<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AS</journal-id><journal-title-group><journal-title>Agricultural Sciences</journal-title></journal-title-group><issn pub-type="epub">2156-8553</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/as.2018.91005</article-id><article-id pub-id-type="publisher-id">AS-81785</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Earth&amp;Environmental Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Cloning and Ectopic Expression of &lt;i&gt;ScYCF&lt;/i&gt;1 Gene from &lt;i&gt;Saccharomyces cerevisiae&lt;/i&gt; in Cotton
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Min</surname><given-names>Mu</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Na</surname><given-names>Shu</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Xuke</surname><given-names>Lu</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Xiugui</surname><given-names>Chen</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Shuai</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Junjuan</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Delong</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Weili</surname><given-names>Fan</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lixue</surname><given-names>Guo</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Chao</surname><given-names>Chen</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Wuwei</surname><given-names>Ye</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>State Key Laboratory of Cotton Biology, Chinese Academy of Agricultural Sciences Cotton Research Institute, Anyang, China</addr-line></aff><pub-date pub-type="epub"><day>08</day><month>01</month><year>2018</year></pub-date><volume>09</volume><issue>01</issue><fpage>53</fpage><lpage>68</lpage><history><date date-type="received"><day>12,</day>	<month>October</month>	<year>2017</year></date><date date-type="rev-recd"><day>14,</day>	<month>January</month>	<year>2018</year>	</date><date date-type="accepted"><day>17,</day>	<month>January</month>	<year>2018</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Yeast cadmium factor 1 (
  YCF1), is a member of the ATP-binding cassette (ABC) transporter family. To explore the functions of 
  YCF1 of 
  Saccharomyces cerevisiae (
  ScYCF1) in the cotton, 
  ScYCF1 was cloned from
   Saccharomyces cerevisiae As2.375, with the full-length of 4548 bp. The bioinformatics analysis revealed that the largest component of 
  ScYCF1 protein is leucine (12%). 
  ScYCF1 is alkaline and positive charged, stable, and hydrophilic protein. The predictive secondary structure is mainly composed of 
  α-helix areas, random coils and 
  β-sheets. We constructed the pBI121-
  ScYCF1:GFP infusion expression vector and verified it by enzyme ingestion. The transient expression results of cotton pollen showed that the green fluorescence phenomenon of three kinds of upland cotton pollen significantly increased after transforming 
  ScYCF1. The salt sensitive material upland cotton CCRI12 was transformed 
  in vivo simultaneously, and the germination ability of trans-
  ScYCF1-gene T
  <sub>0</sub> seeds was much better than the acceptor material CCRI12 under the stress of 100 mM NaCl saline solution. According to the gene nucleotide sequences, four pairs of primers were designed for molecular detection of T
  <sub>0</sub> generation, and the sequencing results of PCR products of four specific primers evidence that the transgene is successful. Salt tolerance analysis of leaf discs of identified transgenic cotton showed that the chlorophyll content of leaf discs of transgenic cotton was higher than the content of the control cotton under salt stress. 
  ScYCF1 gene was cloned and introduced into cotton, showing that 
  ScYCF1 plays an important role in improving the salt tolerance of cotton.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Saccharomyces cerevisiae&lt;/i&gt;</kwd><kwd> &lt;i&gt;ScYCF&lt;/i&gt;1</kwd><kwd> Upland Cotton</kwd><kwd> Pollen Instantaneous Expression</kwd><kwd> Molecular Detection</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Soil salinization is a phenomenon that the water-soluble salts in soil and groundwater move on with capillary water to surface soil, and the water of the top soil evaporates resulting in accumulation of salts in the soil solum or regolith [<xref ref-type="bibr" rid="scirp.81785-ref1">1</xref>] . Salinization affects about 1/5 of the world’s arable land and causes loss of 10 million hectares per year [<xref ref-type="bibr" rid="scirp.81785-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.81785-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.81785-ref4">4</xref>] .</p><p>Numerous studies showed that related salt tolerant genes of halotolerant fungi can increase the salt tolerance of fungal microorganisms and plants [<xref ref-type="bibr" rid="scirp.81785-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.81785-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.81785-ref7">7</xref>] . SOD2 of yeast was transferred into rice, and the salt tolerance of transgenic plants was improved [<xref ref-type="bibr" rid="scirp.81785-ref8">8</xref>] . Chaetomium thermophilic SOD was cloned and transferred into tobacco, and found that it cannot only improve the salt tolerance of transgenic plants but also has certain resistant activity against tobacco brown spot disease and anthracnose [<xref ref-type="bibr" rid="scirp.81785-ref9">9</xref>] . Salt tolerant gene RPL44 isolated from Aspergillus glaucus and transferred into arabidopsis and tobacco, and showed that tolerance of transgenic plants to salinization was significantly higher than the control wild-types [<xref ref-type="bibr" rid="scirp.81785-ref10">10</xref>] .</p><p>In 1996, genome sequencing of Saccharomyces cerevisiae was completed [<xref ref-type="bibr" rid="scirp.81785-ref11">11</xref>] . Nelson et al. [<xref ref-type="bibr" rid="scirp.81785-ref4">4</xref>] showed that there are more than 200 genes in the genome of Saccharomyces cerevisiae that are related to salt tolerance. It was found in the genome sequencing results that there are 31 ABC genes in the genome; phylogenetic analysis showed that the yeast ABC proteins can be divided into six different subfamilies, which are named MDR, PDR, MRP/CFTR, ALDp, YEF3 and RLI [<xref ref-type="bibr" rid="scirp.81785-ref12">12</xref>] . ScYCF1 is the member of the most studied MRP subfamily. Based on the correlation between YCF1 protein and liquid bubble detoxification, the salt tolerance experiment was conducted in arabidopsis under high salt conditions. Three weeks old arabidopsis wild type and transgenic seedlings were treated with 75,100,150 and 200 mM NaCl for 6 h and results showed that after being treated with 200 mM NaCl the accumulation amount of Na<sup>+</sup> in Arabidopsis was 26.5% higher than that in wild type, but under stress of other salt concentrations there was no significant difference between them, indicating that Arabidopsis plants with transformed ScYCF1 gene has stronger stress tolerance to NaCl than the wild type, it is because of the transgenic plants can accumulate more Na<sup>+</sup> in vacuoles [<xref ref-type="bibr" rid="scirp.81785-ref13">13</xref>] .</p><p>Cotton is one of the ideal crops for development and utilization of saline land, and improving salinity tolerance of cotton through genetic engineering and transgenic technology become an urgent demand and important direction for current cotton breeding. This study took Saccharomyces cerevisiae As2.375 as the materials, cloned ScYCF1 gene and constructed expression vector, used a gene gun in vivo conversion technology to transform upland cotton (Gossypium hirsutum L.) CCRI12, aiming to explore whether the fungi salt-tolerant gene can successfully play its function in cotton and provide a theoretical basis for obtaining new salt tolerant cotton varieties.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Experiment Material</title><p>Saccharomyces cerevisiae As2.375 is purchased from Shanghai Industrial Institute of Microbiology. The pMD18-T Vector is purchased from TaKaRa. E. coli strain DH5α, expression vector pBI121:GFP are preserved by the research group. CCRI12, GK50, Y2067 and GZ-2 were conserved in the stress-resistance identification research group of Institute of Cotton Research of CAAS.</p></sec><sec id="s2_2"><title>2.2. Cloning of Targeted Gene and Sequential Analysis</title><p>The RNA of Saccharomyces cerevisiae AS2.375 was extracted with the Ultra Clean Microbial RNA Isolation Kit (MO BIO) kit, whose concentration and purity was assessed by Nanodrop 2000 ultramicrospectrophotometer. The RNA was reversely transcribed into cDNA with ReverTra Ace qPCR RT Master Mix with gDNA Remover kit. According to the obtained cDNA as the template, the full-length gene primer was designed using the Primer Premier 5 software, 5'-end: ScYCF1-F and 3'-end: ScYCF1-R (<xref ref-type="table" rid="table1">Table 1</xref>). The full-length sequence of mRNA was amplified using 2 &#215; TransTaq-T PCR SuperMix. The amplification procedure was 94˚C 5 min, 94˚C 45 s, 55˚C 45 s, 72˚C 1 min, 40 cycles; 72˚C 10 min. The connected pMD-18T vector was transformed into competent Escherichia coli cells DH5α, and the positive clone was picked for sequencing verification. The physicochemical property of ScYCF1 protein was analyzed using the online-software ProtParam (http://web.expasy.org/protparam/), and the hydrophilic-hydrophobic property of protein was predicted by ProtScale</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used in the experiments</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primers name</th><th align="center" valign="middle" >Sequence (5' - 3')</th></tr></thead><tr><td align="center" valign="middle" >ScYCF1-F</td><td align="center" valign="middle" >ATGGCTGGTAATCTTGTTT</td></tr><tr><td align="center" valign="middle" >ScYCF1-R</td><td align="center" valign="middle" >TTAATTTTCATTGACCAAACCA</td></tr><tr><td align="center" valign="middle" >InScYCF1-F</td><td align="center" valign="middle" >CACGGGGGACTCTAGAATGGCTGGTAATCTTGTTT</td></tr><tr><td align="center" valign="middle" >InScYCF1-R</td><td align="center" valign="middle" >ACTCATACTAGTCCCGGGATTTTCATTGACCAAAC</td></tr><tr><td align="center" valign="middle" >ScYCF1-F1</td><td align="center" valign="middle" >ACGGTGTGATCCTAAATCTATCAG</td></tr><tr><td align="center" valign="middle" >ScYCF1-R1</td><td align="center" valign="middle" >AAGTTCTGCATATAGCCCATGA</td></tr><tr><td align="center" valign="middle" >ScYCF1-F2</td><td align="center" valign="middle" >GCTATGTTTCTGGTGGGCTT</td></tr><tr><td align="center" valign="middle" >ScYCF1-R2</td><td align="center" valign="middle" >CTTTTCCCTATAAGGCTTCTCCCA</td></tr><tr><td align="center" valign="middle" >ScYCF1-F3</td><td align="center" valign="middle" >GGCATAGATACGACGCGGAA</td></tr><tr><td align="center" valign="middle" >ScYCF1-R3</td><td align="center" valign="middle" >GCAGTTGTTCCAGCTCTCCT</td></tr><tr><td align="center" valign="middle" >ScYCF1-F4</td><td align="center" valign="middle" >CATCAAGGGAGTTGCGTCGT</td></tr><tr><td align="center" valign="middle" >ScYCF1-R4</td><td align="center" valign="middle" >GTGGTCTGTGGCCTTCAACT</td></tr></tbody></table></table-wrap><p>(http://web.expasy.org/protscale/). The secondary structure of protein was analyzed with SOPMA (http://npsa-prabi.ibcp.fr/cgi-bin/npsa_automat.pl?page=/MPSA/npsa_sopma.html).</p></sec><sec id="s2_3"><title>2.3. Construct Fluorescence Expression Vector pBI121-ScYCF1:GFP</title><p>The In-Fusion primer was designed on line (http://bioinfo.clontech.com/infusion) 5'-end InScYCF1-F and 3'-end InScYCF1-R (<xref ref-type="table" rid="table1">Table 1</xref>). The target sequence was obtained through amplification of the ScYCF1 plasmid as the template. The double cleavage sites Xba I and Sma I were chosen, and double enzyme digestion was performed on the expression vector pBI121:GFP. The fusion expression vector pBI121-ScYCF1:GFP was constructed with In-Fusion method, followed by recombinant clone verification and sequencing.</p></sec><sec id="s2_4"><title>2.4. Transient Expression Analysis of ScYCF1 in the Pollen from Upland Cotton</title><p>The pollen from upland cotton Y-2067, ZA-23 and GZ-3 were bombarded with portable particle gun GDS-80, and the gene expression was observed under laser scanning confocal microscope FV1000 (Olympus, Japan).</p></sec><sec id="s2_5"><title>2.5. In vivo Transformation of Cotton with Gene Gun</title><p>The powders and plasmids were treated as the way of Kong Jingjing [<xref ref-type="bibr" rid="scirp.81785-ref14">14</xref>] and the particle gun transformation in vivo was completed.</p></sec><sec id="s2_6"><title>2.6. Molecular Detection of Transgenic Cotton</title><p>Four pairs of primers were designed for ScYCF1 gene sequence, 5'-end primers were ScYCF1-F1, ScYCF1-F2, ScYCF1-F3, ScYCF1-F4 and the 3'-end primers were ScYCF1-R1, ScYCF1-R2, ScYCF1-R3, ScYCF1-R4 (<xref ref-type="table" rid="table1">Table 1</xref>). DNA from transgenic plants was extracted with CTAB method for PCR amplification, and the program is 94˚C, 5 min; 94˚C 45 s, 58˚C 45 s, 72˚C 30 s, 40 cycle; 72˚C 10 min.</p></sec><sec id="s2_7"><title>2.7. Analysis of Salt Tolerance of Trans-ScYCF1 Cotton</title><p>The germination experiment was performed on obtained T<sub>0</sub> seeds with the double walled filter paper method [<xref ref-type="bibr" rid="scirp.81785-ref14">14</xref>] , using 100 mM NaCl solution as treatment solution and water as control. Each group repeated for three times. The seeds were sent into the illumination incubator for incubation (condition of culture: 28˚C, illumination for 14 h; 25˚C, darkness for 10 h). The germination results were summarized after 7 d. Measured and compared the content of chlorophyll of the leaf discs, which obtained from the same position of 6 transgenic cotton and acceptor material CCRI12, were treated with 0, 400 and 600 mM NaCl and cultured at 28˚C under illumination conditions for 72 h to analyze salt tolerance of trans-ScYCF1 cotton.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Cloning of ScYCF1 Gene and Construction of Expression Vector</title><p>The specific primer was designed according to the full-length sequence of Saccharomyces cerevisiae ScYCF1 gene retrieved from NCBI database (GenBank: NM_001180442.3). Gene amplification was performed using cDNA as template to obtain a nucleotide sequence with a length of 4584 bp (<xref ref-type="fig" rid="fig1">Figure 1</xref>), which was connected to vector for sequencing and turned out correct. ScYCF1 gene was inserted into a plant expression vector pBI121:GFP to construct green fluorescent fusion expression vector. Digestion by restriction endonuclease Bgl ІІ was verified to be properly inserted (<xref ref-type="fig" rid="fig2">Figure 2</xref>), indicating that the expression vector was successfully constructed and was named as pBI121-ScYCF1:GFP.</p></sec><sec id="s3_2"><title>3.2. Bioinformatics Analysis</title><p>The results of bioinformatics analysis indicated that ScYCF1 gene encodes a</p><p>protein ScYCF1 with 1515 amino acid, the molecular formula of ScYCF1 protein was C7777H12253N2031O2199S54, with the molecular weight of 120.34 kDa and the isoelectronic point of 8.64, and located on the cell membrane. Amino acid composition showed that ScYCF1 protein leucine (Leu) takes up the largest proportion, 12%; which is followed by valine (Ile) and serine (Ser) taking up 8% each (<xref ref-type="fig" rid="fig3">Figure 3</xref>). With 156 positively charged alkaline amino acids (Arg + Lys) and 143 negatively charged acidic amino acid (Asp + Glu), the protein is alkaline and positively charged, the instability index is 36.15, with a half-life over 20 h, which belonged stable protein. The hydrophilicity and hydrophobicity analysis of ScYCF1 protein revealed that the quantity of hydrophobic amino acids in the protein much larger than that of hydrophilic amino acids (<xref ref-type="fig" rid="fig4">Figure 4</xref>), of which the GRAVY was 0.064 namely the whole protein was hydrophobic. The secondary structure prediction result (<xref ref-type="fig" rid="fig5">Figure 5</xref>) showed that in the protein there were 700 amino acids in α helical region, which constituted the main structure of the protein; there were 309 β-pleated sheets, accounting for 20.4%, 375 randomly coiled amino acids, accounting for 24.75%, and β-turn contains 131 amino acids, accounting for 8.65%. Thus, we could speculate that the structural and functional domain might be composed of β-pleated sheets and randomly coils.</p></sec><sec id="s3_3"><title>3.3. Transient Expression Analysis of Cotton Pollen</title><p>Cotton pollen has auto-fluorescence phenomenon. Under excitation light at a wavelength of 488 nm, the auto-fluorescence of cotton pollen is green [<xref ref-type="bibr" rid="scirp.81785-ref14">14</xref>] . According to previous findings, three varieties Y2067, ZA-23 and GZ-2 with weak auto-fluorescence [<xref ref-type="bibr" rid="scirp.81785-ref14">14</xref>] were selected to collect pollen, and gene gun in vivo conversion technology was used to bombard the cotton pollen. The study found that</p><p>after the vector pBI121-ScYCF1:GFP was bombarded, the green fluorescence of pollens of three materials was significantly enhanced (<xref ref-type="fig" rid="fig6">Figure 6</xref>), indicating that ScYCF1 can be expressed in cotton pollen, which lay the foundation of using gene gun in vivo conversion technology to obtain transgenic salt-tolerant materials in the next step.</p></sec><sec id="s3_4"><title>3.4. Salt Tolerance Analysis of T<sub>0</sub> Generation of Transgenic Cotton Seeds</title><p>Choosing 20 grains of plump and uniform transgenic ScYCF1 seeds and CCRI12 inbreds was used for salt tolerance screening experiments. The seeds treated with 100 mM NaCl solution were taken as the experimental group, and those treated with water as the control group. The result (<xref ref-type="fig" rid="fig7">Figure 7</xref>) shown that under stress from 100 mM NaCl solution, the germination capacity of transgenic seeds was significantly higher than the control seeds, and the growth capacity of the root was significantly stronger than the control group. The root length of CCRI12 inbreds and transgenic seeds in water and under stress from 100 mM NaCl was measured respectively and it was found that under two kinds of treatment, the root length of transgenic seeds was longer than that of CCRI12 inbreds, indicating that the expression of salt tolerant gene ScYCF1 can not only enhance salt tolerance of cotton seeds, but also can enhance the growing ability of them.</p></sec><sec id="s3_5"><title>3.5. Molecular Detection of Transgenic Seeds</title><p>Four pairs of primers were designed based on mRNA of ScYCF1 gene for</p><p>molecular detection of transgenic ScYCF1 plants. The length of amplified fragments of primers was 747 bp, 477 bp, 525 bp and 450 bp. The detection results were shown in <xref ref-type="fig" rid="fig8">Figure 8</xref>, expected band can be amplified from the transgenic plants and plasmid, while in the negative control CCRI12 inbreds there were no band amplified. Combining the sequencing results of PCR products (<xref ref-type="fig" rid="fig9">Figure 9</xref>), it was considered that the cotton was successfully transformed with ScYCF1 gene.</p></sec><sec id="s3_6"><title>3.6. Salt Tolerance Analysis of Leaf Discs</title><p>Salt tolerance experiments of leaf discs were conducted for six transgenic plants that were detected with correct molecular. After being treated with stress from</p><p>400 and 600 mM NaCl saline for 72 h, (<xref ref-type="fig" rid="fig1">Figure 1</xref>0) the color of the cotton leaf discs gradually turned yellow, and the leaf margin turned white, while the leaf discs under 0 mM NaCl solution remained green; Under the same concentration of saline, the color and shape of leaf discs in ScYCF1 transgenic plants were more obvious than the control leaf discs. The chlorophyll content of the leaf discs processed was measured and results showed that under three kinds of treatment, the chlorophyll content of leaf discs in transgenic plants was significantly higher than that in CCRI12; but after treated with 400 mM NaCl, there wasn’t much difference in chlorophyll content between the two groups, so it is speculated that ScYCF1 gene of Saccharomyces cerevisiae can increase the chlorophyll content of cotton and plays a significant role in the tolerance of the cotton to salt stress.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>In recent years, domestic and foreign experts have used transient expression technology to establish corresponding expression systems in wheat (Triticum monococcum), corn (Zea mays), rice (Oryza sativa), petunia (Petunia hybrid), periwinkle (Catharanthus roseus) and green algae (Chlorophyta) and other plants [<xref ref-type="bibr" rid="scirp.81785-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.81785-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.81785-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.81785-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.81785-ref19">19</xref>] . Kong Jingjing selected 26 cotton varieties to study the auto-fluorescence phenomenon of cotton pollen and results showed that the auto-fluorescence of cotton pollen is green under 288 nm excitation light, and</p><p>the auto-fluorescence of pollens of three cotton varieties (Y2067, GZ-2 and ZA-23) is weaker than it of other cotton varieties [<xref ref-type="bibr" rid="scirp.81785-ref14">14</xref>] . This study chose the three cotton varieties with weak pollen auto-fluorescence, bombarded the target gene to the pollen by a gene gun and results showed that the fluorescence of three kinds of cotton pollens was strengthened. If to transform upland cotton with genes of Saccharomyces cerevisiae, the distant genetic relationship between the two may lead to that the genes of Saccharomyces cerevisiae cannot be expressed in the upland cotton, while in the transient expression assay of cotton pollen, the expression of yeast genes was observed in a short time, which laid a foundation for successful transformation of cotton with yeast genes.</p><p>T<sub>0</sub> cotton seeds were harvested after transforming with a gene gun, but whether the yeast salt-tolerant gene can enter and be integrated into the genome of upland cotton, the size of integrated fragments, and functional performance of the target gene in the transgenic plants all needs to be further explored, therefore, detection of transgenic cotton materials is a critical step. Given that more T<sub>0</sub> generation of seeds ask for arduous testing work and the growing cycle is quite long, this study started from verification of the gene function, coerced the transgenic seeds with 100 mM NaCl solution, used double-filter paper method to filter its salt tolerance, and combined with PCR method for amplification of target gene sequences, and directly sequenced the purified fragments after amplification, which greatly reduced the time of a series of experiments including molecular detection and function verification of target genes and sped up the progress of the experiment.</p><p>Given that ScYCF1 protein is related to vacuole detoxification, salt tolerance experiments were conducted for ScYCF1 transformed arabidopsis plants under high salt conditions. Three weeks old arabidopsis wild type and transgenic seedlings were treated with 75, 100, 150 and 200 mM NaCl for 6 h and results showed that after being treated with 200 mM NaCl the accumulation amount of Na+ in Arabidopsis was 26.5% higher than that in wild type, but under stress of other salt concentrations there was no significant difference between them, indicating that Arabidopsis with transformed ScYCF1 gene has stronger stress tolerance to NaCl than the wild type, which is because that the transgenic plants can accumulate more Na+ in vacuoles [<xref ref-type="bibr" rid="scirp.81785-ref13">13</xref>] . This study conducted salt tolerance germination experiment for transgenic cotton plants with 100 mM NaCl solution and results showed that the bud length of transgenic seeds under salt stress was significantly shorter than that in water of the control group, but was longer than that of non-transgenic seeds under salt stress. Salt tolerance analysis of leaf discs in transgenic plants showed that transforming the cotton with yeast ScYCF1 improves the salt tolerance of leaf discs and plays an important role in improving the salt tolerance under high salt concentrations. The transgenic plants will be further explored in subsequent trials.</p></sec><sec id="s5"><title>5. Conclusion</title><p>The ScYCF1 gene of Saccharomyces cerevisiae were transformed and expressed in cotton and its pollen, which not only enhanced salt tolerance of cotton seeds and the growing ability of them, but also increased the chlorophyll content of cotton and played a significant role in the tolerance of the cotton to salt stress.</p></sec><sec id="s6"><title>Acknowledgements</title><p>This work was supported by National High-technology Research and Development Program (863 Program) (2013AA102601). Min Mu, Na Shu and Wuwei Ye participated in the design of the study, and performed major experiments, the data interpretation and drafted the manuscript. Xuke Lu, Xiugui Chen and Shuai Wang participated in part of the experiments. Junjuan Wang, Delong Wang, Weili Fan, Lixue Guo and Chao Chen performed part of proteomics analysis.</p></sec><sec id="s7"><title>Cite this paper</title><p>Mu, M., Shu, N., Lu, X.K., Chen, X.G., Wang, S., Wang, J.J., Wang, D.L., Fan, W.L., Guo, L.X., Chen, C. and Ye, W.W. (2018) Cloning and Ectopic Expression of ScYCF1 Gene from Saccharomyces cerevisiae in Cotton. Agricultural Sciences, 9, 53-68. https://doi.org/10.4236/as.2018.91005</p></sec></body><back><ref-list><title>References</title><ref id="scirp.81785-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Rengasamy, P. (2006) World Salinization with Emphasis on Australia. Journal of Experimental Botany, 57, 1017-1023. https://doi.org/10.1093/jxb/erj108</mixed-citation></ref><ref id="scirp.81785-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Boyer, J.S. (1982) Plant Productivity and Environment. Science, 218, 443-448. 
https://doi.org/10.1126/science.218.4571.443</mixed-citation></ref><ref id="scirp.81785-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Flowers, T.J., and Yeo, A.R. (1995) Breeding for Salinity Resistance in Crop Plants: Where Next? Australian Journal Plant Physiology, 22, 875-884. 
https://doi.org/10.1071/PP9950875</mixed-citation></ref><ref id="scirp.81785-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Nelson, D.E., Shen, B. and Bohnert, H.J. (1998) Salinity Tolerance—Mechanisms, Models and the Metabolic Engineering of Complex Traits. Genetic Engineering, 20, 153-176. https://doi.org/10.1007/978-1-4899-1739-3_9</mixed-citation></ref><ref id="scirp.81785-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Mai, Z., Yang, J., Tian, X., Li, J. and Zhang, S. (2013) Gene Cloning and Characterization of a Novel Salt-Tolerant and Glucose-Enhanced β-Glucosidase from a Marine Streptomycete. Applied Biochemistry and Biotechnology, 169, 1512-1522. 
https://doi.org/10.1007/s12010-012-0080-3</mixed-citation></ref><ref id="scirp.81785-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Jin, Y., Weining, S. and Nevo, E. (2005) A MAPK Gene from Dead Sea Fungus Confers Stress Tolerance to Lithium Salt and Freezing-Thawing: Prospects for Saline Agriculture. Proceedings of the National Academy of Sciences of the United States of America, 102, 18992-18997. https://doi.org/10.1073/pnas.0509653102</mixed-citation></ref><ref id="scirp.81785-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Kultz, D. (2003) Evolution of the Cellular Stress Proteome: From Monophyletic Origin to Ubiquitous Function. The Journal of Experimental Biology, 206, 3119-3124. 
https://doi.org/10.1242/jeb.00549</mixed-citation></ref><ref id="scirp.81785-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Zhao, F.Y., Guo, S.L., Zhang, H. and Zhao, Y.X. (2006) Expression of Yeast SOD2 in Transgenic Rice Results in Increased Salt Tolerance. Plant Science, 170, 216-224. 
https://doi.org/10.1016/j.plantsci.2005.08.017</mixed-citation></ref><ref id="scirp.81785-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, L.Q., Guo, F.X., Xian, H.Q., Wang, X.J., Li, A.N., et al. (2011) Expression of a Novel Thermostable Cu, Zn-Superoxide Dismutase from Chaetomium Thermophilum in Pichia pastoris and Its Antioxidant Properties. Biotechnology Letters, 33, 1127-1132. https://doi.org/10.1007/s10529-011-0543-6</mixed-citation></ref><ref id="scirp.81785-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Liu, X.D., Xie, L., Wei, Y., Zhou, X., Jia, B., et al. (2014) Abiotic Stress Resistance, a Novel Moonlighting Function of Ribosomal Protein RPL44 in the Halophilic Fungus Aspergillus glaucus. Applied and Environmental Microbiology, 80, 4294-4300. 
https://doi.org/10.1128/AEM.00292-14</mixed-citation></ref><ref id="scirp.81785-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Mewes, H.W., Albermann, K., Bahr, M., Frishman, D., Gleissner, A., et al. (1997) Overview of the Yeast Genome. Nature, 387, 7-65. https://doi.org/10.1038/42755</mixed-citation></ref><ref id="scirp.81785-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Bauer, B.E., Wolfger, H. and Kuchler, K. (1999) Inventory and Function of Yeast ABC Proteins: About Sex, Stress, Pleiotropic Drug and Heavy Metal Resistance. Bba-Biomembranes, 1461, 217-236. https://doi.org/10.1016/S0005-2736(99)00160-1</mixed-citation></ref><ref id="scirp.81785-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Koh, E.J., Song, W.Y., Lee, Y., Kim, K.H., Kim, K., et al. (2006) Expression of Yeast Cadmium Factor 1 (YCF1) Confers Salt Tolerance to Arabidopsis thaliana. Plant Science, 170, 534-541. https://doi.org/10.1016/j.plantsci.2005.10.007</mixed-citation></ref><ref id="scirp.81785-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Kong, J., Lu, X., Zhao, X., Yin, Z., Wang, S., et al. (2016) Cloning of SjCA Gene and Its Expression Analysis on Upland Cottons. Journal of Biomedical Engineering and Informatics, 2, 150. https://doi.org/10.5430/jbei.v2n2p150</mixed-citation></ref><ref id="scirp.81785-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Vickers, C.E., Xue, G.P. and Gresshoff, P.M. (2006) A Novel Cis-Acting Element, ESP, Contributes to High-Level Endosperm-Specific Expression in an Oat Globulin Promoter. Plant Molecular Biology, 62, 195-214.  
https://doi.org/10.1007/s11103-006-9014-1</mixed-citation></ref><ref id="scirp.81785-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Scheffler, B., Franken, P., Schutt, E., Schrell, A., Saedler, H., et al. (1994) Molecular Analysis of C1 Alleles in Zea mays Defines Regions Involved in the Expression of This Regulatory Gene. Molecular Genetics and Genomics, 242, 40-48.</mixed-citation></ref><ref id="scirp.81785-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Lange, P.D., Boer, G.J.D., Mol, J.N.M. and Kooter, J.M. (1993) Conditional Inhibition of β-Glucuronidase Expression by Antisense Gene Fragments in Petunia Protoplasts. Plant Molecular Biology, 23, 45-55. https://doi.org/10.1007/BF00021418</mixed-citation></ref><ref id="scirp.81785-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Di Fiore, S., Hoppmann, V., Fischer, R. and Schillberg, S. (2004) Transient Gene Expression of Recombinant Terpenoid Indole Alkaloid Enzymes in Catharanthus roseus Leaves. Plant Molecular Biology Reporter, 22, 15-22. 
https://doi.org/10.1007/BF02773344</mixed-citation></ref><ref id="scirp.81785-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Teng, C.Y., Qin, S., Liu, J.G., Yu, D.Z., Liang, C.W. and Tseng, C.K. (2002) Transient Expression of lacZ in Bombarded Unicellular Green Alga Haematococcus pluvialis. Journal of Applied Phycology, 14, 497-500.  
https://doi.org/10.1023/A:1022314815045</mixed-citation></ref></ref-list></back></article>