<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">ABB</journal-id><journal-title-group><journal-title>Advances in Bioscience and Biotechnology</journal-title></journal-title-group><issn pub-type="epub">2156-8456</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/abb.2018.91002</article-id><article-id pub-id-type="publisher-id">ABB-82072</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  cDNA Cloning of Paramyosin from Several Kinds of Squid Mantle Muscle
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Takayuki</surname><given-names>Kajita</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yoshiko</surname><given-names>Takeda</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Saki</surname><given-names>Yoshida</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Koki</surname><given-names>Yamada</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Masahiro</surname><given-names>Matsumiya</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hideto</surname><given-names>Fukushima</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Marine Science and Resources, College of Bioresource Science, Fujisawa, Japan</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>fukushima.hideto@nihon-u.ac.jp(HF)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>19</day><month>01</month><year>2018</year></pub-date><volume>09</volume><issue>01</issue><fpage>11</fpage><lpage>25</lpage><history><date date-type="received"><day>13,</day>	<month>December</month>	<year>2017</year></date><date date-type="rev-recd"><day>26,</day>	<month>January</month>	<year>2018</year>	</date><date date-type="accepted"><day>29,</day>	<month>January</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Paramyosin is a rod-shaped muscle protein found exclusively in invertebrates, with 
  &lt;i&gt;
  α
  &lt;/i&gt;
  -helices coiled around each other to form a coiled-coil structure. Marine organisms in which the primary structure of paramyosin has been determined are mollusks, including abalone (
  &lt;i&gt;
  Haliotis discus
  &lt;/i&gt;
  ), mussels (
  &lt;i&gt;
  Mytilus galloprovincialis
  &lt;/i&gt;
  ), octopus (
  &lt;i&gt;
  Octopus bimaculoides
  &lt;/i&gt;
  ), and oyster (
  &lt;i&gt;
  Crassostrea gigas
  &lt;/i&gt;
  ). In contrast, the primary structure of squid paramyosin, which is of particular interest, has yet to be reported. In the present study, cDNA cloning of paramyosins from four squid species, the neon flying squid (
  &lt;i&gt;
  Ommastrephes bartramii
  &lt;/i&gt;
  ), the Humboldt squid (
  &lt;i&gt;
  Dosidicus gigas
  &lt;/i&gt;
  ), the golden cuttlefish (
  &lt;i&gt;
  Sepia esculenta
  &lt;/i&gt;
  ), and the clawed armhook squid (
  &lt;i&gt;
  Gonatus onyx
  &lt;/i&gt;
  ), was performed to determine the following: the 2605-bp 
  &lt;i&gt;
  O. bartramii
  &lt;/i&gt;
   paramyosin gene containing a 2574-bp open reading frame (ORF), the 2691-bp 
  &lt;i&gt;
  D. gigas
  &lt;/i&gt;
   paramyosin gene containing a 2640-bp ORF, the 2631-bp 
  &lt;i&gt;
  S. esculenta
  &lt;/i&gt;
   paramyosin gene containing a 2574 ORF, and the 2609-bp 
  &lt;i&gt;
  G. onyx
  &lt;/i&gt;
   paramyosin gene containing a 2574-bp ORF. The primary structure of the four squid paramyosins was found to contain heptad repeats and an ACD
   
  (assembly competence domain), which are characteristic of a coiled coil. A phylogenetic analysis was performed with paramyosin sequences from species including the four squid species examined in this study, the results of which indicated that the four squid paramyosins form a group independent from the paramyosins of other species, to which octopus paramyosins are closest.
 
</p></abstract><kwd-group><kwd>Paramyosin</kwd><kwd> Squid</kwd><kwd> cDNA Cloning</kwd><kwd> Mantle Muscle</kwd><kwd> Phylogenetic Analysis</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Paramyosin is a protein found exclusively in invertebrate muscles [<xref ref-type="bibr" rid="scirp.82072-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.82072-ref2">2</xref>] . Paramyosin molecules polymerize into a core structure, surrounding which myosin binds to form a thick filament that is considered to function similarly to vertebrate thick filaments [<xref ref-type="bibr" rid="scirp.82072-ref3">3</xref>] . Paramyosin constitutes 5% to 50% of invertebrate muscles depending on the species and the body part [<xref ref-type="bibr" rid="scirp.82072-ref4">4</xref>] . Under physiological conditions, α-helices with a molecular weight of approximately 100,000 coil around each other to form a coiled-coil structure [<xref ref-type="bibr" rid="scirp.82072-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.82072-ref6">6</xref>] , the primary structure of which contains a heptad repeat, a characteristic repeating pattern of seven amino acid residues represented as abcdefg [<xref ref-type="bibr" rid="scirp.82072-ref7">7</xref>] . The hydrophobic interactions between the a and d residues as well as the electrostatic interactions between the e and g residues in the paramyosin molecules confer stability to the resulting dimer.</p><p>Squid musculature consists of obliquely striated muscles that are different from vertebrate striated muscles [<xref ref-type="bibr" rid="scirp.82072-ref8">8</xref>] . Apart from mollusks, obliquely striated muscles are found in nematodes, annelids, brachiopods, and chaetognaths. Obliquely striated muscles are referred to as such due to their structure in which each filament is slightly displaced relative to the next, so that adjacent sarcomeres are arranged in an oblique pattern. The muscle fibers are further arranged helically to form spindle-shaped muscle cells.</p><p>Squid muscles are eaten in raw or cooked. As the muscle of squid is covered by four layers of skin and is tough in texture when eaten in raw, it is often prepared by scoring the surface with a knife [<xref ref-type="bibr" rid="scirp.82072-ref9">9</xref>] . It can also be highly processed into a product that is similar to fish paste, so that it is more soft and easier to chew for people of all ages. However, the processing of squid meat is unique to that of fish meat in two aspects. One is that the gel strength and the elasticity do not increase when it is left to settle, in which highly active proteases present in squid meat are believed to be involved [<xref ref-type="bibr" rid="scirp.82072-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.82072-ref11">11</xref>] . When squid meat is minced, the endogenous proteases are activated to cause the proteolysis of muscle proteins that are essential in thermal gelation, resulting in poor gel formation. The other aspect is the unique texture of squid paste compared to that of fish paste. This difference in texture has been suggested to be attributable to paramyosins present in invertebrate meats. It has also been reported that paramyosin purified from scallop adductor muscle has a high gel-forming ability [<xref ref-type="bibr" rid="scirp.82072-ref12">12</xref>] . The muscle-processing property also varies among species of squid, some of which are more suitable for sashimi and others for processed foods. It has not been clear what factor contributes their differences. The differences in texture compared to other molluscan species such as shellfish, as well as among species of squid, probably also result from differences in the properties of muscle proteins, which led us to focus on paramyosin.</p><p>Marine organisms in which the primary structure of paramyosin has been determined are mollusks, including abalone (Haliotis discus, Accession number: BAJ61596), mussels (Mytilus galloprovincialis, O96064), octopus (Octopus bimaculoides, XP-014783284), oyster (Crassostrea gigas, XP-011429255), scallops (Mizuhopecten yessoensis, XP-021345467), and a species of Lingula (Lingula anatina, XP-013380361). With regards to squid paramyosins, the amino acid composition has been described in the Japanese flying squid (Todarodes pacificus) [<xref ref-type="bibr" rid="scirp.82072-ref13">13</xref>] , although the primary structure, which is of particular interest, has yet to be reported. The determination of the primary structures of squid paramyosin is possibly available for understanding the reason of the species-specific food processing. Thus, the present study was conducted with the aim of determining the primary structure of paramyosins from the mantles of edible squid species, including three species in the order Teuthida and one species in the order Sepiida, as well as characterizing the squid paramyosins.</p></sec><sec id="s2"><title>2. Materials</title><p>Frozen mantle muscle from four squid species, O. bartramii, D. gigas, S. esculenta, and G. onyx, were purchased from IDO-SYOTEN Company (Iwate, Japan). The frozen mantle muscles were stored at −60˚C until use.<sup> </sup></p></sec><sec id="s3"><title>3. Methods</title><sec id="s3_1"><title>3.1. cDNA Cloning</title><p>Initially, total RNA was prepared from 80 mg of the mantle muscle of each species using 0.8 ml ISOGEN II solution (Nippon Gene, Tokyo, Japan) according to the manufacturer’s instructions. cDNA was synthesized using total RNA and oligo dT primers with a reverse transcriptase (Takara Bio, Shiga, Japan) according to the manufacturer’s instructions. cDNA synthesis parameters were as follows: 42˚C for 60 min, followed 70˚C for 15 min. Primers were designed from the conserved sequences of the paramyosins of oyster, mussels, abalone, and octopus previously reported. PCR, 3' RACE, and 5' RACE methods were performed to obtain a DNA fragment, and this fragment was then sequenced. PCR for first-strand cDNA synthesis was performed using a Go Taq Master Mix (Promega Corporation, Tokyo, Japan). PCR parameters for the first PCR were as follows: Initial denaturation at 95˚C for 30 s, followed by 35 cycles of 95˚C for 30 s, 55˚C for 30 s, and 72˚C for 1 min. Nested PCR was performed using the same PCR parameters, except that samples of the first PCR products were 10-fold diluted. PCR parameters for the 3' RACE analyses were as follows: Initial denaturation at 95˚C for 30 s, followed by 30 cycles of 95˚C for 30 s, 55˚C for 30 s, and 72˚C for 1 min. The 5' RACE analyses were performed using kits provided by Invitrogen (Carlsbad, CA) according to the manufacturer’s instructions. PCR for full-length cDNA cloning was performed using platinum&#174; Pfx Taq DNA polymerase (Invitrogen). The full-length PCR parameters were as follows: 95˚C for 2 min, followed by 30 cycles of 95˚C for 30 s, 51.5˚C for 30 s, and 72˚C for 3 min. DNA analysis was performed using BigDye Terminator v3.1 (Thermo Fisher Scientific, Kanagawa, Japan).</p></sec><sec id="s3_2"><title>3.2. SDS-PAGE</title><p>Sodium dodecylsulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was performed by using 12.5% commercial polyacrylamide gels (e-PAGEL, ATTO Corporation, Tokyo, Japan) according to the method of [<xref ref-type="bibr" rid="scirp.82072-ref14">14</xref>] . Mantle muscle (0.2 g) and protein dissolution solution (3.75 &#181;l) of 20 mM Tris-HCl (pH 8.0)-2% SDS-8 M urea-2% β-mercaptoethanol were mixed and boiled for 2 min. And then muscle was dissolved by stirring overnight. Prestained molecular weight markers (Bio-rad, Hercules, CA) were used as standard. The gel was stained with Coomassie Brilliant Blue (CBB) R-250 after electrophoresis for 1.5 hours and then destained overnight with 30% methanol containing 10% acetic acid.</p></sec><sec id="s3_3"><title>3.3. Amino Acid Sequence of Four Paramyosin</title><p>The polyacrylamide gel applied to 1/50 (v/v) samples to CBB stained one was stained with AE-1360 Ez Stain Silver (ATTO, Tokyo, Japan). A gel slice was cut into small pieces and destained with destaining solution (15 mM K<sub>3</sub> [Fe(CN)<sub>6</sub>], 50 mM Na<sub>2</sub>S<sub>2</sub>O<sub>3</sub>). Destained gel pieces were trypsinized as described in the manual for the In-Gel Tryptic Digestion Kit (Thermo Scientific, Waltham, MA). The peptide mixtures obtained were subjected to a nanoscale liquid chromatography-electrospray (Thermo Scientific) equipped with a captive spray ionization source (Michrom Bioresources, Auburn, CA) and an Advance UHPLC System (Michrom Bioresources).</p></sec><sec id="s3_4"><title>3.4. Phylogenetic Tree Analysis</title><p>The deduced amino acid sequences were aligned using the ClustalW program (EMBL-EBI: The European Bioinformatics Institute, European Molecular Biology Laboratory). Subsequently, a phylogenetic tree was constructed based on the neighbor-joining method using software Mega6 software [<xref ref-type="bibr" rid="scirp.82072-ref15">15</xref>] .</p></sec></sec><sec id="s4"><title>4. Results and Discussion</title><sec id="s4_1"><title>4.1. cDNA Cloning of Paramyosins from Four Squid Species</title><p>Initially, cDNA was synthesized from frozen muscle RNA. Using this cDNA as a template, PCR was performed with the primers (pmF-1,2 and pmR-1,2) designed from paramyosin sequences of oyster, octopus, abalone, and mussels, as previously reported, to obtain the internal sequence of squid paramyosins (<xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="table" rid="table1">Table 1</xref>). The obtained sequences were then used to design the internal primer for amplification of the 5' end and the 3' RACE primer to obtain the partial sequence. For S. esculenta (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)), 5' RACE was attempted, in which the partial sequence containing the start codon was successfully amplified. The obtained N-terminal untranslated region of S. esculenta paramyosin was then used to design the forward primer (pm5'-F1) and the reverse primers (pm5'-R1,2) for full-length amplification. Using the designed primers for full-length amplification, PCR was performed for the amplification of the whole length of the S. esculenta paramyosin sequence. The primers for full-length amplification were subsequently used for amplification of the whole paramyosin sequence of O. bartramii, D. gigas, and G. onyx.</p><p>The full-length amplified fragments were inserted into the T-easy vector</p><p>(Promega Corporation) for cloning. The entire base sequence of paramyosin was determined through sequence analysis for these clones. The O. bartramii paramyosin gene was cloned as a 2605-bp fragment containing a 2574-bp ORF, encoding a polypeptide of 858 amino acids. The D. gigas paramyosin gene was cloned as a 2691-bp fragment containing a 2640-bp ORF, encoding a polypeptide of 880 amino acids. The G. onyx paramyosin gene was cloned as a 2609-bp fragment containing a 2574-bp ORF, encoding a polypeptide of 858 amino acids. The S. esculenta paramyosin gene was cloned as a 2631-bp fragment containing a 2574 ORF, encoding a polypeptide of 858 amino acids. The entire base sequence and the deduced amino acid sequence obtained for O. bartramii, D. gigas,</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> The sequences of primers shown in <xref ref-type="fig" rid="fig1">Figure 1</xref></title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Sequence</th><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Sequence</th></tr></thead><tr><td align="center" valign="middle" >3'end</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >cDNA cloning</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >pm3'F-2</td><td align="center" valign="middle" >AAGTCTGCGCAAGCAGCTTG</td><td align="center" valign="middle" >pmF-1</td><td align="center" valign="middle" >GNYTNMGNGARAARGAYGARGA</td></tr><tr><td align="center" valign="middle" >pmDg3'F-1</td><td align="center" valign="middle" >TCGGAGATGAACTCAGACAGG</td><td align="center" valign="middle" >pmF-2</td><td align="center" valign="middle" >AARAARTAYGARACNGAYATHMG</td></tr><tr><td align="center" valign="middle" >pmSe3'F-1</td><td align="center" valign="middle" >CAACCGACTTTCCGATGAACTC</td><td align="center" valign="middle" >pmR-1</td><td align="center" valign="middle" >AANGCYTCNGCYTCYTCNARNC</td></tr><tr><td align="center" valign="middle" >pmGo3'F-1</td><td align="center" valign="middle" >GTTGAGGCCAACAGACTTTCTG</td><td align="center" valign="middle" >pmR-2</td><td align="center" valign="middle" >TTNCKNARNWSYTCNGCYTTYTT</td></tr><tr><td align="center" valign="middle" >3′RACE primer</td><td align="center" valign="middle" >CTGTGAATGCTGCGACTACGAT</td><td align="center" valign="middle" >pmF-3</td><td align="center" valign="middle" >GAYAAYYTNAAYGCNMGNTAYG</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >pmR-3</td><td align="center" valign="middle" >CGTTGAGTCTGTTCCGTCTAT</td></tr><tr><td align="center" valign="middle" >5'end</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >pmR-4</td><td align="center" valign="middle" >TCYTCRTCYTTYTCNCKNARNC</td></tr><tr><td align="center" valign="middle" >pmSe5'-1</td><td align="center" valign="middle" >TCTCTTACGATTGAGCTCGC</td><td align="center" valign="middle" >pmF-4</td><td align="center" valign="middle" >CARYTNATHATHGARATHGA</td></tr><tr><td align="center" valign="middle" >pmSe5'-2</td><td align="center" valign="middle" >TTCTGCAACGAGTTTCTCGG</td><td align="center" valign="middle" >pmR-5</td><td align="center" valign="middle" >TTGCTAAGTTGGTTACGC</td></tr><tr><td align="center" valign="middle" >AAP</td><td align="center" valign="middle" >GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG</td><td align="center" valign="middle" >pmR-6</td><td align="center" valign="middle" >GTTACTTTCGGATTCCTC</td></tr><tr><td align="center" valign="middle" >AUAP</td><td align="center" valign="middle" >GGCCACGCGTCGACTAGTAC</td><td align="center" valign="middle" >pmF-7</td><td align="center" valign="middle" >NATHMGNGARYTNGARGAYG</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >pmDgR-1</td><td align="center" valign="middle" >AGGCTAGTTTCCACTTCC</td></tr><tr><td align="center" valign="middle" >Full-length</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >pmSeR-1</td><td align="center" valign="middle" >CATTCTGTCGATTGGCAGTATC</td></tr><tr><td align="center" valign="middle" >pm5'-F1</td><td align="center" valign="middle" >CTTTCGGTATCACACTGC</td><td align="center" valign="middle" >pmSeR-2</td><td align="center" valign="middle" >ATTTATACGGACTCGTGC</td></tr><tr><td align="center" valign="middle" >pm5'-R1</td><td align="center" valign="middle" >GCTGCTCTATTGCGATCA</td><td align="center" valign="middle" >pmSeR-3</td><td align="center" valign="middle" >CATTCATTCTGCGTCTGAG</td></tr><tr><td align="center" valign="middle" >pm5'-R2</td><td align="center" valign="middle" >CTGCTCTATTGTGATCAGTG</td><td align="center" valign="middle" >pmGoR-2</td><td align="center" valign="middle" >TCAAGAGCACTCTCAAGTTC</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >pmGoR-7</td><td align="center" valign="middle" >ATCTTGCTAAGTTGGGTACG</td></tr></tbody></table></table-wrap><p>S. esculenta, and G. onyx paramyosins were submitted to the DNA Data Bank of Japan (DDBJ) (Accession numbers: LC272578, LC272579, LC272580, and LC272083).</p><p>In general, paramyosin forms a coiled coil structure that contains a heptad repeat consisting of hydrophobic amino acids and a 28-residue repeat consisting of charged amino acids [<xref ref-type="bibr" rid="scirp.82072-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.82072-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.82072-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.82072-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.82072-ref18">18</xref>] . In the C-terminal region, it also contains an assembly competence domain (ACD) consisting of 29 residues [<xref ref-type="bibr" rid="scirp.82072-ref19">19</xref>] , through which the paramyosin molecules are believed to polymerize. Heptad repeats were identified throughout almost the entire sequences of the four squid paramyosins (Figures 2-5), in which hydrophobic amino acids were found in many of the a and d positions [<xref ref-type="bibr" rid="scirp.82072-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.82072-ref21">21</xref>] and charged amino acids were found in the e and g positions, displaying a structure characteristic of a coiled coil. Skip residues were also identified, resulting in the modification of heptad repeats into octad repeats. The skip residues further contribute to form 28-residue repeats containing repeated sequences [<xref ref-type="bibr" rid="scirp.82072-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.82072-ref22">22</xref>] . As shown in the figures, almost the entire region of the paramyosin sequences, excluding parts of the N- and C-terminal regions, was identified to form a coiled-coil structure. The sequences were also found to end in C-terminal tail pieces.</p><p>The percentage similarity among paramyosin sequences was found to be 96% between O. bartramii and D. gigas, 88% between O. bartramii and G. onyx, 90% between O. bartramii and S. esculenta, 86% between D. gigas and G. onyx, 87% between D. gigas and S. esculenta, and 89% between G. onyx and S. esculenta</p><p>(<xref ref-type="table" rid="table2">Table 2</xref>). No clear difference was observed between the three species in the order Teuthida (O. bartramii, D. gigas, and G. onyx) and the one species in the order Sepiida (S. esculenta). The N-terminal region was found to be the region showing the least homology among the sequences of the four squid paramyosins. The amino acids in the ACD were highly conserved, showing an exact match between O. bartramii and D. gigas, and between S. esculenta and G. onyx. Only one-residue differences were observed among the sequences that did not show</p><p>an exact match.</p></sec><sec id="s4_2"><title>4.2. Amino Acid Sequence of Four Paramyosin</title><p>SDS-PAGE analysis showed that four squid mantle muscles was constituted three major myofibrillar proteins; myosin heavy chain around 250 kDa, paramyosin around 90 kDa and actin around 40 kDa (<xref ref-type="fig" rid="fig6">Figure 6</xref>). The bands of paramyosin were subjected to the analysis for amino acid sequences after destained</p><p>and trypsinized. As an example, deduced amino acid sequence of O. bartramii paramyosin and the covered regions of the peptide fragments was shown in <xref ref-type="fig" rid="fig7">Figure 7</xref>. The peptide fragments exhibited high coverage of 56.18% (484 residues). In addition, either end the tripsinized sites was K or R. Therefore, the tripsin treatment was identified as successful. The other three squids, D. gigas, S. esculenta and G. onyxalso showed high coverage of 46.36% (407 residues), 68.53% (587 residues) and 43.47% (372 residues), respectively (date not shown). From these results, it was suggested that paramyosin genes determined in this</p><p>study was actually expressed in each mantle muscles and existed as protein.</p></sec><sec id="s4_3"><title>4.3. Phylogenetic Analysis</title><p>Phylogenetic analysis of paramyosin had been reported in fluke species and tapeworm species [<xref ref-type="bibr" rid="scirp.82072-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.82072-ref24">24</xref>] . An unrooted phylogenetic tree was constructed using a total of 26 paramyosin sequences, including one sequence from one octopus species, 13 sequences from seven shellfish species, five sequences from five fluke species, and three sequences from three tapeworm species, which are all known,</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Similarities among four squid paramyosins (%)</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" >O. bartramii</th><th align="center" valign="middle" >D. gigas</th><th align="center" valign="middle" >S. esculenta</th><th align="center" valign="middle" >G. onyx</th></tr></thead><tr><td align="center" valign="middle" >O. bartramii</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >96</td><td align="center" valign="middle" >90</td><td align="center" valign="middle" >88</td></tr><tr><td align="center" valign="middle" >D. gigas</td><td align="center" valign="middle" >96</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >87</td><td align="center" valign="middle" >86</td></tr><tr><td align="center" valign="middle" >S. esculenta</td><td align="center" valign="middle" >90</td><td align="center" valign="middle" >87</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >89</td></tr><tr><td align="center" valign="middle" >G. onyx</td><td align="center" valign="middle" >88</td><td align="center" valign="middle" >86</td><td align="center" valign="middle" >89</td><td align="center" valign="middle" >-</td></tr></tbody></table></table-wrap><p>in addition to the sequences from the four squid species determined in this study, in order to examine the characteristics of the paramyosin structure (<xref ref-type="fig" rid="fig8">Figure 8</xref>, <xref ref-type="table" rid="table3">Table 3</xref>). The four squid paramyosins formed a group independent from the paramyosins of other species, to which the octopus paramyosin was most closely positioned. Fluke and tapeworm species also formed a group, whereas shellfish species remained dispersed. Shellfish species vary in shape such as univalves and bivalves, which may form independent groups. Nonetheless, these</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Species used for phylogenetic analysis</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >number</th><th align="center" valign="middle" >species name</th><th align="center" valign="middle" >number</th><th align="center" valign="middle" >species name</th></tr></thead><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Crassostrea gigas1</td><td align="center" valign="middle" >14</td><td align="center" valign="middle" >Lingula anatina2</td></tr><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" >Crassostrea gigas2</td><td align="center" valign="middle" >15</td><td align="center" valign="middle" >Schistosoma japonicum</td></tr><tr><td align="center" valign="middle" >3</td><td align="center" valign="middle" >Crassostrea gigas3</td><td align="center" valign="middle" >16</td><td align="center" valign="middle" >Clonorchis sinensis</td></tr><tr><td align="center" valign="middle" >4</td><td align="center" valign="middle" >Crassostrea gigas4</td><td align="center" valign="middle" >17</td><td align="center" valign="middle" >Schistosoma haematobium</td></tr><tr><td align="center" valign="middle" >5</td><td align="center" valign="middle" >Haliotis discus discus</td><td align="center" valign="middle" >18</td><td align="center" valign="middle" >Paragonimus westermani</td></tr><tr><td align="center" valign="middle" >6</td><td align="center" valign="middle" >Haliotis discus hannai</td><td align="center" valign="middle" >19</td><td align="center" valign="middle" >Schistosoma mansoni</td></tr><tr><td align="center" valign="middle" >7</td><td align="center" valign="middle" >Biomphalaria glabrata1</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >Echinococcus granulosus</td></tr><tr><td align="center" valign="middle" >8</td><td align="center" valign="middle" >Biomphalaria glabrata2</td><td align="center" valign="middle" >21</td><td align="center" valign="middle" >Taenia saginata</td></tr><tr><td align="center" valign="middle" >9</td><td align="center" valign="middle" >Mytilus galloprovincialis</td><td align="center" valign="middle" >22</td><td align="center" valign="middle" >Taenia solium</td></tr><tr><td align="center" valign="middle" >10</td><td align="center" valign="middle" >Mizuhopecten yessoensis1</td><td align="center" valign="middle" >23</td><td align="center" valign="middle" >Ommastrephes bartramii</td></tr><tr><td align="center" valign="middle" >11</td><td align="center" valign="middle" >Mizuhopecten yessoensis2</td><td align="center" valign="middle" >24</td><td align="center" valign="middle" >Dosidicus gigas</td></tr><tr><td align="center" valign="middle" >12</td><td align="center" valign="middle" >Octopus bimaculoides</td><td align="center" valign="middle" >25</td><td align="center" valign="middle" >Sepia esculenta</td></tr><tr><td align="center" valign="middle" >13</td><td align="center" valign="middle" >Lingula anatina1</td><td align="center" valign="middle" >26</td><td align="center" valign="middle" >Gonatus onyx</td></tr></tbody></table></table-wrap><p>shellfish species showed greater diversity compared to the other groups of species. Fluke [<xref ref-type="bibr" rid="scirp.82072-ref25">25</xref>] paramyosins showed high sequence similarities within the group, with percentages of 93% or greater. Tapeworm [<xref ref-type="bibr" rid="scirp.82072-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.82072-ref27">27</xref>] paramyosins also showed high sequence similarities with percentages of 98% or greater. Shellfish paramyosins showed lower sequence similarities compared to other groups of species, with percentages from 71% to 86%. The underlined species in <xref ref-type="fig" rid="fig6">Figure 6</xref> have multiple isoforms of paramyosin, and the respective isoforms were found close to each other. For instance, oyster is known to have four paramyosin isoforms, which all have high similarities to each other with percentages of 96% or greater. Similarly, paramyosin isoforms from two species of fresh water snail, two species of scallops, and two species of Lingula, whose sequences are registered in the database, have high similarities among their respective isoforms, with percentages exceeding 96%. For these species that are known to have multiple isoforms, the sequences were suggested to encode paramyosin genes through genome analyses. In contrast, in species whose paramyosin sequences have been determined by means of cDNA cloning, such as those in the present study (including O. bartramii, D. gigas, S. esculenta, G. onyx, and mussel species), only a single gene has been identified. Although genome databases collect the sequences of all genes from entire genome sequences, cDNA cloning identifies only those genes that are actually expressed. In the present study, a single gene was identified in each species, suggesting that only one gene is expressed in the respective organisms. That is, although two or more paramyosin genes may be present on the genome, some are considered to be pseudogenes. Pseudogenes have base sequences similar to those of normal genes, although they are not expressed in vivo. For the species that are considered to have two or more paramyosin genes, the expression of these genes will be further investigated in vivo.</p></sec></sec><sec id="s5"><title>5. Conclusions</title><p>The primary structures of four squid paramyosins were determined. In each sequence, heptad repeats (abcdefg) were identified, as well as hydrophobic amino acids in many of the a and d positions and charged amino acids in the e and g positions, representing a characteristic coiled-coil structure. A highly conserved ACD consisting of 29 residues was found in the C-terminal region, through which paramyosin molecules are suggested to polymerize.</p><p>The results of phylogenetic analysis showed that the four squid paramyosins form a group independent from the paramyosins of other species, to which octopus paramyosins are most closely related. Fluke and tapeworm paramyosins also formed independent groups, whereas shellfish paramyosins remained dispersed.</p></sec><sec id="s6"><title>Acknowledgements</title><p>This research was supported in part by a grant from a scheme to revitalize agriculture and fisheries in diester area through deploying highly advanced technology.</p></sec><sec id="s7"><title>Cite this paper</title><p>Kajita, T., Takeda, Y., Yoshida, S., Yamada, K., Matsumiya, M. and Fukushima, H. (2018) cDNA Cloning of Paramyosin from Several Kinds of Squid Mantle Muscle. Advances in Bioscience and Biotechnology, 9, 11-25. https://doi.org/10.4236/abb.2018.91002</p></sec></body><back><ref-list><title>References</title><ref id="scirp.82072-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Elfvin, M., Levine, R.J.C. and Dewey, M.M. (1976) Paramyosin in Invertebrate Muscles: Ⅰ. Identification and Localization. The Journal of Cell Biology, 71, 261-272. https://doi.org/10.1083/jcb.71.1.261</mixed-citation></ref><ref id="scirp.82072-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Levine, R.J.C, Elfvin, M., Dewey, M.M. and Walcott, B. (1976) Paramyosin in Invertebrate Muscles: Ⅱ. Content in Relation to Structure and Function. The Journal of Cell Biology, 71, 273-279. https://doi.org/10.1083/jcb.71.1.273</mixed-citation></ref><ref id="scirp.82072-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Deitiker, P.R. and Epstein, H.F. (1993) Thick Filament Substructures in Caenorhabditis elegans: Evidence for Two Populations of Paramyosin. The Journal of Cell Biology, 123, 303-311. https://doi.org/10.1083/jcb.123.2.303</mixed-citation></ref><ref id="scirp.82072-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Pante, N. (1994) Paramyosin Polarity in the Thick Filament of Molluscan Smooth Muscles. The Journal of Cell Biology, 113, 148-163. https://doi.org/10.1006/jsbi.1994.1047</mixed-citation></ref><ref id="scirp.82072-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Vinos, J., Maroto, M., Garesse, R., Marco, R. and Cervera, M. (1992) Drosophila melanogaster Paramyosin: Developmental Pattern, Mapping and Properties Deduced from Its Complete Coding Sequence. Molecular Genetics and Genomics, 231, 385-394. https://doi.org/10.1007/BF00292707</mixed-citation></ref><ref id="scirp.82072-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Cohen, C., Lanar, D.E. and Parry, D.A.D. (1987) Amino Acid Sequence and Structural Repeats in Schistosome Paramyosin Match Those of Myosin. Bioscience Reports, 7, 11-16. https://doi.org/10.1007/BF01122722</mixed-citation></ref><ref id="scirp.82072-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Watabe, S., Iwasaki, K., Funabara, D., Hirayama, Y., Nakaya, M. and Kikuchi, K. (2000) Complete Amino Acid Sequence of Mytilus anterior byssus Retractor Paramyosin and Its Putative Phosphorylation Site. Journal of Experimental Zoology, 71, 261-272.</mixed-citation></ref><ref id="scirp.82072-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Paniagua, R., Royuela, M., Garcia-Anchuelo, R.M. and Fraile, B. (1996) Ultrastructure of Invertebrate Muscle Cell Types. Histology and Histopathology, 11, 181-201.</mixed-citation></ref><ref id="scirp.82072-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Kagawa, M., Matsumoto, M. and Hatae, K. (2000) Differences in Texture among Three Varieties of Squid and the Effect of Cold Storage on the Texture. Journal of Home Economics of Japan, 51, 699-708.</mixed-citation></ref><ref id="scirp.82072-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Gomez-Guillen, M.C., Hurtado, J.L. and Montero, P. (2002) Autolysis and Protease Inhibition Effects on Dynamic Viscoelastic Properties during Thermal Gelation of Squid Muscle. Journal of Food Science, 67, 2491-2496. https://doi.org/10.1111/j.1365-2621.2002.tb08764.x</mixed-citation></ref><ref id="scirp.82072-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Park, S., Cho, S., Yoshioka, T., Kimura, M., Nozawa, H. and Seki, N. (2003) Influence of Endogenous Proteases and Transglutaminase on Thermal Gelation of Salted Squid Muscle Paste. Journal of Food Science, 68, 2473-2478. https://doi.org/10.1111/j.1365-2621.2003.tb07048.x</mixed-citation></ref><ref id="scirp.82072-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Fukuda, N., Fujiura, M., Kimura, M., Nozawa, H. and Seki, N. (2006) Thermally Induced Gelation of Paramyosin from Scallop Adductor Muscle. Fisheries Science, 72, 1261-1268.</mixed-citation></ref><ref id="scirp.82072-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Tsuchiya, T., Fukuhara, S. and Matsumoto, J.J. (1980) Physico-Chemical Properties of Squid Paramyosin. Bulletin of the Japanese Society of Scientific Fisheries, 46, 197-200. https://doi.org/10.2331/suisan.46.197</mixed-citation></ref><ref id="scirp.82072-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Laemmli, U.K. (1970) Cleavage of Structural Proteins during the Assembly of the Head of Bacteriophage T4. Nature, 227, 680-685. https://doi.org/10.1038/227680a0</mixed-citation></ref><ref id="scirp.82072-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Tamura, K., Stecher, G., Peterson, D., Filipski, A. and Kumar, S. (2013) MEGA6: Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and Evolution, 30, 2725-2729. https://doi.org/10.1093/molbev/mst197</mixed-citation></ref><ref id="scirp.82072-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Kagawa, H., Gengyo, K., McLachlan, A.D., Brenner, S. and Karn, J. (1989) Paramyosin Gene (unc-15) of Caenorhabditis elegans. Molecular Cloning, Nucleotide Sequence and Models for Thick Filament Structure. Journal of Molecular Biology, 207, 311-333. https://doi.org/10.1016/0022-2836(89)90257-X</mixed-citation></ref><ref id="scirp.82072-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Laclette, J.P., Landa, A., Arcos, L., Willms, K., Davis, A.E. and Shoemaker, C.B. (1991) Paramyosin in the Schistosoma mansoni (Trematoda) Homologue of Antigen B from Taenia solium (Cestoda). Molecular and Biochemical Parasitology, 44, 287-296. https://doi.org/10.1016/0166-6851(91)90015-X</mixed-citation></ref><ref id="scirp.82072-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Dahmen, A., Gallin, M., Schumacher, M. and Erttmann, K.D. (1993) Molecular Cloning and pre-mRNA Maturation of Onchocerca volvulus Paramyosin. Molecular and Biochemical Parasitology, 57, 335-338. https://doi.org/10.1016/0166-6851(93)90209-G</mixed-citation></ref><ref id="scirp.82072-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Cohen, C. and Parry, D.D. (1998) A Conserved C-Terminal Assembly Region in Paramyosin and Myosin Rods. Journal of Structural Biology, 122, 180-187. https://doi.org/10.1006/jsbi.1998.3983</mixed-citation></ref><ref id="scirp.82072-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Parry, D.A.D. (1981) Structure of Rabbit Skeletal Myosin. Analysis of the Amino Acid Sequence of Two Fragments from the Rod Region. Journal of Molecular Biology, 153, 459-464. https://doi.org/10.1016/0022-2836(81)90290-4</mixed-citation></ref><ref id="scirp.82072-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">McLachlan, A.D. and Karn, J. (1982) Periodic Charge Distributions in the Myosin Rod Amino Acid Sequence Match Cross-Bridge Spacings in Muscle. Nature, 299, 226-231. https://doi.org/10.1038/299226a0</mixed-citation></ref><ref id="scirp.82072-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Offer, G. (1990) Skip Residues Correlate with Bends in the Myosin Tail. Journal of Molecular Biology, 216, 213-218. https://doi.org/10.1016/S0022-2836(05)80309-2</mixed-citation></ref><ref id="scirp.82072-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Shustov, A.V., Kotelkin, A.T., Sorokin, A.V., Ternovoi, V.A. and Loktev, V.B. (2002) The Opisthorchis felineus Paramyosin: cDNA Sequence and Characterization of Its Recombinant Fragment. Parasitology Research, 88, 724-730. https://doi.org/10.1007/s00436-001-0514-2</mixed-citation></ref><ref id="scirp.82072-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Shekhovtsov, S.V., Katokhin, A.V., Romanov, K.V., Besprozvannykh, V.V., Fedorov, K.P., Yurlova, N.I., Serbina, E.A., Sithithaworn, P., Kolchanov, N.A. and Mordvinov, V.A. (2009) A Novel Nuclear Marker, Pm-int9, for Phylogenetic Studies of Opisthorchis felineus, Opisthorchis viverrini, and Clonorchis sinensis (Opisthorchiidae, Trematoda) Parasitology Research, 106, 293-297. https://doi.org/10.1007/s00436-009-1628-1</mixed-citation></ref><ref id="scirp.82072-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Park, T.J., Kang, J.M., Na, B.K. and Sohn, W.M. (2009) Molecular Cloning and Characterization of a Paramyosin from Clonorchis sinensis. The Korean Journal of Parasitology, 47, 359-367. https://doi.org/10.3347/kjp.2009.47.4.359</mixed-citation></ref><ref id="scirp.82072-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Muhlschlegel, F., Sygulla, L., Frosch, P., Massetti, P. and Frosch, M. (1993) Paramyosin of Echinococcus granulosus: cDNA Sequence and Characterization of a Tegumetal Antigen. Parasitology Research, 79, 660-666. https://doi.org/10.1007/BF00932508</mixed-citation></ref><ref id="scirp.82072-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Landa, A., Laclette, J.P., Nicholson-Weller, A. and Shoemaker, C.B. (1993) cDNA Cloning and Recombinant Expression of Collagen-Binding and Complement Inhibitor Activity of Taenia solium Paramyosin (AgB). Molecular and Biochemical Parasitology, 60, 343-348. https://doi.org/10.1016/0166-6851(93)90147-P</mixed-citation></ref></ref-list></back></article>