date date-type="received"><day>25,</day>	<month>December</month>	<year>2017</year></date><date date-type="rev-recd"><day>27,</day>	<month>January</month>	<year>2018</year>	</date><date date-type="accepted"><day>30,</day>	<month>January</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Actinopterygii express two types of chitinase (acidic fish chitinase-1 (AFCase-1) and acidic fish chitinase-2 (AFCase-2)) that are active at acidic pHs and involved in digestion in the stomach. We proposed the existence of a new fish chitinase that has a non-digestive function. In this study, we used 
  
  Sebastiscus marmoratus
  , for which characteristics and cDNA cloning of chitinase isozymes (SmChi-1, SmChi-2) in the stomach have been reported. Initially, we examined the distribution of chitinase and 
  
  β-N
  -acetylhexosaminidase (Hex) in the body and then we tried to clone novel chitinase cDNA from the kidney. Chitinase and Hex activities were measured using 
  
  p
  NP-(GlcNAc)
  
  <sub>n</sub><sub></sub>
  , (
  n 
  = 2, 3) and 
  
  p
  NP-GlcNAc as substrates, respectively. Total RNA was extracted from the kidney. RT-PCR was performed to obtain chitinase cDNA fragments using reverse transcriptase with an oligo dT primer. The RACE method was used to obtain sequences of the upstream and downstream regions of cDNA. The full-length chitinase cDNA was determined using PrimeSTAR&amp;reg; Max DNA polymerase with proofreading activity. High chitinase activity was observed in the stomach, as previously reported. In addition, relatively high activity was observed in the liver, spleen, kidney, and heart. In contrast, Hex activity was detected in all organs. This result is consistent with the report that Hex is related to body-wide metabolism. Full-length cDNA (
  
  SmChi
  -3) of the novel chitinase was obtained from the kidney, which contained 1440 bp open reading frames. The domain structure of SmChi-3 was assumed to be similar to those of SmChi-1 and SmChi-2. SmChi-1 and SmChi-2 have a serine and glycine-rich linker region, which is characteristic of AMCase. In contrast, SmChi-3 contained no apparent sequence in the linker region. Phylogenetic analysis revealed the existence of a new chitinase group, which was named fish chitinase-3 (FCase-3) and differed from AFCase-1 and AFCase-2.
 
</p></abstract><kwd-group><kwd>Chitinolytic Enzyme</kwd><kwd> Chitinase</kwd><kwd> &lt;i&gt;Sebastiscus marmoratus&lt;/i&gt;</kwd><kwd> Distribution</kwd><kwd> cDNA Cloning</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Chitin, a β-1,4-linked aminopolysaccharide of N-acetyl-D-glucosamine (GlcNAc), is the second most abundant component of biomass in the world, after cellulose, and is found in the exoskeletons of arthropods, the cell walls of fungi, and the cuticles of nematodes [<xref ref-type="bibr" rid="scirp.82114-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref3">3</xref>] . In recent years, byproducts degraded from chitin have been shown to have various biological activities. For example, chitin oligosaccharides (GlcNAc)<sub>n</sub>, have been found to promote the growth of bifidobacteria, have immunostimulatory activity [<xref ref-type="bibr" rid="scirp.82114-ref4">4</xref>] , and GlcNAc has been found to improve osteoarthritis [<xref ref-type="bibr" rid="scirp.82114-ref5">5</xref>] and dry skin [<xref ref-type="bibr" rid="scirp.82114-ref6">6</xref>] .</p><p>Chitinolytic enzymes can be classified into the following two categories according to their degradation patterns: Endo-type chitinolytic enzymes, which degrade β-1,4-glycosidic bonds in a chitin polymer at random to produce chitin oligosaccharides (GlcNAc)<sub>n</sub> and are called chitinases (EC 3.2.1.14) [<xref ref-type="bibr" rid="scirp.82114-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref9">9</xref>] ; and exo-type chitinolytic enzymes, which degrade a chitin polymer from the nonreducing end, one by one, to produce GlcNAc and are called β-N-acetylhexosaminidase (Hex) (EC 3.2.1.52) [<xref ref-type="bibr" rid="scirp.82114-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref10">10</xref>] . Chitinases have been found in various organisms including mammals [<xref ref-type="bibr" rid="scirp.82114-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref13">13</xref>] , fish [<xref ref-type="bibr" rid="scirp.82114-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref17">17</xref>] , mollusks [<xref ref-type="bibr" rid="scirp.82114-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref19">19</xref>] , insects [<xref ref-type="bibr" rid="scirp.82114-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref21">21</xref>] , plants [<xref ref-type="bibr" rid="scirp.82114-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref24">24</xref>] , and fungi [<xref ref-type="bibr" rid="scirp.82114-ref25">25</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref27">27</xref>] and play important physiological roles in digestion [<xref ref-type="bibr" rid="scirp.82114-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref17">17</xref>] , defense [<xref ref-type="bibr" rid="scirp.82114-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref22">22</xref>] , aggression [<xref ref-type="bibr" rid="scirp.82114-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref19">19</xref>] , and ecdysis [<xref ref-type="bibr" rid="scirp.82114-ref18">18</xref>] , in each of these organisms. Chitinases are classified into glycoside hydrolase (GH) families 18 and 19 on the basis of homology of amino acid sequences [<xref ref-type="bibr" rid="scirp.82114-ref27">27</xref>] and catalytic mechanisms [<xref ref-type="bibr" rid="scirp.82114-ref28">28</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref29">29</xref>] . Family 18 chitinases are widely found in animals, plants, microorganisms, etc. [<xref ref-type="bibr" rid="scirp.82114-ref20">20</xref>] . Family 19 chitinases, on the other hand, are found primarily in higher plants and are reported to have strong antibacterial properties [<xref ref-type="bibr" rid="scirp.82114-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref23">23</xref>] .</p><p>We have conducted basic research about chitinases in several aquatic organisms. In the process of our research, we purified chitinase isozymes from fish stomachs, which are active at acidic pHs and are involved in digestion, and we investigated their properties [<xref ref-type="bibr" rid="scirp.82114-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref17">17</xref>] . We also have shown, through phylogenetic analysis based on amino acid sequences, which fish stomach chitinases form two fish-specific groups: acidic fish chitinase-1 (AFCase-1) and acidic fish chitinase-2 (AFCase-2) [<xref ref-type="bibr" rid="scirp.82114-ref30">30</xref>] . Furthermore, in fish, chitinase activity has been observed not only in the digestive tract, but also in other organs [<xref ref-type="bibr" rid="scirp.82114-ref31">31</xref>] . Also, an acidic mammalian chitinase (AMCase) was found in mammals, which are vertebrates like fish, and this AMCase is involved in digestion and absorption of food [<xref ref-type="bibr" rid="scirp.82114-ref11">11</xref>] . In addition, Chitotriosidase, a chitinase produced by macrophages that plays a role in defense against pathogens, was found in mammals [<xref ref-type="bibr" rid="scirp.82114-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref13">13</xref>] . Based on these findings, we predicted that additional chitinases existed in fish and that these new chitinases would have physiological roles other than digestion, like their counterparts in mammals.</p><p>In this study, we used marbled rockfish Sebastiscus marmoratus, as a model species. Our group had previously purified three chitinase isozymes, SmChiA, SmChiB, and SmChiC from the stomach of S. marmoratus. These chitinases showed the optimum pH in the acidic region (pH 2.0 - 4.5). SmChiA and SmChiB preferentially degrades the second glycosidic bond from the non-reducing end of (GlcNAc)<sub>n</sub> and SmChiC preferentially degrade the third glycosidic bond. SmChi-1 encoding SmChiA and SmChiB, and SmChi-2 encoding SmChiC were cloned. SmChi-1 and SmChi-2 were classified into AFCase-1 and AFCase-2, respectively [<xref ref-type="bibr" rid="scirp.82114-ref14">14</xref>] . In this study, we measured chitinase activity and Hex activity to search for the presence of new chitinases in S. marmoratus using crude enzyme solutions of organs. Also, we examined the effect of pH on chitinase activity using crude enzymes prepared from the kidney and stomach. Furthermore, we tried to obtain full-length genes of a new chitinase, different from SmChi-1 and SmChi-2, from the kidney of S. marmoratus using RT-PCR methods. Finally, we conducted phylogenetic analyses with data obtained in this study and data of family 18 chitinases that have been entered in a database to clarify phylogenetic relations among fish chitinases.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Material</title><p>The marbled rockfish S. marmoratus was purchased from a fresh fish shop of Kanagawa (n = 3; average standard length = 25 cm; average body weight = 275 g). p-Nitrophenyl Di-N-Acetyl-β-chitobioside (pNP-(GlcNAc)<sub>2</sub>) and p-Nitrophenyl Tri-N-Acetyl-β-chitobioside (pNP-(GlcNAc)<sub>3</sub>) were purchased from Seikagaku corporation (Tokyo, Japan). p-Nitrophenyl-N-Acetyl-β-D-glucosaminide (pNP-GlcNAc) was kindly supplied by Yaizu Suisankagaku Industry Co., Ltd. (Shizuoka, Japan).</p></sec><sec id="s2_2"><title>2.2. Measurement of Chitinolytic Enzyme Activity</title><p>All organs (0.5 g) from S. marmoratus were homogenized in 3 volumes of 20 mM phosphate buffer (pH 7.3), and the homogenate was centrifuged at 9000&#215; g for 20 min 4˚C. Chitinase assays were conducted using the method of Ohtakara [<xref ref-type="bibr" rid="scirp.82114-ref26">26</xref>] , with slight modification. The assays were completed using pNP-(GlcNAc)<sub>n</sub>, (n = 1 - 3) as the substrate. The crude enzyme solutions (12.5 &#181;l) and 5 &#181;l of 4 mM pNP-(GlcNAc)<sub>n</sub> were added to 12.5 &#181;l of 0.2 M phosphate-0.1 M citrate buffer (pH 6.0). The mixture was incubated at 37˚C for 20 min, and the reaction was stopped by adding 130 &#181;l of 0.2 M sodium carbonate solution and the absorbance of the p-nitrophenol released was measured at 420 nm in a spectrophotometer. One unit of enzyme activity was defined as the amount of enzyme that was liberated by 1 &#181;mol of pNP per minute and was expressed as the activity per gram of the organs. The results are the mean of 3 replicates &#177; standard deviation.</p></sec><sec id="s2_3"><title>2.3. Effect of pH on Chitinase Activity</title><p>The effect of pH on chitinase activity was determined from the crude enzyme solutions obtained from the kidney and stomach of S. marmoratus. Chitinase activity was measured in a buffer solution with a pH between 2.0 to 8.0 by the method of distribution of chitinolytic enzymes activity, with 4 mM pNP-(GlcNAc)<sub>2</sub> as the substrate.</p></sec><sec id="s2_4"><title>2.4. Molecular Cloning of a Novel Chitinase Gene from the Kidney</title><p>Total RNA was extracted from the kidney of S. marmoratus using ISOGEN II (Nippon Gene, Tokyo, Japan), according to the manufacturer’s instructions. Total RNA concentrations and purity were measured using the NanoVue spectrophotometer (GE Healthcare, Little Chalfont, UK). The first strand of cDNA was synthesized using 1.0 μg total RNA and oligo dT primers (<xref ref-type="table" rid="table1">Table 1</xref>) with PrimeScript™ II Reverse Transcriptase (Takara Bio, Shiga, Japan) according to the manufacturer’s instructions. For the reverse transcriptase-polymerase chain reaction (RT-PCR), three degenerate primers were designed from conserved sequences of the GH family 18 chitinases of vertebrates and internal sequence amplification was performed using GoTaq<sup>&#174;</sup> Green Master Mix (Promega, Madison, USA). The primers used in this study are shown in <xref ref-type="table" rid="table1">Table 1</xref>. The first PCR was performed using cDNA as a template, and Chi3 F1 and Chi3 R as primers. The PCR parameters were 30 cycles of denaturation at 95˚C for 30 s, annealing at 50˚C for 30 s, and extension at 72˚C for 30 s. Nested PCR was performed using the products of the first PCR as templates, and Chi3 F2 and Chi3 R as primers, with the same PCR parameters as described above. cDNA fragments encoding the 3' region of SmChi-3 were amplified using S. marmoratus cDNA as the template and the primer pairs Chi3 3' F1 and 3' RACE, and Chi3 3' F2 and 3' RACE. The PCR parameters were 30 cycles of denaturation at 95˚C for 30 s, annealing at 50˚C for 30 s, and extension at 72˚C for 60 s. The 5' RACE was performed using the 5'-Full RACE Core Set (Takara Bio) according to the manufacturer’s instructions. Full length SmChi-3 was performed by PCR using specific primers (Chi3 full F and Chi3 full R) and PrimeSTAR<sup>&#174;</sup> Max DNA Polymerase (Takara Bio) with proofreading activity. The PCR products were resolved on a 2% agarose gel electrophoresis and purified using the Quantum Prep<sup>&#174;</sup> Freeze 'N Squeeze spin columns (Bio Rad, Hercules, USA). We subcloned all of the PCR products into pGEM-T Easy Vector (Promega) according to the manufacturer’s instructions.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Sequence (5'-3')</th><th align="center" valign="middle" >Length</th><th align="center" valign="middle" >Usage</th><th align="center" valign="middle" >Annealing temperature (˚C)</th></tr></thead><tr><td align="center" valign="middle" >Oligo dT</td><td align="center" valign="middle" >CTGTGAATGCTGCGACTACGATTTTTTTTTTTTTTTTTTT</td><td align="center" valign="middle" >40 mer</td><td align="center" valign="middle" >cDNA synthesis</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Chi3 F1 (F)</td><td align="center" valign="middle" >TGYTAYTTYACNAAYTGG</td><td align="center" valign="middle" >19 mer</td><td align="center" valign="middle" >Conserved region PCR</td><td align="center" valign="middle" >50.0</td></tr><tr><td align="center" valign="middle" >Chi3 F2 (F)</td><td align="center" valign="middle" >GAYATHGAYTGGGARTAYCC</td><td align="center" valign="middle" >19 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Chi3 R (R)</td><td align="center" valign="middle" >TTCCARTARTTCATNGCRTARTC</td><td align="center" valign="middle" >23 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >3'RACE (R)</td><td align="center" valign="middle" >CTGTGAATGCGACTACGAT</td><td align="center" valign="middle" >19 mer</td><td align="center" valign="middle" >3' RACE PCR</td><td align="center" valign="middle" >50.0</td></tr><tr><td align="center" valign="middle" >Chi3 3' F1 (F)</td><td align="center" valign="middle" >AAGAGGAAGTCCTCTGGAGG</td><td align="center" valign="middle" >20 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Chi3 3' F2 (F)</td><td align="center" valign="middle" >GCTGAGGGAACAGCAACTGG</td><td align="center" valign="middle" >20 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Chi3 5' R1 (R)</td><td align="center" valign="middle" >GCAGCGGAGACCATTAATC</td><td align="center" valign="middle" >19 mer</td><td align="center" valign="middle" >5' RACE PCR</td><td align="center" valign="middle" >50.0</td></tr><tr><td align="center" valign="middle" >Chi3 5' R2 (R)</td><td align="center" valign="middle" >CCAGTTGCTGTTCCCTCA</td><td align="center" valign="middle" >18 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Chi3 5' F1 (F)</td><td align="center" valign="middle" >AGGAACCATTGATGCTGGTT</td><td align="center" valign="middle" >20 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Chi3 5' F2 (F)</td><td align="center" valign="middle" >TGGCAAAGTACCTGGACTT</td><td align="center" valign="middle" >19 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Chi3 5' F3 (F)</td><td align="center" valign="middle" >CGTGATGACGTATGACTTTCATG</td><td align="center" valign="middle" >23 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Chi3 5' P</td><td align="center" valign="middle" >GTGATGTCCTGTCACGCT</td><td align="center" valign="middle" >18 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Chi3 full F (F)</td><td align="center" valign="middle" >GACATGACAAGAGACCATCCAA</td><td align="center" valign="middle" >22 mer</td><td align="center" valign="middle" >Full length amplification</td><td align="center" valign="middle" >55.0</td></tr><tr><td align="center" valign="middle" >Chi3 full R (R)</td><td align="center" valign="middle" >ACAGAGCATTTCAAACAGAGGG</td><td align="center" valign="middle" >22 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >β-actin (F)</td><td align="center" valign="middle" >GATCATGTTCGAGACCTTCAACAC</td><td align="center" valign="middle" >24 mer</td><td align="center" valign="middle" >Organ expression</td><td align="center" valign="middle" >50.0</td></tr><tr><td align="center" valign="middle" >β-actin (R)</td><td align="center" valign="middle" >TCCAATCCAGACAGAGTATTTAGC</td><td align="center" valign="middle" >24 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >SmChi-1 (F)</td><td align="center" valign="middle" >ACTAGCGTGATCAAGTTCC</td><td align="center" valign="middle" >19 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >SmChi-1 (R)</td><td align="center" valign="middle" >ACAGCTCCAATCGCGGA</td><td align="center" valign="middle" >17 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >SmChi-2 (F)</td><td align="center" valign="middle" >CTCAGTCATTTAATTCCTGA</td><td align="center" valign="middle" >20 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >SmChi-2 (R)</td><td align="center" valign="middle" >CCTGGCCAAGCTTGGGAAT</td><td align="center" valign="middle" >19 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >SmChi-3 (F)</td><td align="center" valign="middle" >CAGTCTTCTGTCAACCTAC</td><td align="center" valign="middle" >19 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >SmChi-3 (R)</td><td align="center" valign="middle" >GGTACTTTGCCATCTCTGC</td><td align="center" valign="middle" >19 mer</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap><p>The full-length amplification products of SmChi-3 carried out A-tailing, and were subcloned into pGEM-T Easy vector. Inserts were sequenced using the Big Dye Terminator Cycle Sequencing FS Ready Reaction Kit (Applied Biosystems, Waltham, USA).</p></sec><sec id="s2_5"><title>2.5. Phylogenetic Analysis of SmChi-3</title><p>Phylogenetic analysis of chitinase from several organisms was carried out using the ClustalW2 program (EMBL-EBI: The European Bioinformatics Institute, European Molecular Biology Laboratory, Hinxton, England) and the tree view program. A bacterial chitinase (GenBank: X03657) was used as the outgroup.</p></sec><sec id="s2_6"><title>2.6. Organ-Specific Genes Expressions</title><p>Total RNA was prepared for all organs from S. marmoratus. First-strand cDNA was synthesized using each total RNA (0.5 &#181;g) and an oligo dT primer, amplified using RT-PCR on the synthesized cDNA (1.0 &#181;g). SmChi-1, SmChi-2, and SmChi-3, 250 bp gene fragments, were amplified using the first-strand cDNA as the template and the primer pairs SmChi-1 (F) and SmChi-1 (R) for SmChi-1, SmChi-2 (F) and SmChi-2 (R) for SmChi-2, and SmChi-3 (F) and SmChi-3 (R) for SmChi-3 (<xref ref-type="table" rid="table1">Table 1</xref>). To determine the amount of total RNA in each organ, β-actin mRNA fragments were amplified using specific primer pairs (<xref ref-type="table" rid="table1">Table 1</xref>). The PCR parameters were 30 cycles of denaturation at 95˚C for 30 s, annealing at 50˚C for 30 s, and extension at 72˚C for 20 s.</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><sec id="s3_1"><title>3.1. Distribution of Chitinolytic Enzyme</title><p>Measurement of activity of chitinolytic enzymes in organs of S. marmoratus (<xref ref-type="fig" rid="fig1">Figure 1</xref>) revealed that the chitinase activity assayed using pNP-(GlcNAc)<sub>2</sub> and pNP-(GlcNAc)<sub>3</sub> as substrates agreed with results that were reported previously [<xref ref-type="bibr" rid="scirp.82114-ref32">32</xref>] , in which glycol chitin was used as a substrate and had the highest value in the stomach. In addition, relatively high activity also was observed in organs other than the digestive tract, including the liver, which is involved in metabolism and detoxification and contains much blood; the spleen, which is involved in blood production and storage; the kidney, which is involved in metabolism and hormone secretion; and the heart, which is involved in blood circulation. These</p><p>findings suggested a possibility that chitinases in fish have physiological roles in several, non-digestive organs, as well as having a role in the digestion of ingested chitinous substances in the stomach. In addition, while the ratio of the degradation ability for pNP-(GlcNAc)<sub>2</sub> to that for pNP-(GlcNAc)<sub>3</sub> in the stomach was approximately 1:1.5, the ratio in the kidney was 1:12.5, which considerably differed from that in the stomach. This finding suggested the presence of chitinases in the kidney that degrade pNP-(GlcNAc)<sub>3</sub> better than pNP-(GlcNAc)<sub>2</sub>, such as SmChiC in the stomach of S. marmoratus [<xref ref-type="bibr" rid="scirp.82114-ref14">14</xref>] . Hex activity measured at the same time had high values in the spleen, kidney, and heart. In fish, Hex activity in digestive organs has been thought to play a role in the degradation of (GlcNAc)<sub>n</sub> into GlcNAc, produced via the effect of chitinases in the stomach [<xref ref-type="bibr" rid="scirp.82114-ref31">31</xref>] . It has been reported that fish contain chitinous substances in their scales [<xref ref-type="bibr" rid="scirp.82114-ref33">33</xref>] , have chitin synthases [<xref ref-type="bibr" rid="scirp.82114-ref34">34</xref>] , and have a mechanism of carbohydrate metabolism [<xref ref-type="bibr" rid="scirp.82114-ref35">35</xref>] . From these findings, we thought that after ingested chitin was degraded to (GlcNAc)<sub>n</sub>, by chitinases in the stomach, S. marmoratus would degrade (GlcNAc)<sub>n</sub> into GlcNAc with chitinases and Hex, which would allow for the metabolism and use of (GlcNAc)<sub>n</sub> that had been absorbed in the intestines and transferred to the bloodstream.</p></sec><sec id="s3_2"><title>3.2. Effect of pH on Chitinase Activity</title><p>Chitinase activity of crude enzymes obtained from the stomach and kidney of S. marmoratus was measured at each pH using pNP-(GlcNAc)<sub>2</sub> as a substrate (<xref ref-type="fig" rid="fig2">Figure 2</xref>). The stomach chitinase activity was greatest at pH 2.5, but declined to 55% of the maximum at pH 5.0, and to 15% at pH 7.0. In nature, the optimum pH for chitinase activity has been shown to be 2.5, which was similar to that for chitinases obtained from the stomachs of fish including S. marmoratus [<xref ref-type="bibr" rid="scirp.82114-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref17">17</xref>] and to a property of AMCase [<xref ref-type="bibr" rid="scirp.82114-ref11">11</xref>] . On the other hand, the activity of the crude enzyme of the kidney peaked at pH 5.0 and 40% of the maximum at pH 7.0. This was similar to a property of chitotriosidase, which for which the optimum pH is 5.0 [<xref ref-type="bibr" rid="scirp.82114-ref36">36</xref>] . The optimum pH for chitinase contained in the kidney was</p><p>slightly more neutral than the optimum pH of the stomach chitinase and this finding suggested that the chitinase activity detected in the kidney was attributable to the effect of a new chitinase that was different from the stomach chitinase. Chitinases have been obtained from fish organs other than those of the digestive system; for example, previous studies have reported the activity of chitinase in the blood serum of Salmo gairdneni [<xref ref-type="bibr" rid="scirp.82114-ref37">37</xref>] and a 75 kDa chitinase obtained from the blood serum of freshwater, which has an optimum pH of 7.0 and considerable degradation capacity for 4MU(GlcNAc)<sub>2</sub> rather than 4MU(GlcNAc)<sub>3</sub>, which was used as a substrate [<xref ref-type="bibr" rid="scirp.82114-ref38">38</xref>] . Although the kidneys of S. marmoratus are also non-digestive organs, the ability of the kidney chitinase of S. marmoratus to degrade substrates and the optimum pH differed from those of the chitinase of the plasma of Oreochromis niloticus. These results demonstrated the possibility that the chitinase of the kidney of S. marmoratus is a new chitinase isozyme different from chitinases contained in the blood serum of fish.</p></sec><sec id="s3_3"><title>3.3. Molecular Cloning of SmChi-3</title><p>As a result of amplification of internal sequences of a gene of a new chitinase obtained from the kidney of S. marmoratus, 350 bp gene fragments were obtained. Analysis of base sequences of the gene fragments, conducted by the National Center for Biotechnology Information Basic Local Alignment Search Tool (NCBI Blast), showed 94% homology with fChi3 of Paralichthys olivaceus. After this analysis, unknown regions of the upstream and downstream regions of the chitinase obtained from the kidneys of S. marmoratus were amplified using the RACE method. As a result, initiation codons and termination codons were found in the upstream regions and the downstream regions, respectively. Full-length genes of the chitinase obtained from the kidney of S. marmoratus were amplified using a sense primer and an antisense primer (designed with upstream and downstream untranslated regions (UTRs) in mind, respectively) and an enzyme with proofreading activity. As a result, a 1618 bp full-length gene of the chitinase obtained from the kidney of S. marmoratus (SmChi-3) was obtained. This gene contained a 1440 bp open reading frame (ORF) encoding 480 amino acids (<xref ref-type="fig" rid="fig3">Figure 3</xref>). The base sequence of SmChi-3 and some pieces of information were registered with the database of DDBJ and an accession number (LC077733) was issued.</p><p>Molecular weight of SmChi-3 was estimated at 51 kDa based on its deduced amino acid sequence (SmChi-3) using the Compute pI/Mw tool of the Expert Protein Analysis System (ExPASy, Lausanne, Switzerland). This value is most similar to that of SmChi-1 (AB686658; 49 kDa), SmChi-2 (AB686659; 52 kDa), and chitotriosidase (51 kDa) obtained from a mammal (Rattus norvegicus), which were estimated using the same method. This value was considerably lower than the value of 75 kDa for the chitinase obtained from blood serum of O. niloticus [<xref ref-type="bibr" rid="scirp.82114-ref38">38</xref>] . <xref ref-type="fig" rid="fig4">Figure 4</xref> shows SmChi-3, two chitinases obtained from the stomach of S. marmoratus (SmChi-1 and SmChi-2) [<xref ref-type="bibr" rid="scirp.82114-ref14">14</xref>] , and the deduced amino acid</p><p>sequences of genes, corresponding to Chi-3, of four varieties of fish and their predicted domain structures for comparison. SmChi-1, SmChi-2, and SmChi-3 consisted of N-terminal signal peptides, a catalytic domain, a chitinase insertion domain, a linker region, and a chitin binding domain, and the catalytic domain contained a sequence peculiar to the active site of GH family 18 chitinase, DXXDXDXE [<xref ref-type="bibr" rid="scirp.82114-ref39">39</xref>] . While SmChi-1 and SmChi-2, like AMCase [<xref ref-type="bibr" rid="scirp.82114-ref13">13</xref>] , have repeated sequences of turn/coil-forming amino acids serine and glycine in the linker region, SmChi-3 does not have such characteristic repeated sequences. The same was true for fChi3 of P. olivaceus [<xref ref-type="bibr" rid="scirp.82114-ref16">16</xref>] , CHIT3 of Scophthalmus maximus [<xref ref-type="bibr" rid="scirp.82114-ref40">40</xref>] , and Chi-3 of Danio rerio [<xref ref-type="bibr" rid="scirp.82114-ref41">41</xref>] . Furthermore, comparison of Chi-3 of S. marmoratus, Hexagrammos otakii, Sardinops melanostictus, P. olivaceus [<xref ref-type="bibr" rid="scirp.82114-ref16">16</xref>] , and Thunnus orientalis showed homology of 45% or more probability among the five varieties of fish. These results suggested the possibility that a Chi-3 gene ubiquitously exists in fish.</p></sec><sec id="s3_4"><title>3.4. Phylogenetic Analysis of SmChi-3</title><p>Phylogenetic analysis of SmChi-3 was conducted on the basis of homology of deduced amino acid sequences of family 18 chitinases of other vertebrates and of</p><p>chitinase from Serratia marcescens, which was used as an outgroup (<xref ref-type="fig" rid="fig5">Figure 5</xref>). As a result, like in previous work [<xref ref-type="bibr" rid="scirp.82114-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref31">31</xref>] , chitinases expressed in the stomachs and lungs of mammals form an AMCase cluster, chitinases expressed in the tongue and spleen and derived from macrophages form Chitotriosidase clusters, and chitinases from the stomach of ray-finned fish form AFCase-1 and AFCase-2 clusters. However, SmChi-3 belonged neither to AFCase-1 cluster nor AFCase-2 cluster. SmChi-3 of S. marmoratus, the full-length gene sequence of which was obtained in this study, formed a new cluster that is obviously different from other chitinases, with the following chitinases registered in gene database under the various designations: SmeChi-3 of S. melanostictus, HoChi-3 of</p><p>H. otakii, AMCase of Larimichthys crocea, AMCase-like of Neolamprologus brichardi, chitotriosidase-1-like of Oryzias latipes, fChi3 of P. olivaceus, chitotriosidase-1-like of Stegastes partitus, AMCase-like of Takifugu rubripes, Chi3 of T. orientalis, chitotriosidase-1-like of Labrus bergylta (muscle) (XP_020510835), with AMCase of O. niloticus (blood) (XP_019205294), and chitotriosidase-1-like of Lates calcarifer (brain, kidney) (XP_018529975). One of the functions of chitinases in fish organs other than the stomach is said to be defense-related [<xref ref-type="bibr" rid="scirp.82114-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref38">38</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref40">40</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref41">41</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref42">42</xref>] . Examples are chitinases in blood plasma [<xref ref-type="bibr" rid="scirp.82114-ref38">38</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref42">42</xref>] and chitinases on the surface of mucous membranes, which prevent attachment to and entry of pathogens [<xref ref-type="bibr" rid="scirp.82114-ref40">40</xref>] . Because these chitinase genes of various fish, which were grouped into this new cluster, are widely distributed in the body, including in the liver, kidneys, brain, muscle, and blood, it was suggested that the chitinase genes belonging to this cluster are present in fish regardless of fish variety and have various physiological roles besides digestion and defense. We named this new cluster of fish chitinase genes Fish Chitinase-3 (FCase-3). Furthermore, because Chi-3 of S. melanostictus and that of T. orientalis branch off in this phylogenetic analysis, the FCase-3 cluster may be divided further.</p></sec><sec id="s3_5"><title>3.5. Organ-Specific Genes Expressions</title><p>Expression of SmChi-1, SmChi-2, SmChi-3, and β-actin, which is used as a housekeeping gene, in organs of S. marmoratus were analyzed by a semi-quantitative RT-PCR method and the result is shown in <xref ref-type="fig" rid="fig6">Figure 6</xref>. SmChi-1, classified into the AFCase-1 cluster, was expressed strongly in the stomach and heart and also expressed slightly in the pyloric appendage and ovary. SmChi-2, classified into the AFCase-2 cluster, was expressed strongly in the stomach and also expressed slightly in the heart. In contrast, SmChi-3, classified into the FCase-3 cluster, was newly identified in this study and was expressed in the liver and kidney, where SmChi-1 and SmChi-2 were not expressed. fChi1 of P. olivaceus [<xref ref-type="bibr" rid="scirp.82114-ref16">16</xref>] , PaChi-1 of P. argentata [<xref ref-type="bibr" rid="scirp.82114-ref31">31</xref>] , and SmeChi-1 of S. melanostictus [<xref ref-type="bibr" rid="scirp.82114-ref15">15</xref>] , which were classified into the AFCase-1 cluster in the phylogenetic analysis, were reported to be expressed strongly in the stomach and slightly in the gonad. fChi2 of P. olivaceus [<xref ref-type="bibr" rid="scirp.82114-ref16">16</xref>] , PaChi-2 of P. argentata [<xref ref-type="bibr" rid="scirp.82114-ref31">31</xref>] , and SmeChi-2 of S. melanostictus [<xref ref-type="bibr" rid="scirp.82114-ref15">15</xref>] , which were classified into the AFCase-2 cluster were reported to be expressed strongly in the stomach. Distribution of mRNA of SmChi-1 and SmChi-2 was similar to that of fish classified into AFCase-1 and AFCase-2, respectively [<xref ref-type="bibr" rid="scirp.82114-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.82114-ref31">31</xref>] . These findings indicated the possibility that AFCase-1 and AFCase-2 in fish have the same roles. In other words, SmChi-1 and SmChi-2 play roles in digestion and degradation of ingested chitin and chitin-containing organisms (which enter the stomach and pyloric appendage after initial entry into the digestive tract through the mouth), defense against chitin-containing external organisms in the gonad (ovary), and degradation of chitin oligosaccharides (GlcNAc)<sub>n</sub> transferred to blood in the heart. On the other hand, because SmChi-3 was expressed only in the liver and kidney, SmChi-3 may be a new chitinase that plays physiological roles not only in digestion, but also in metabolism and carbohydrate storage.</p></sec></sec><sec id="s4"><title>4. Conclusion</title><p>In the body of S. marmoratus, relatively high chitinase activity was observed not only in the stomach, but also in the liver, spleen, kidney, and heart. Hex activity, on the other hand, was detected widely throughout the body; especially high Hex activity was observed in the spleen, kidney, and heart. Optimum pH for a chitinase contained in the crude enzyme of the stomach of S. marmoratus was</p><p>measured using pNP-(GlcNAc)<sub>2</sub> as a substrate and was determined to be at pH 2.5. Its optimal pH was similar to that of previously reported fish stomach chitinases. On the other hand, the ratio of the degradation ability for pNP-(GlcNAc)<sub>2</sub> to that for pNP-(GlcNAc)<sub>3</sub> of a chitinase contained in the kidney and its optimum pH was different from those of previously reported chitinases obtained from the stomach of S. marmoratus and the blood plasma of O. niloticus. Molecular weight estimated from a deduced amino acid sequence of the new chitinase gene SmChi-3 (ORF, 1440 bp) obtained from the kidney of S. marmoratus in this study was 51 kDa, which was most similar to the molecular weight of chitotriosidase obtained from R. norvegicus (50 kDa), but was remarkably lower than a chitinase obtained from the blood plasma of O. niloticus (75 kDa). These findings suggested that SmChi-3 was a new chitinase that was distinct from stomach chitinases and blood plasma chitinases. Although SmChi-3 had a domain structure analogous to that previously reported for SmChi-1 and SmChi-2, SmChi-3 did not have SG repeated sequences in the linker region as observed in SmChi-1 and SmChi-2. Phylogenetic analysis revealed that SmChi-3 formed a peculiar cluster Fish Chitinase-3 (FCase-3), which is different from clusters of previously reported chitinases obtained from ray-finned fish (AFCase-1 and AFCase-2). Furthermore, because Chi-3 of T. orientalis and that of pilchard branch off in this phylogenetic analysis, the FCase-3 cluster may be divided further. Expression analysis of SmChi-1, SmChi-2, and SmChi-3 in organs made by a semi-quantitative RT-PCR method showed that expression of SmChi-3 in the liver and kidney, where SmChi-1 and SmChi-2 were not expressed. Furthermore, the results of chitinase activity measurement in the body of S. marmoratus and expression analysis of each gene suggested a possibility that chitinase activity in the kidney and liver was attributable to SmChi-3, but chitinase activity in the spleen was attributable to another chitinase different from SmChi-1, SmChi-2, and SmChi-3.</p></sec><sec id="s5"><title>Acknowledgements</title><p>This work was supported in part by College of Bioresource science, Nihon University Grant (2017).</p></sec><sec id="s6"><title>Cite this paper</title><p>Watanabe, M., Kakizaki, H., Tsukamoto, T., Fujiwara, M., Fukushima, H., Ueda, M. and Matsumiya, M. (2018) Distribution of Chitinolytic Enzyme in the Organs and Molecular Cloning of a Novel Chitinase Gene from the Kidney of Marbled Rockfish Sebastiscus marmoratus. Advances in Bioscience and Biotechnology, 9, 36-51. https://doi.org/10.4236/abb.2018.91004</p></sec></body><back><ref-list><title>References</title><ref id="scirp.82114-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Muzzarelli, R.A.A. (1977) Chitin. Pergamon Press, Oxford.</mixed-citation></ref><ref id="scirp.82114-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Khoushab, F. and Yamabhai, M. (2010) Chitin Research Revisited. Marine Drugs, 8, 1988-2012. https://doi.org/10.3390/md8071988</mixed-citation></ref><ref id="scirp.82114-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Rinaudo, M. (2006) Chitin and Chitosan: Properties and Applications. Progress in Polymer Science, 31, 603-632. https://doi.org/10.1016/j.progpolymsci.2006.06.001</mixed-citation></ref><ref id="scirp.82114-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Mei, Y.X., Chen, H.X., Zhang, J., Zhang, X.D. and Liang, Y.X. (2013) Protective Effect of Chitooligosaccharides against Cyclophosphamide-Induced Immunosuppression in Mice. International Journal of Biological Macromolecules, 62, 330-335. https://doi.org/10.1016/j.ijbiomac.2013.09.038</mixed-citation></ref><ref id="scirp.82114-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Kim, C., Shores, L., Guo, Q., Aly, A., Jeon, O.H., Kim, D.H., Bernstein, N., Bhattacharya, R., Chae, J.J., Yarema, K.J. and Elisseeff, J.H. (2016) Electrospun Microfiber Scaffolds with Anti-Inflammatory Tributanoylated N-Acetyl-D-Glucosamine Promote Cartilage Regeneration. Tissue Engineering Part A, 22, 689-697. https://doi.org/10.1089/ten.tea.2015.0469</mixed-citation></ref><ref id="scirp.82114-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Sayo, T., Sakai, S. and Inoue, S. (2004) Synergistic Effect of N-Acetylglucosamine and Retinoids on Hyaluronan Production in Human Keratinocytes. Skin Pharmacology and Physiology, 17, 77-83. https://doi.org/10.1159/000076017</mixed-citation></ref><ref id="scirp.82114-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Dahiya, N., Tewari, R. and Hoondal, G.S. (2006) Biochemical Aspects of Chitinolytic Enzymes: A Review. Applied Microbiology and Biotechnology, 71, 773-782. https://doi.org/10.1007/s00253-005-0183-7</mixed-citation></ref><ref id="scirp.82114-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Patil, R.S., Ghormade, V. and Deshpande, M.V. (2000) Chitinolytic Enzymes: An Exploration. Enzyme and Microbial Technology, 26, 473-483. https://doi.org/10.1016/S0141-0229(00)00134-4</mixed-citation></ref><ref id="scirp.82114-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Rovertus, J.D. and Monzingo, F.A. (1999) The Structure and Action of Chitinases. EXS, 87, 125-135.</mixed-citation></ref><ref id="scirp.82114-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Slamova, K., Bojarova, P., Petraskova, L. and Kren, V. (2010) β-N-Acetylhexosaminidase: What’s in a Name…? Biotechnology Advances, 28, 682-693. https://doi.org/10.1016/j.biotechadv.2010.04.004</mixed-citation></ref><ref id="scirp.82114-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Muzzarelli, R.A.A., Boudrant, J., Meyer, D., Manno, N., Demarchis, M. and Paoletti, M.G. (2012) Current Views on Fungal Chitin/Chitosan, Human Chitinases, Food Preservation, Glucans, Pectins and Inulin: A Tribute to Henribraconnot, Precursor of the Carbohydrate Polymers Science, on the Chitin Bicentennial. Carbohydrate Polymers, 87, 995-1012. https://doi.org/10.1016/j.carbpol.2011.09.063</mixed-citation></ref><ref id="scirp.82114-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Boot, R.G., Renkema, H., Strijland, A., Zonneveld, A.J.V. and Aerts, J.M.F.G. (1995) Cloning of a cDNA Encoding Chitotriosidase, a Human Chitinase Produced by Macrophages. The Journal of Biological Chemistry, 270, 26252-26256. https://doi.org/10.1074/jbc.270.44.26252</mixed-citation></ref><ref id="scirp.82114-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Boot, R.G., Blommaart, E.F.C., Swart, E., Vlugt, K.G.V.D., Bijl, N., Moe, C., Place, A. and Aerts, J.M.F.G. (2001) Identification of a Novel Acidic Mammalian Chitinase Distinct from Chitotriosidase. The Journal of Biological Chemistry, 276, 6770-6778. https://doi.org/10.1074/jbc.M009886200</mixed-citation></ref><ref id="scirp.82114-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Ikeda, M., Shirase, D., Sato, T., Ueda, M., Hirabayashi, S. and Matsumiya, M. (2014) Primary Structure and Enzymatic Properties of Chitinase Isozymes Purification from the Stomach of the Marbled Rockfish Sebastiscus marmoratus. Journal of Chitin and Chitosan Science, 2, 106-116. https://doi.org/10.1166/jcc.2014.1048</mixed-citation></ref><ref id="scirp.82114-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Kawashima, S., Ikehata, H., Tada, C., Ogino, T., Kakizaki, H., Ikeda, M., Fukushima, H. and Matsumiya, M. (2016) Stomach Chitinase from Japanese Sardine Sardinops melanostictus: Purification, Characterization, and Molecular Cloning of Chitinase Isozymes with a Long Linker. Marine Drugs, 14, 22. https://doi.org/10.3390/md14010022</mixed-citation></ref><ref id="scirp.82114-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Kurokawa, T., Tuji, S. and Suzuki, T. (2004) Molecular Cloning of Multiple Chitinase Genes in Japanese Flounder, Paralichthys olivaceus. Comparative Biochemistry and Physiology—Part B: Biochemistry &amp; Molecular Biology, 138, 255-268. https://doi.org/10.1016/j.cbpc.2004.03.015</mixed-citation></ref><ref id="scirp.82114-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Matsumiya, M., Arakane, Y., Haga, A., Muthukrishnan, S. and Kramer, K.J. (2006) Substrate Specificity of Chitinase from Two Species of Fish, Greenling, Hexagrammos otakii, and Common Mackerel, Scomber japonicus, and the Insect, Tobacco Hornworm, Manducasexta. Bioscience, Biotechnology, and Biochemistry, 70, 971-979. https://doi.org/10.1271/bbb.70.971</mixed-citation></ref><ref id="scirp.82114-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Gooday, G.W. (1999) Aggressive and Defensive Roles for Chitinases. EXS, 87, 157-169. https://doi.org/10.1007/978-3-0348-8757-1_11</mixed-citation></ref><ref id="scirp.82114-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Ogino, T., Tabata, H., Ikeda, M., Kakizaki, H. and Matsumiya, M. (2014) Purification of a Chitinase from the Posterior Salivary Gland of Common Octopus Octopus vulgaris and Its Properties. Journal of Chitin and Chitosan Science, 2, 135-142. https://doi.org/10.1166/jcc.2014.1049</mixed-citation></ref><ref id="scirp.82114-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Adrangi, S. and Faramarzi, M.A. (2013) From Bacteria to Human: A Journey into the World of Chitinases. Biotechnology Advances, 31, 1786-1795. https://doi.org/10.1016/j.biotechadv.2013.09.012</mixed-citation></ref><ref id="scirp.82114-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Merzendorfer, H. and Zimoch, L. (2003) Chitin Metabolism in Insects: Structure, Function and Regulation of Chitin Synthases and Chitinases. Journal of Experimental Biology, 206, 4393-4412. https://doi.org/10.1242/jeb.00709</mixed-citation></ref><ref id="scirp.82114-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Ahmed, N.U., Park, J.I., Jung, H.J., Kang, K.K., Hur, Y., Lim, Y.P. and Nou, I.S. (2012) Molecular Characterization of Stress Resistance-Related Chitinase Genes of Brassica rapa. Plant Physiology and Biochemistry, 58, 106-115. https://doi.org/10.1016/j.plaphy.2012.06.015</mixed-citation></ref><ref id="scirp.82114-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Karasuda, S., Tanaka, S., Kagihara, H., Yamamoto, Y. and Koga, D. (2003) Plant Chitinase as a Possible Biocontrol Agent for Use Instead of Chemical Fungicides. Bioscience, Biotechnology, and Biochemistry, 67, 221-224. https://doi.org/10.1271/bbb.67.221</mixed-citation></ref><ref id="scirp.82114-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Wang, S., Shao, B., Fu, H. and Rao, P. (2009) Isolation of a Thermostable Legume Chitinase and Study on the Antifungal Activity. Applied Microbiology and Biotechnology, 85, 313-321. https://doi.org/10.1007/s00253-009-2074-9</mixed-citation></ref><ref id="scirp.82114-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Karthik, N., Akanksha, K., Binod, P. and Pandey, A. (2014) Production, Purification and Properties of Fungal Chitinase—A Review. Indian Journal of Experimental Biology, 52, 1025-1035</mixed-citation></ref><ref id="scirp.82114-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Ohtakara, A. (1988) Chitinase and β-N-Acetylhexosaminidase from Pycnoporu cinnabarinus. Biomass Part B: Lignin, Pectin, and Chitin, 161, 462-470. https://doi.org/10.1016/0076-6879(88)61059-7</mixed-citation></ref><ref id="scirp.82114-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Henrissat, B. and Bairoch, A. (1993) New Families in the Classification of Glycosyl Hydrolases Based on Amino acid Sequence Similarities. The Journal of Biochemistry, 293, 781-788. https://doi.org/10.1042/bj2930781</mixed-citation></ref><ref id="scirp.82114-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Fukamizo, T., Koga, D. and Goto, S. (1995) Comparative Biochemistry of Chitinases-Anomeric Form of the Reaction Products. Bioscience, Biotechnology, and Biochemistry, 59, 311-313. https://doi.org/10.1271/bbb.59.311</mixed-citation></ref><ref id="scirp.82114-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Koga, D., Yoshioka, T. and Arakane, Y. (1998) HPLC Analysis of Anomeric Formation and Cleavage Pattern by Chitinolytic Enzyme. Bioscience, Biotechnology, and Biochemistry, 62, 1643-1646. https://doi.org/10.1271/bbb.62.1643</mixed-citation></ref><ref id="scirp.82114-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Ikeda, M., Kakizaki, H. and Matsumiya, M. (2017) Biochemistry of Fish Stomach Chitinase. International Journal of Biological Macromolecules, 104, 1672-1681. https://doi.org/10.1016/j.ijbiomac.2017.03.118</mixed-citation></ref><ref id="scirp.82114-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Kakizaki, H., Ikeda, M., Fukushima, H. and Matsumiya, M. (2015) Distribution of Chitinolytic Enzymes in the Organs and cDNA Cloning of Chitinase Isozymes from the Stomach of Two Species of Fish, Chub Mackerel (Scomber japonicus) and Silver Croaker (Pennahia argentata). Open Journal of Marine Science, 5, 398-411. https://doi.org/10.4236/ojms.2015.54032</mixed-citation></ref><ref id="scirp.82114-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Matsumiya, M. and Mochizuki, A. (1996) Distribution of Chitinase and β-N-Acerylhexosaminidase in the Organs of Several Fishes. Fisheries Science, 62, 150-151. https://doi.org/10.2331/fishsci.62.150</mixed-citation></ref><ref id="scirp.82114-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Kumari, S. and Rath, P.K. (2014) Extraction and Characterization of Chitin and Chitosan from (Labeo rohit) Fish Scales. Procedia Materials Science, 6, 482-489. https://doi.org/10.1016/j.mspro.2014.07.062</mixed-citation></ref><ref id="scirp.82114-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Wagner, G.P., Lo, J., Laine, R. and Almeder, M. (1993) Chitin in the Epidermal Cuticle of a Vertebrate (Paralipophrys trigloides, Blenniidae, Teleostei). Experientia, 49, 317-319. https://doi.org/10.1007/BF01923410</mixed-citation></ref><ref id="scirp.82114-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Hemre, G.I., Mommsen, T.P. and Krogdahl, A. (2002) Carbohydrates in Fish Nutrition: Effects on Growth, Glucose Metabolism and Hepatic Enzymes. Aquaculture Nutrition, 8, 175-194. https://doi.org/10.1046/j.1365-2095.2002.00200.x</mixed-citation></ref><ref id="scirp.82114-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Xiao, H.C. and Guo, P.C. (2008) Molecular Cloning and Characterization of Rat Chitotriosidase. DNA Sequence, 19, 121-129. https://doi.org/10.1080/10425170701447499</mixed-citation></ref><ref id="scirp.82114-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Lindsay, G.J.H., Walton, M.J., Adron, J.W., Hetcher, T.C., Cho, C.Y. and Cowey, C.B. (1984) The Growth of Rainbow Trout (Salmo gairdneni) Given Diets Containing Chitin and Its Relationship to Chitinolytic Enzymes and Chitin Digestibility. Aquaculture, 37, 315-324. https://doi.org/10.1016/0044-8486(84)90297-7</mixed-citation></ref><ref id="scirp.82114-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Molinari, L.M., Pedroso, R.B., Scoaris, D.O., Ueda-Nakamura, T., Nakamura, C.V. and Filho, B.P.D. (2007) Identification and Partial Characterization of a Chitinase from Nile Tilapia, Oreochromis niloticus. Comparative Biochemistry and Physiology—Part B: Biochemistry &amp; Molecular Biology, 146, 81-87. https://doi.org/10.1016/j.cbpb.2006.09.004</mixed-citation></ref><ref id="scirp.82114-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">van Aalten, D.M., Synstad, B., Brurberg, M.B., Hough, E., Riise, B.W., Eijsink, V.G. and Wierenga, R.K. (2000) Structure of a Two-Domain Chitotriosidase from Serratia marcescens at 1.9-A Resolution. Proceedings of the National Academy of Sciences, 97, 5842-5847. https://doi.org/10.1073/pnas.97.11.5842</mixed-citation></ref><ref id="scirp.82114-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Gao, C., Cai, X., Zhang, Y., Su, B., Song, H. and Li, C. (2017) Characterization and Expression Analysis of Chitinase Genes (CHIT1, CHIT2 and CHIT3) in Turbot (Scophthalmus maximus L.) Following Bacterial Challenge. Fish and Shellfish Immunology, 64, 357-366. https://doi.org/10.1016/j.fsi.2017.03.019</mixed-citation></ref><ref id="scirp.82114-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Zinan, T., Chen, S., Shousheng, L., Hongmiao, W. and Shicui, Z. (2014) Functional Characterization of Chitinase-3 Reveals Involvement of Chitinases in Early Embryo Immunity in Zebrafish. Developmental &amp; Comparative Immunology, 46, 489-498. https://doi.org/10.1016/j.dci.2014.06.008</mixed-citation></ref><ref id="scirp.82114-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Fange, R., Lundblad, G. and Lind, J. (1976) Lysozyme and Chitinase in Blood and Lymphomyeloid Tissues of Marine Fish. Marine Biology, 36, 277-282. https://doi.org/10.1007/BF00389289</mixed-citation></ref></ref-list></back></article>