<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AS</journal-id><journal-title-group><journal-title>Agricultural Sciences</journal-title></journal-title-group><issn pub-type="epub">2156-8553</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/as.2017.812100</article-id><article-id pub-id-type="publisher-id">AS-81478</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Earth&amp;Environmental Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Genetic Diversity of Tomato (&lt;i&gt;Solanum lycopersicum&lt;/i&gt; L.) Begomovirus in Togo
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Assion</surname><given-names>Sétu Mivedor</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Justin</surname><given-names>Simon Pita</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Kossikouma</surname><given-names>Djodji Adjata</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jérôme</surname><given-names>Duclercq</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yawovi</surname><given-names>Mawuena Dieudonné Gumedzoe</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Laboratory of Plant Virology and Biotechnology (LVBV): Ecole Supérieure d’Agronomie (ESA)/University of Lome, Lomé, Togo</addr-line></aff><aff id="aff2"><addr-line>Université Félix Houphou&amp;amp;euml;t-Boigny, Laboratory of Plant Virology, P&amp;amp;ocirc;le Scientifique et d’Innovation, Bingerville, C&amp;amp;ocirc;te d’Ivoire</addr-line></aff><aff id="aff3"><addr-line>Laboratory of Agroecology, Ecophysiology and Integrative Biology (AEB), Unit EDYSAN FRE 3498 CNRS/University of Picardie
Jules Verne, Amiens, France</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>dadjata@yahoo.fr(KDA)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>28</day><month>12</month><year>2017</year></pub-date><volume>08</volume><issue>12</issue><fpage>1402</fpage><lpage>1414</lpage><history><date date-type="received"><day>5,</day>	<month>October</month>	<year>2017</year></date><date date-type="rev-recd"><day>26,</day>	<month>December</month>	<year>2017</year>	</date><date date-type="accepted"><day>29,</day>	<month>December</month>	<year>2017</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  
    Geminiviruses, in particular the members of the genus Begomovirus , are considered to be a major phytosanitary problem for tomato crops production in the world. They are responsible for yield losses of up to 20% to 100%. Regrettably, Togo is not spared from this situation. This work aims to show the genetic diversity of the begomoviruses affecting tomato crops production in Togo and their relationship with other begomoviruses. To achieve these objectives, 307 samples of tomato leaves and wild plant species with typical virus symptoms were collected in the Maritime, Plateaus, Central, Kara and Savannah regions and submitted to PCR analysis. The results revealed the presence of begomovirus in 25.40% of the analyzed samples. The PCR products obtained were submitted to direct sequencing. Phylogenetic analysis of sequences of DNA-A different regions of begomovirus identified in this work with that of other begomoviruses showed a nucleotide identity of 96% respectively for 
   Tomato leaf curl Togo virus-Fontem, Tomato Leaf Curl Togo Virus , Ageratum leaf curl Cameroon Alphasatellite; 98% respectively to 
   Tomato leaf curl Nigeria virus , Ageratum leaf curl Cameroon virus , Tomato leaf curl Cameroon virus-Fontem, 
   Ageratum leaf curl Cameroon virus and 99% respectively to 
   Tomato leaf curl Kumasi virus , Pepper yellow vein Mali virus Bazegahot and 
   Pepper yellow vein Mali virus-Ouaga. These results suggest a high degree of genetic diversity of tomato begomoviruses identified in Togo. 
  
 
</p></abstract><kwd-group><kwd>Begomoviruses</kwd><kwd> Direct Sequencing</kwd><kwd> Phylogenetic Relationships</kwd><kwd> Tomato</kwd><kwd> Wild Plants</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Begomoviruses, transmitted in persistent, circulative manner by Bemisia tabaci Gennadius (Homoptera: Aleyrodidae), are a major limiting factor for the production of many agricultural species in tropical and subtropical regions of the world [<xref ref-type="bibr" rid="scirp.81478-ref1">1</xref>] . In particular, approximately 70 species of the genus Begomovirus (family Geminiviridae) have been identified as naturally infecting tomato (Solanum lycopersicum L.) in different parts of the world [<xref ref-type="bibr" rid="scirp.81478-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.81478-ref3">3</xref>] and even in some places, these diseases have eliminated the tomato as an economically viable crop [<xref ref-type="bibr" rid="scirp.81478-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.81478-ref5">5</xref>] .</p><p>The diversity of geminiviruses is reflected in seven genera (Becurtovirus, Begomovirus, Curtovirus, Eragrovirus, Mastrevirus, Topocuvirus and Turncurtovirus), which are defined on the basis of genome structure, host range and insect vector [<xref ref-type="bibr" rid="scirp.81478-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.81478-ref7">7</xref>] . With 288 species currently recognized by the International Committee of Taxonomy of Viruses (ICTV), the genus Begomovirus is the largest genus of plant viruses in relation to the number of members it includes (http://www.ictvonline.org/virusTaxonomy.asp). Their genome is a single- stranded circular DNA that can be monopartite (containing DNA-A) or bipartite (containing both genomic DNA-A and B) [<xref ref-type="bibr" rid="scirp.81478-ref8">8</xref>] .</p><p>Based on genome organization, phylogenetic relationship and geographic distribution, begomoviruses have generally been divided into two groups: the begomoviruses of the Old World (Europe, Africa, Asia and Australia) and the begomoviruses of the New World (Americas) [<xref ref-type="bibr" rid="scirp.81478-ref9">9</xref>] . Most bipartite begomoviruses are found in the New World, while most monopartite species are found in the Old World. However, there are exceptions. Bipartite begomoviruses such as Tomato leaf curl New Delhi virus (ToLCNDV) [<xref ref-type="bibr" rid="scirp.81478-ref10">10</xref>] and Tomato yellow leaf curl Thailand virus (TYLCTHV) [<xref ref-type="bibr" rid="scirp.81478-ref11">11</xref>] are distributed in the Old World, while the monopartite Tomato yellow leaf curl virus (TYLCV) was introduced in the New World in the early 1990s and it is now widespread in the Caribbean basin and in the South America (Hawaii, Mexico and Guatemala) [<xref ref-type="bibr" rid="scirp.81478-ref12">12</xref>] .</p><p>Contrary to the considerable genetic diversity that exists among begomoviruses infecting tomato crops, the symptoms induced by these viruses are relatively similar and include varying degrees of stunting, leaf curling, mottling and yellowing. In addition, symptoms vary depending on the cultivar, host plant species, age of the plant at the infection time, environmental factors and mixed infections with other viruses or pathogens. Thus it is difficult, if not impossible, to identify the species involved in an outbreak based solely on symptoms, hence the importance of a molecular analysis for the identification of these viruses.</p><p>In Western Africa begomoviruses have emerged recently and are caused by genetically distinct species that have evolved locally, hence these regions could be an important area for new evolutionary linkages of the species within the genus [<xref ref-type="bibr" rid="scirp.81478-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.81478-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.81478-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.81478-ref15">15</xref>] .</p><p>The work aimed at studying the genetic diversity of begomoviruses infecting tomato and associated wild plants in tomato fields in Togo.</p></sec><sec id="s2"><title>2. Material and Methods</title><sec id="s2_1"><title>2.1. Sample Collection</title><p>A total of 307 samples of tomato leaves and wild plants showing typical symptoms of begomoviruses; leaf curling, yellowing, stunting and leaf thickening (<xref ref-type="fig" rid="fig1">Figure 1</xref>) were collected in 2013, 2014 and 2015 from Maritime, Plateaus, Central, Kara and Savannah regions in Togo (<xref ref-type="table" rid="table1">Table 1</xref>). Samples were also collected on wild plants in tomato fields for the search of inoculum sources of begomoviruses. For molecular analyses, samples were dried in an oven at 40˚C. It is important to notice that the variability in the number of collected samples is due to the fact that the sampling protocol used, required that tomato fields should be separated from each other of 10 km in order to take geo-referenced positions.</p></sec><sec id="s2_2"><title>2.2. DNA Extraction and PCR Running</title><p>Total nucleic acids were extracted from symptomatic tomato plants and wild plants through the methods adapted by [<xref ref-type="bibr" rid="scirp.81478-ref16">16</xref>] ; 150 mg of desiccated tissue was ground in 500 μL of extraction buffer (2% de CTAB, 1, 4 M NaCl, 20 mM EDTA, 100 mM Tris-HCl, 1% PVP, pH 8, 0 and 0, 2% β-mercapto&#233;thanol) and incubated at 60˚C for 30 min. The mixture was kept on ice for 10 min followed by centrifugation at 13,000 rpm for 15 minutes at 4˚C. The supernatant was transferred to a new vial and diluted with distilled water before using in Polymerase Chain Reaction (PCR) reaction.</p><p>Begomoviruses identification was performed by PCR using six pairs of universal primers able to amplify the different regions of the component DNA-A</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Number of tomato and wild plants infected leaf samples in tomato production regions in Togo</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Regions</th><th align="center" valign="middle" >Samples from Tomato</th><th align="center" valign="middle" >Samples from wild plants</th></tr></thead><tr><td align="center" valign="middle" >Maritime</td><td align="center" valign="middle" >41</td><td align="center" valign="middle" >54</td></tr><tr><td align="center" valign="middle" >Plateaus</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >5</td></tr><tr><td align="center" valign="middle" >Central</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >5</td></tr><tr><td align="center" valign="middle" >Kara</td><td align="center" valign="middle" >74</td><td align="center" valign="middle" >32</td></tr><tr><td align="center" valign="middle" >Savannah</td><td align="center" valign="middle" >46</td><td align="center" valign="middle" >31</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >180</td><td align="center" valign="middle" >127</td></tr></tbody></table></table-wrap><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Primers used in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primers</th><th align="center" valign="middle" >Sequences 5’ ------------------------------3’</th><th align="center" valign="middle" >Length (bp)</th><th align="center" valign="middle" >Amplified region (DNA-A)</th><th align="center" valign="middle" >PCR Conditions</th><th align="center" valign="middle" >References</th></tr></thead><tr><td align="center" valign="middle" >AVcore ACcore</td><td align="center" valign="middle" >GCCHATRTAYAGRAAGCCNAGRAT GGRTTDGARGCATGHGTACANGCC</td><td align="center" valign="middle" >575</td><td align="center" valign="middle" >CP</td><td align="center" valign="middle" >94˚C /2min, 35 &#215; (94˚C 1 mn/60˚C 2 mn/72˚C 2 mn) 72˚C /10min</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.81478-ref17">17</xref>]</td></tr><tr><td align="center" valign="middle" >Av494 Ac1048</td><td align="center" valign="middle" >GCCYATRTAYAGRAAGCCMAG GGRTTDGARGCATGHGTACATG</td><td align="center" valign="middle" >550</td><td align="center" valign="middle" >CP</td><td align="center" valign="middle" >94˚C /2 min, 35 &#215; (94˚C 1 mn/55˚C 2 mn/72˚C 1 mn) 72˚C/10min</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.81478-ref18">18</xref>]</td></tr><tr><td align="center" valign="middle" >Deng A Deng B</td><td align="center" valign="middle" >TAATATTACCKGWKGVCCSC TGGACYTTRCAWGGBCCTTCACA</td><td align="center" valign="middle" >520</td><td align="center" valign="middle" >CP</td><td align="center" valign="middle" >94˚C /2 min, 30 &#215; (94˚C 1mn/61˚C 1 mn/72˚C 2 mn) 72˚C/10min</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.81478-ref19">19</xref>]</td></tr><tr><td align="center" valign="middle" >PALIc 1960 PARIv 722</td><td align="center" valign="middle" >ACNGGNAARACNATGTGGGC GGNAARATHTGGATGGA</td><td align="center" valign="middle" >1200</td><td align="center" valign="middle" >AC1,AC2,AC3, CP</td><td align="center" valign="middle"  rowspan="2"  >94˚C /2 min, 30 &#215; (94˚C 1 mn/55˚C 2 mn/72˚C 2 mn) 72˚C/10min</td><td align="center" valign="middle"  rowspan="2"  >[<xref ref-type="bibr" rid="scirp.81478-ref20">20</xref>]</td></tr><tr><td align="center" valign="middle" >PAR1c 496 PCRv 181</td><td align="center" valign="middle" >AATACTGCAGGGCTTYCTRTACATRGG TAATATTACCGGWTGGCC</td><td align="center" valign="middle" >500</td><td align="center" valign="middle" >CP</td></tr><tr><td align="center" valign="middle" >TYv 2664 TYc138</td><td align="center" valign="middle" >ATTGACCAAGATTTTTACACTTATCCC AAGTGGGTCCCACATATTGCAAGAC</td><td align="center" valign="middle" >316</td><td align="center" valign="middle" >IR</td><td align="center" valign="middle" >94˚C/5 min, 30&#215; (94˚C/1min, 62˚C/45 sec, 72˚C/1min.), 1&#215; (94˚C/1 min, 56˚C/1 min, 72˚C/10 min).</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.81478-ref21">21</xref>]</td></tr></tbody></table></table-wrap><p>D = A, G, T; H = A, C, T; K = G, T; M = A, C; N = A, C, G, T; R = A, G; W = A, T; Y = C, T</p><p>according to protocols of [<xref ref-type="bibr" rid="scirp.81478-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.81478-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.81478-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.81478-ref20">20</xref>] and [<xref ref-type="bibr" rid="scirp.81478-ref21">21</xref>] (<xref ref-type="table" rid="table2">Table 2</xref>). The universal primer pair Avcore/ACcore [<xref ref-type="bibr" rid="scirp.81478-ref17">17</xref>] which amplify a 575 nucleotide fragment corresponding to the core region of coat protein (CP) gene of almost all begomoviruses. Two sets of Begomovirus group specific universal primers Deng A/Deng B primers [<xref ref-type="bibr" rid="scirp.81478-ref19">19</xref>] and Av494/Ac1048 [<xref ref-type="bibr" rid="scirp.81478-ref18">18</xref>] which are capable to amplify the core CP of many begomoviruses were used for viral detection. The primer pair PALIc1960/PARI722 produces a 1.2 Kb band upon PCR and had been designed to amplify the bottom half region of the A genome component of most WTGs [<xref ref-type="bibr" rid="scirp.81478-ref20">20</xref>] . Primers PAR1c496/PCRv181 [<xref ref-type="bibr" rid="scirp.81478-ref20">20</xref>] amplify ~300 bp of the A component that contains ~172 bp of region between the beginning of the loop and the beginning of the CP and~126 bp of the CP. Primers TYv2664/TYc138 were used to amplify the IR of TYLCV-Mld.</p><p>The parameters for the PCR reaction were optimized for 25 μl. The final concentrations of reaction components were: 200 &#181;M deoxynucleotide triphosphate (dNTPs), 1x Taq DNA polymerase buffer, 2.5 mM MgCl<sub>2</sub>, 0.8 units Taq DNA polymerase, 1 μM of each complementary and virus-sense primers and 2 μl of DNA. PCR cycle parameters were as described in <xref ref-type="table" rid="table2">Table 2</xref>. All PCR reactions were performed in a programmable thermocycler (Mastercycler ep gradient S, Eppendorf, Hamburg, Germany).</p><p>The amplified products, along with 10 kb DNA ladder, were resolved in 1% agarose gel in Tris-borate EDTA (TBE), pH 8.0 buffer with 10 &#181;l/100ml GelGreenTM. Gel electrophoresis was carried out at 70 V until tracking dye has reached the bottom of the gel. The DNA bands were viewed and photographed using a gel documentation system (BioRad, Hercules, CA, USA).</p></sec><sec id="s2_3"><title>2.3. Sequencing and Phylogenetic Analysis</title><p>PCR products from amplifications were purified using the Agentcourt AMPure XP magnetic beads (Beckman Coulter, Inc. 250 S. Kraemer Blvd. Brea, CA 92821 USA) according to the manufacturer’s protocol. The Illumina Nextera XT Index kit (Illumina Inc., San Diego, CA, USA) was used according to the manufacturer’s instructions to assign a code to each sample prior to sequencing. The purity of the PCR products was verified at the Agilent Bioanalyzer 2100 (Agilent Technologies, Palo Alto, CA, USA) and the sequencing was performed at the UPJV Molecular Biology platform via the high throughput technique using the kit V2 of the Illumina Miseq (Illumina Inc., San Diego, CA, USA).</p><p>The partial sequences were assembled using the FROG software (http://bioinfo.genotoul.fr/fileadmin/user_upload/FROGS_poster_Jobim_2015.pdf) and aligned with the sequences available in the GenBank database using the BLASTn algorithm (http://www.ncbi.nlm.nih.gov). The multiple alignment of the sequences was obtained with the ClustalX software [<xref ref-type="bibr" rid="scirp.81478-ref22">22</xref>] with default parameters. Phylogenetic analyze was performed by the Neighbor-Joining method using Darwin5. A thousand Bootstrap replicas were used to evaluate the robustness of the topology of the final tree. The nucleotide sequences of isolates Tomato geminiviruses Lebanon (TOGV-LB), Tomato geminiviruses Gezira (TOGV-SD), Tomato yellow leaf curl virus-Puerto Rico (TYLCV-PR), Tomato geminiviruses Kuwait (TYLCV-KU), Tomato yellow leaf curl virus-Reunion (TYLCV-RU), Tomato yellow leaf curl virus―Egypt (TYLCV-EG), Tomato yellow leaf curl virus―Israel (TYLCV-IS), Tomato yellow leaf curl virus-Mild [Spain7297] (TYLCV-SP), Tomato yellow leaf curl virus―Mild [Shizuokua] (TYLCV-JP), Tomato yellow leaf curl virus―Cuba (TYLCV-CU), Tomato yellow leaf curl Mali virus (TYLCV-ML), Tomato leaf curl Nigeria virus (ToLCNGV), Tomato leaf curl Cameroon virus―Fontem (ToLCCMV-Fontem) and Pepper yellow vein Mali virus-Ouagadougou (PepYVMLV-OUAGA) were included in the analysis.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Begomoviruses Identification by PCR</title><p>A total of 307 samples among with, 180 samples from tomatoes and 127 from wild plants were collected and based on PCR analysis, 66 tomatoes and 12 wild plants were revealed to be positive for the presence of begomoviruses. In the Maritime Region, 10.52% of the samples analyzed were positive, 53.84% in the Plateaus region, 31.25% in the Central Region, 44.33% in the Kara region and 11.68% in the Savannah region (<xref ref-type="table" rid="table3">Table 3</xref>). Surprisingly, no infection by begomoviruses was reported in Kpendjal Prefecture. These results could suggest that the insect vector B. tabaci is not present in the environment. The results obtained from PCR showed that the isolate TYLCV-Mild was not detected in all the collected samples. Different fragment sizes were obtained from five geminiviruses</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Percentage of samples infected by begomoviruses in the five economic regions of Togo</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Regions of Togo</th><th align="center" valign="middle" >Number of collected samples tomatoes (Solanum lycopersicum)</th><th align="center" valign="middle" >Number of samples reacted positively to PCR</th><th align="center" valign="middle" >Number of collected samples wild plants</th><th align="center" valign="middle" >Number of samples reacted positively to PCR</th><th align="center" valign="middle" >Percent disease incidence (%)</th></tr></thead><tr><td align="center" valign="middle" >Maritime</td><td align="center" valign="middle" >41</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >54</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >10.52</td></tr><tr><td align="center" valign="middle" >Plateaus</td><td align="center" valign="middle" >8</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >53.84</td></tr><tr><td align="center" valign="middle" >Central</td><td align="center" valign="middle" >11</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >31.25</td></tr><tr><td align="center" valign="middle" >Kara</td><td align="center" valign="middle" >74</td><td align="center" valign="middle" >44</td><td align="center" valign="middle" >32</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >44.33</td></tr><tr><td align="center" valign="middle" >Savannah</td><td align="center" valign="middle" >46</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >31</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >11.68</td></tr><tr><td align="center" valign="middle" >Total of Togo</td><td align="center" valign="middle" >180</td><td align="center" valign="middle" >66</td><td align="center" valign="middle" >127</td><td align="center" valign="middle" >12</td><td align="center" valign="middle" >25.40</td></tr></tbody></table></table-wrap><p>primer pairs (<xref ref-type="fig" rid="fig2">Figure 2</xref>).</p></sec><sec id="s3_2"><title>3.2. Sequence Analysis and Identification of New Viruses</title><p>A total of 123 PCR products including 111 from tomato and 12 from wild plants were fully sequenced to identify the different species of the genus Begomovirus. Partial sequences up to 500 nucleotides were obtained from each reaction and processed with the FROG software (http://bioinfo.genotoul.fr/fileadmin/user_upload/FROGS_poster_Jobim_2015.pdf). These partial sequences were compared to sequences published in GenBank using the BLASTn algorithm (http://www.ncbi.nlm.nih.gov). This comparison showed that the degree of similarity was between 95% and 100%. Moreover, the alignment enabled to observe that 11 sequences were close to Tomato leaf curl Nigeria virus (FJ685621.1), 15 to Ageratum leaf curl Cameroon virus (FR873228.1; FR873230; FN675292.1), 7 to Tomato leaf curl Kumasi virus (EU847739.1; FM210063.1; FM210062.1), 2 to Tomato leaf curl Togo virus (FJ685620.1; HE659517.1), 1 from Tomato leaf curl Cameroon virus-Fontem (HE659516.1), 1 to Pepper yellow vein Mali virus―Bazegahot (FM876848.1) and 1 to Pepper yellow vein Mali virus―Ouaga (FM876851.1). 123 PCR products were fully sequenced but only 49 sequences available were obtained among which 10 did not show any similarity with Genbank sequences (<xref ref-type="table" rid="table4">Table 4</xref>).</p></sec><sec id="s3_3"><title>3.3. Phylogenetic Analysis</title><p>Phylogenetic analysis was performed with the partial sequences of Togo isolates and control sequences available in GenBank using ClustalX multiple alignment software. The phylogenetic tree was designed using the DARWin5 program and the Neighbor-Joining method. Of the positive PCR samples, 44 sequences from tomato and 4 from wild plants were selected for phylogenetic analysis. This analysis indicated that the Begomoviruses isolated in Togo form seven groups (<xref ref-type="fig" rid="fig3">Figure 3</xref>). Groups 1 and 2 contain begomovirus isolates from tomato and two from wild plants Solanum macrocarpon (L.) and Euphorbia heterophylla (L.). Groups 3, 4 and 5 contain only Begomovirus isolates from tomato. Most of GenBank isolates and Group 7 contain both GenBank and tomato isolates.</p><table-wrap-group id="4"><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> Comparison of Begomovirus sequences isolated in Togo with those of Genbank</title></caption><table-wrap id="4_1"><table><tbody><thead><tr><th align="center" valign="middle" >N˚</th><th align="center" valign="middle" >Origin</th><th align="center" valign="middle" >Code of samples and host plants</th><th align="center" valign="middle" >Genbank virus</th><th align="center" valign="middle" >Degree of similarity</th></tr></thead><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >Maritime Region</td><td align="center" valign="middle" >16-83a/2014 (Tomato)</td><td align="center" valign="middle" >Ageratum leaf curl Cameroon virus [CM:AGFG24:2009] |FR873228.1|</td><td align="center" valign="middle" >98%</td></tr><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" >Maritime Region</td><td align="center" valign="middle" >16-83b/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Togo virus-Fontem |HE659517.1|</td><td align="center" valign="middle" >96%</td></tr><tr><td align="center" valign="middle" >3</td><td align="center" valign="middle" >Maritime Region</td><td align="center" valign="middle" >16-83c/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Nigeria virus-[Nigeria:2006] |FJ685621.1</td><td align="center" valign="middle" >98%</td></tr><tr><td align="center" valign="middle" >4</td><td align="center" valign="middle" >Maritime Region</td><td align="center" valign="middle" >16-83f/2014 (Tomato)</td><td align="center" valign="middle" >No found</td><td align="center" valign="middle" >NS</td></tr><tr><td align="center" valign="middle" >5</td><td align="center" valign="middle" >Maritime Region</td><td align="center" valign="middle" >16-93/2014 (Tomato)</td><td align="center" valign="middle" >No found</td><td align="center" valign="middle" >NS</td></tr><tr><td align="center" valign="middle" >6</td><td align="center" valign="middle" >Maritime Region</td><td align="center" valign="middle" >35-71a/2013 (Tomato)</td><td align="center" valign="middle" >No found</td><td align="center" valign="middle" >NS</td></tr><tr><td align="center" valign="middle" >7</td><td align="center" valign="middle" >Maritime Region</td><td align="center" valign="middle" >35-71b/2013 (Tomato)</td><td align="center" valign="middle" >No found</td><td align="center" valign="middle" >NS</td></tr><tr><td align="center" valign="middle" >8</td><td align="center" valign="middle" >Maritime Region</td><td align="center" valign="middle" >35-76/2013 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Togo virus-[Togo:2006] |FJ685620.1|</td><td align="center" valign="middle" >96%</td></tr><tr><td align="center" valign="middle" >9</td><td align="center" valign="middle" >Maritime Region</td><td align="center" valign="middle" >35-82/2013 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Nigeria virus-[Nigeria:2006] |FJ685621.1|</td><td align="center" valign="middle" >99%</td></tr><tr><td align="center" valign="middle" >10</td><td align="center" valign="middle" >Central Region</td><td align="center" valign="middle" >30-233/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Nigeria virus-[Nigeria:2006] |FJ685621.1|</td><td align="center" valign="middle" >99%</td></tr><tr><td align="center" valign="middle" >11</td><td align="center" valign="middle" >Central Region</td><td align="center" valign="middle" >27-235a/2014 (Tomato)</td><td align="center" valign="middle" >Ageratum leaf curl Cameroon virus [CM:AGFG24:2009] |FR873228.1|</td><td align="center" valign="middle" >99%</td></tr><tr><td align="center" valign="middle" >12</td><td align="center" valign="middle" >Central Region</td><td align="center" valign="middle" >27-235b/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Nigeria virus-[Nigeria:2006] |FJ685621.1|</td><td align="center" valign="middle" >99%</td></tr><tr><td align="center" valign="middle" >13</td><td align="center" valign="middle" >Central Region</td><td align="center" valign="middle" >27-235c/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Kumasi virus clone (GOTB2-2)|EU847739.1|</td><td align="center" valign="middle" >99%</td></tr><tr><td align="center" valign="middle" >14</td><td align="center" valign="middle" >Central Region</td><td align="center" valign="middle" >27-235d/2014 (Tomato)</td><td align="center" valign="middle" >Ageratum leaf curl Cameroon virus [CM:AGFG23:2009] |FR873230.1|</td><td align="center" valign="middle" >98%</td></tr><tr><td align="center" valign="middle" >15</td><td align="center" valign="middle" >Central Region</td><td align="center" valign="middle" >27-235e/2014 (Tomato)</td><td align="center" valign="middle" >Ageratum leaf curl Cameroon alphasatellite [CM:ODL1D1:Ok:09] |FN675292.1|</td><td align="center" valign="middle" >96%</td></tr><tr><td align="center" valign="middle" >16</td><td align="center" valign="middle" >Plateaus Region</td><td align="center" valign="middle" >25-10a/2015 (Tomato)</td><td align="center" valign="middle" >No found</td><td align="center" valign="middle" >NS</td></tr><tr><td align="center" valign="middle" >17</td><td align="center" valign="middle" >Plateaus Region</td><td align="center" valign="middle" >25-11a/2015 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Kumasi virus clone (GOTB2-2)|EU847739.1|</td><td align="center" valign="middle" >96%</td></tr><tr><td align="center" valign="middle" >18</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >5-272a/2014 (Tomato)</td><td align="center" valign="middle" >Ageratum leaf curl Cameroon virus [CM:AGFG23:2009] |FR873230.1|</td><td align="center" valign="middle" >97%</td></tr><tr><td align="center" valign="middle" >19</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >5-272b/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Kumasi virus partial V1 AMJ11|FM210063.1|</td><td align="center" valign="middle" >98%</td></tr></tbody></table></table-wrap><table-wrap id="4_2"><table><tbody><thead><tr><th align="center" valign="middle" >20</th><th align="center" valign="middle" >Kara Region</th><th align="center" valign="middle" >5-272c/2014 (Tomato)</th><th align="center" valign="middle" >Ageratum leaf curl Cameroon virus [CM:AGFG24:2009] |FR873228.1|</th><th align="center" valign="middle" >97%</th></tr></thead><tr><td align="center" valign="middle" >21</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >5-278/2014 (Tomato)</td><td align="center" valign="middle" >Ageratum leaf curl Cameroon virus [CM:AGFG24:2009] |FR873228.1|</td><td align="center" valign="middle" >97%</td></tr><tr><td align="center" valign="middle" >22</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >5-279a/2014 (Tomato)</td><td align="center" valign="middle" >Ageratum leaf curl Cameroon virus [CM:AGFG24:2009] |FR873228.1|</td><td align="center" valign="middle" >97%</td></tr><tr><td align="center" valign="middle" >23</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >5-279b/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Kumasi virus partial V1 LIONGO1 |FM210062.1</td><td align="center" valign="middle" >99%</td></tr><tr><td align="center" valign="middle" >24</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >5-279c/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Kumasi virus partial V1 AMJ11 |FM210063.1|</td><td align="center" valign="middle" >97%</td></tr><tr><td align="center" valign="middle" >25</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >5-281/2014 (Tomato)</td><td align="center" valign="middle" >Ageratum leaf curl Cameroon virus [CM:AGFG24:2009] |FR873228.1|</td><td align="center" valign="middle" >98%</td></tr><tr><td align="center" valign="middle" >26</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >8-250/2014 (Tomato)</td><td align="center" valign="middle" >Ageratum leaf curl Cameroon virus [CM:AGFG24:2009] |FR873228.1|</td><td align="center" valign="middle" >96%</td></tr><tr><td align="center" valign="middle" >27</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >8-252/2014 (Tomato)</td><td align="center" valign="middle" >Ageratum leaf curl Cameroon virus [CM:AGFG24:2009] |FR873228.1|</td><td align="center" valign="middle" >97%</td></tr><tr><td align="center" valign="middle" >28</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >8-260a/2014 (Euphorbia heterophylla)</td><td align="center" valign="middle" >Tomato leaf curl Nigeria virus-[Nigeria:2006] |FJ685621.1|</td><td align="center" valign="middle" >99%</td></tr><tr><td align="center" valign="middle" >29</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >8-260b/2014 (Euphorbia heterophylla)</td><td align="center" valign="middle" >No found</td><td align="center" valign="middle" >NS</td></tr><tr><td align="center" valign="middle" >30</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >8-260c/2014 (Euphorbia heterophylla)</td><td align="center" valign="middle" >No found</td><td align="center" valign="middle" >NS</td></tr><tr><td align="center" valign="middle" >31</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >14-226a/2014 (Tomato)</td><td align="center" valign="middle" >Ageratum leaf curl Cameroon virus [CM:AGFG24:2009] |FR873228.1|</td><td align="center" valign="middle" >98%</td></tr><tr><td align="center" valign="middle" >32</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >14-226b/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Cameroon virus - Fontem |HE659516.1|</td><td align="center" valign="middle" >98%</td></tr><tr><td align="center" valign="middle" >33</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >14-226c/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Kumasi virus partial V1 LIONGO1 |FM210062.1|</td><td align="center" valign="middle" >98%</td></tr><tr><td align="center" valign="middle" >34</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >14-226d/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Nigeria virus-[Nigeria:2006] |FJ685621.1|</td><td align="center" valign="middle" >98%</td></tr><tr><td align="center" valign="middle" >35</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >14-227/2014 (Tomato)</td><td align="center" valign="middle" >Ageratum leaf curl Cameroon virus [CM:AGFG24:2009] |FR873228.1|</td><td align="center" valign="middle" >96%</td></tr><tr><td align="center" valign="middle" >36</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >20-182a/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Kumasi virus clone (GOTB2-2)|EU847739.1|</td><td align="center" valign="middle" >97%</td></tr><tr><td align="center" valign="middle" >37</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >20-182b/2014 (Tomato)</td><td align="center" valign="middle" >Ageratum leaf curl Cameroon virus [CM:AGFG24:2009] |FR873228.1|</td><td align="center" valign="middle" >98%</td></tr><tr><td align="center" valign="middle" >38</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >20-185/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Nigeria virus-[Nigeria:2006] |FJ685621.1|</td><td align="center" valign="middle" >98%</td></tr><tr><td align="center" valign="middle" >39</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >20-187/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Kumasi virus clone (GOTB2-2)|EU847739.1|</td><td align="center" valign="middle" >99%</td></tr><tr><td align="center" valign="middle" >40</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >20-194/2014 (Tomato)</td><td align="center" valign="middle" >Ageratum leaf curl Cameroon virus [CM:AGFG24:2009] |FR873228.1|</td><td align="center" valign="middle" >98%</td></tr><tr><td align="center" valign="middle" >41</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >20-215a/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Nigeria virus-[Nigeria:2006] |FJ685621.1|</td><td align="center" valign="middle" >98%</td></tr><tr><td align="center" valign="middle" >42</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >20-215b/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Nigeria virus-[Nigeria:2006] |FJ685621.1|</td><td align="center" valign="middle" >98%</td></tr><tr><td align="center" valign="middle" >43</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >20-216/2014 (Solanum macrocarpon)</td><td align="center" valign="middle" >No found</td><td align="center" valign="middle" >NS</td></tr><tr><td align="center" valign="middle" >44</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >20-248/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Nigeria virus-[Nigeria:2006] |FJ685621.1|</td><td align="center" valign="middle" >99%</td></tr><tr><td align="center" valign="middle" >45</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >20-266a/2014 (Tomato)</td><td align="center" valign="middle" >Pepper yellow vein Mali virus-Ouaga |FM876851.1|</td><td align="center" valign="middle" >99%</td></tr><tr><td align="center" valign="middle" >46</td><td align="center" valign="middle" >Kara Region</td><td align="center" valign="middle" >20-266b/2014 (Tomato)</td><td align="center" valign="middle" >Pepper yellow vein Mali virus-Bazegahot |FM876848.1|</td><td align="center" valign="middle" >99%</td></tr><tr><td align="center" valign="middle" >47</td><td align="center" valign="middle" >Savannah Region</td><td align="center" valign="middle" >31-112a/2014 (Tomato)</td><td align="center" valign="middle" >No found</td><td align="center" valign="middle" >NS</td></tr><tr><td align="center" valign="middle" >48</td><td align="center" valign="middle" >Savannah Region</td><td align="center" valign="middle" >31-112b/2014 (Tomato)</td><td align="center" valign="middle" >No found</td><td align="center" valign="middle" >NS</td></tr><tr><td align="center" valign="middle" >49</td><td align="center" valign="middle" >Savannah Region</td><td align="center" valign="middle" >31-153/2014 (Tomato)</td><td align="center" valign="middle" >Tomato leaf curl Nigeria virus-[Nigeria:2006]|FJ685621.1|</td><td align="center" valign="middle" >99%</td></tr></tbody></table></table-wrap></table-wrap-group><p>NS = No similarit</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>In West Africa several viruses infecting tomato crops have been reported, including strains of begomoviruses such as: Tomato leaf curl Cameroon virus (ToLCCMV), Tomato yellow leaf curl Mali virus (TYLCMLV), Tomato leaf curl Nigeria virus (ToLCNGV), Tomato leaf curl Ghana virus (ToLCGHV), Tomato leaf curl Kumasi virus (ToLCKuV) et Tomato leaf curl Togo virus (ToLCTGV) [<xref ref-type="bibr" rid="scirp.81478-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.81478-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.81478-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.81478-ref23">23</xref>] belong the West African tomato infecting begomoviruses (WATIBs) clade. The results in this study revealed that the PCR with virus-specific primers for the Mediterranean TYLCV isolates used by [<xref ref-type="bibr" rid="scirp.81478-ref21">21</xref>] , did not succeed in detecting the TYLCD-associated viruses in symptomatic tomato plants and wild plants collected in fields in Togo. However, the degenerate primers of Avcore/ACcore, Deng A/Deng B, Av494/Ac1048, PALIc1960/PARI722 and PAR1c496/ PCRv181 designed respectively by [<xref ref-type="bibr" rid="scirp.81478-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.81478-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.81478-ref18">18</xref>] and [<xref ref-type="bibr" rid="scirp.81478-ref20">20</xref>] for geminiviruses succeeded in amplifying the expected band size of geminiviruses of the tested infected samples.</p><p>The identification of Tomato leaf curl Cameroon virus-Fontem [<xref ref-type="bibr" rid="scirp.81478-ref24">24</xref>] first in Cameroon and now in Togo suggests that this virus is widely distributed in Central and West Africa. Furthermore, since cultivated tomato is not indigenous to Africa and begomoviruses are not seed transmissible [<xref ref-type="bibr" rid="scirp.81478-ref25">25</xref>] , it is more likely that WATIBs originated from an endemic alternate host. The identification of Ageratum leaf curl Cameroon virus first in Ageratum conyzoides and now on tomato in Togo suggests that this begomovirus can infect more than one host. The identification of ALCCMA first in Ageratum conyzoides and now in tomato suggests that ALCCMA may infect more than one host and may be trans-replicated by other begomoviruses. The identification of Tomato leaf curl Nigeria virus [<xref ref-type="bibr" rid="scirp.81478-ref26">26</xref>] on the wild Euphorbia heterophylla in our study suggests that it is a reservoir plant for this virus.</p><p>Analysis of the genetic diversity of begomoviruses infecting tomato was carried out by direct sequencing of the PCR products. This strategy, after the PCR parameters were optimized, was extremely efficient for analyzing a large number of sequences in a short period of time. The sequenced region comprises the 5 end of the CP gene. This is the most variable region of the CP gene and according to [<xref ref-type="bibr" rid="scirp.81478-ref10">10</xref>] , is representative of the variability of the nucleotide sequence of the viral genome. Therefore, phylogenetic analysis based on the region is usually sufficient to establish the taxonomic position of a given isolate of begomoviruses.</p><p>From the results obtained from the phylogenetic analysis, sequences from the begomoviruses CP gene that infect tomato in Togo form seven large groups of begomoviruses. Thus, in groups 6 and 7 there are isolates from Togo mixed with GenBank isolates. But it should also be noted that the elements of the Maritime Region, Central Region, Savannah Region and those of the Kara region can be found together in the same group (G1) and so on. It should be noted that, according to our study, the isolates of begomovirus infecting tomato in Togo are specific to Togo (as shown in the tree of <xref ref-type="fig" rid="fig3">Figure 3</xref> except for two cases where Togo isolates are mixed with isolates from GenBank). The proximity of Pepper yellow vein Mali virus-Ouagadougou [<xref ref-type="bibr" rid="scirp.81478-ref27">27</xref>] with a high degree of similarity of 99% with one of our isolates (20-266a/2014) from the Kara region suggests that this begomovirus has been introduced into this area through the vector insect or trade.</p><p>Although, new distinct species of begomovirus were identified in the early 2000s and this, due to increased interest in begomovirus research that has been strengthened, identification and the determination of begomoviruses as emerging viruses and the discovery of new species by viral genome sequencing is the major concern nowadays. [<xref ref-type="bibr" rid="scirp.81478-ref28">28</xref>] have suggested that the South-East of continental Asia could be an important center of diversity for begomoviruses based on the great diversity of strains and species of local monopartite Begomoviruses and associated betasatellite molecules identified in these regions.</p></sec><sec id="s5"><title>5. Conclusion</title><p>It appears from this study that geographically separated viruses meet and are in mixed infection in Togo. So for the future it would be important to sequence more begomovirus isolates from tomato and wild plants to monitor viral genotypes and to be able to track possible changes in the population structure of these virus. This should be considered when screening programs for virus resistance are established because recombination is permanent with begomoviruses and it is known that when there is recombination, the new recombinants are usually more infectious than their parents.</p></sec><sec id="s6"><title>Acknowledgements</title><p>The Authors wish to express their thanks to the West African Agricultural Productivity Program (WAAPP/TOGO) and Bill and Melinda Gates Foundation (BMGF) for supporting this project.</p></sec><sec id="s7"><title>Cite this paper</title><p>Mivedor, A.S., Pita, J.S., Adjata, K.D., Duclercq, J. and Gumedzoe, Y.M.D. (2017) Genetic Diversity of Tomato (Solanum lycopersicum L.) Begomovirus in Togo. Agricultural Sciences, 8, 1402-1414. https://doi.org/10.4236/as.2017.812100</p></sec></body><back><ref-list><title>References</title><ref id="scirp.81478-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Brown, J.K., Zerbini, F.M., Navas-Castillo, J., Moriones, E., Ramos-Sobrinho, R., Silva, J.F., Fiallo-Olivé, E., Briddon, R., Hernández-Zepeda, C. and Idris, A. (2015). Revision of Begomovirus Taxonomy Based on Pairwise Sequence Comparisons. Archives of Virology, 160, 1593-1619. &lt;/br&gt;https://doi.org/10.1007/s00705-015-2398-y</mixed-citation></ref><ref id="scirp.81478-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Tsai, W.S., Shih, S.L., Venkatesan, S.G., Aquino, M.U., Green, S.K., Kenyon, L. and Jan, F.J. (2011) Distribution and Genetic Diversity of Begomoviruses Infecting Tomato and Pepper Plants in the Philippines. Annals of Applied Biology, 158, 275-287.  
&lt;/br&gt;https://doi.org/10.1111/j.1744-7348.2011.00462.x</mixed-citation></ref><ref id="scirp.81478-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Van Brunschot, S.L., Bergervoet, J.H., Pagendam, D.E., de Weerdt, M., Geering, A.D., Drenth, A. and Van der Vlugt, R.A. (2013) A Bead-Based Suspension Array for the Multiplexed Detection of Begomoviruses and Their Whitefly Vectors. Journal of Virological Methods, 198, 86-94.  
&lt;/br&gt;https://doi.org/10.1016/j.jviromet.2013.12.014</mixed-citation></ref><ref id="scirp.81478-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Zhou, Y.C., Noussourou, M., Kon, T., Rojas, M., Jiang, H., Chen, L.F., Gamby, K., Foster, R. and Gilbertson, R.L. (2008) Evidence of Local Evolution of Tomato-Infecting Begomovirus Species in West Africa: Characterization of Tomato Leaf Curl Mali Virus and Tomato Yellow Leaf Crumple Virus from Mali. Archives of Virology, 153, 693-706. &lt;/br&gt;https://doi.org/10.1007/s00705-008-0042-9</mixed-citation></ref><ref id="scirp.81478-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Hanssen, I.M., Lapidot, M. and Thomma, B. (2010) Emerging Viral Diseases of Tomato Crops. Molecular Plant-Microbe Interactions, 23, 539-548.  
&lt;/br&gt;https://doi.org/10.1094/MPMI-23-5-0539</mixed-citation></ref><ref id="scirp.81478-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Varsani, A., Navas-Castillo, J., Moriones, E., Hernandez-Zepeda, C., Idris, A., Brown, J.K., Murilo Zerbini, F. and Martin, D.P. (2014) Establishment of Three New Genera in the Family Geminiviridae: Becurtovirus, Eragrovirus and Turncurtovirus. Archives of Virology, 159, 2193-2203.  
&lt;/br&gt;https://doi.org/10.1007/s00705-014-2050-2</mixed-citation></ref><ref id="scirp.81478-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Adams, M.J., King, A.M.Q. and Carstens, E.B. (2013) Ratification Vote on Taxonomic Proposals to the International Committee on Taxonomy of Viruses. Archives of Virology, 158, 2023-2030. &lt;/br&gt;https://doi.org/10.1007/s00705-013-1688-5</mixed-citation></ref><ref id="scirp.81478-ref8"><label>8</label><mixed-citation publication-type="book" xlink:type="simple">Stanley, J., Bisaro, D.M., Briddon, R.W., Brown, J.K., Fauquet, C.M., Harrison, B.D., Rybicki, E.P. and Stenger, D.C. (2005) Family Geminiviridae. In: Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U. and Ball, L.A., Eds., Eighth Report of the International Committee on Taxonomy of Viruses, Elsevier Academic Press, 301-326.</mixed-citation></ref><ref id="scirp.81478-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Melgarejo, T.A., Kon, T., Rojas, M.R., Paz-Carrasco, L., Zerbini, F.M. and Gilbertson, R.L. (2013) Characterization of a New World Monopartite Begomovirus Causing Leaf Curl Disease of Tomato in Ecuador and Peru Reveals a New Direction in Geminivirus Evolution. Journal of Virology, 87, 5397-5413.  
&lt;/br&gt;https://doi.org/10.1128/JVI.00234-13</mixed-citation></ref><ref id="scirp.81478-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Padidam, M., Beachy, R.N. and Fauquet, C.M. (1995) Tomato Leaf Curl Geminivirus from India Has a Bipartite Genome and Coat Protein Is Not Essential for Infectivity. Journal of General Virology, 76, 25-35.  
&lt;/br&gt;https://doi.org/10.1099/0022-1317-76-1-25</mixed-citation></ref><ref id="scirp.81478-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Rochester, D.E., Depaulo, J.J., Fauquet, C.M. and Beachy, R.N. (1994) Complete Nucleotide Sequence of the Geminivirus Tomato Yellow Leaf Curl Virus, Thailand Isolate. Journal of General Virology, 75, 477-485.  
&lt;/br&gt;https://doi.org/10.1099/0022-1317-75-3-477</mixed-citation></ref><ref id="scirp.81478-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Lefeuvre, P., Martin, D.P., Harkins, G., Lemey, P., Gray, A.J., Meredith, S., Lakay, F., Monjane, A., Lett, J.M., Varsani, A. and Heydarnejad, J. (2010) The Spread of Tomato Yellow Leaf Curl Virus from the Middle East to the World. Plos Pathogens, 6, e1001164. &lt;/br&gt;https://doi.org/10.1371/journal.ppat.1001164</mixed-citation></ref><ref id="scirp.81478-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Chen, L.F., Rojas, M., Kon, T., Gamby, K., Xoconostle-Cazares, B. and Gilbertson, R.L. (2009) A Severe Symptom Phenotype in Tomato in Mali Is Caused by a Reassortant between a Novel Recombinant Begomovirus (Tomato Yellow Leaf Curl Mali Virus) and a Betasatellite. Molecular Plant Pathology, 10, 415-430.  
&lt;/br&gt;https://doi.org/10.1111/j.1364-3703.2009.00541.x</mixed-citation></ref><ref id="scirp.81478-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Leke, W.N., Brown, J.K., Ligthart, M.E., Sattar, N., Njualema, D.K. and Kvarnheden, A. (2011) Ageratum Conyzoides: A Host to a Unique Begomovirus Disease Complex in Cameroon. Virus Research, 163, 229-237.  
&lt;/br&gt;https://doi.org/10.1016/j.virusres.2011.09.039</mixed-citation></ref><ref id="scirp.81478-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Osei, M.K., Akromah, R., Shih, S.L., Lee, L.M. and Green, S.K. (2008) First Report and Molecular Characterization of DNA A of Three Distinct Begomoviruses Associated with Tomato Leaf Curl Disease in Ghana. Plant Disease, 92, 1585.  
&lt;/br&gt;https://doi.org/10.1094/PDIS-92-11-1585B</mixed-citation></ref><ref id="scirp.81478-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Lohdi, M.A., Ye, G.N., Weeden, N.F. and Reisch, B.I. (1994) A Simple and Efficient Method for DNA Extraction from Grapevine Cultivars and Vitis Species. Plant Molecular Biology, 12, 6-13. &lt;/br&gt;https://doi.org/10.1007/BF02668658</mixed-citation></ref><ref id="scirp.81478-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Brown, J.K., Idris, A., Torres-Jerez, I., Banks, G.K. and Wyatt, S.D. (2001) The Core Region of the Coat Protein Gene Is Highly Useful for Establishing the Provisional Identification and Classification of Begomoviruses. Archives of Virology, 146, 1581-1598. &lt;/br&gt;https://doi.org/10.1007/s007050170080</mixed-citation></ref><ref id="scirp.81478-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Wyatt, S.D. and Brown, J.K. (1996) Detection of Subgroup III Geminivirus Isolates in Leaf Extracts by Degenerate Primers and Polymerase Chain Reaction. Phytopathology, 86, 1288-1293. &lt;/br&gt;https://doi.org/10.1094/Phyto-86-1288</mixed-citation></ref><ref id="scirp.81478-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Deng, D., Mcgrath, P.F., Robinson, D.J. and Harrison, B.D. (1994) Detection and Differentiation of Whitefly-Transmitted Geminiviruses in Plants and Vector Insects by the Polymerase Chain Reaction with Degenerate Primers. Annals of Applied Biology, 125, 327-336. &lt;/br&gt;https://doi.org/10.1111/j.1744-7348.1994.tb04973.x</mixed-citation></ref><ref id="scirp.81478-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Rojas, M.R., Gilbertson, R.L., Russell, D.R. and Maxwell, D.P. (1993) Use of Degenerate Primers in the Polymerase Chain Reaction to Detect Whitefly-Transmitted Geminiviruses. Plant Disease, 77, 340-347. &lt;/br&gt;https://doi.org/10.1094/PD-77-0340</mixed-citation></ref><ref id="scirp.81478-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Anfoka, G.H., Abhary, M. and Nakhla, M.K. (2005) Molecular Identification of Species of the Tomato Yellow Leaf Curl Virus Complex in Jordan. Journal of Plant Pathology, 87, 65-70. &lt;/br&gt;https://doi.org/10.4454/jpp.v87i1.898</mixed-citation></ref><ref id="scirp.81478-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Larkin, M.A., Blackshields, G., Brown, N.P., Chenna, R., Mcgettigan, P.A., Mcwilliam, H., Valentin, F., Wallace, I.M., Wilm, A., Lopez, R., Thompson, J.D., Gibson, T.J. and Higgins, D.G. (2007) Clustal W and Clustal X Version 2.0. Bioinformatics Applications, 23, 2947-2948. &lt;/br&gt;https://doi.org/10.1093/bioinformatics/btm404</mixed-citation></ref><ref id="scirp.81478-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Kon, T., Rojas, M.R., Abdourhamane, I.K. and Gilbertson, R.L. (2009) Roles and Interactions of Begomoviruses and Satellite DNAs Associated with Okra Leaf Curl Disease in Mali, West Africa. Journal of General Virology, 90, 1001-1013.  
&lt;/br&gt;https://doi.org/10.1099/vir.0.008102-0</mixed-citation></ref><ref id="scirp.81478-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Leke, W.N. and Kvarnheden, A (2014) Mixed Infection by Two West African Tomato-Infecting Begomoviruses and Ageratum Leaf Curl Cameroon Betasatellite in Tomato in Cameroon. Archives of Virology, 159, 3145-3148.  
&lt;/br&gt;https://doi.org/10.1007/s00705-014-2159-3</mixed-citation></ref><ref id="scirp.81478-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Inoue-Nagata, A.K., Lima, M.F. and Gilbertson, R.L. (2016) A Review of Geminivirus (Begomovirus) Diseases in Vegetables and Other Crops in Brazil: Current Status and Approaches for Management. Horticultura Brasileira, 34, 8-18.  
&lt;/br&gt;https://doi.org/10.1590/S0102-053620160000100002</mixed-citation></ref><ref id="scirp.81478-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Kon, T. and Gilbertson, R.L. (2012) Two Genetically Related Begomoviruses Causing Tomato Leaf Curl Disease in Togo and Nigeria differ in Virulence and Host Range But Do Not Require a Betasatellite for Induction of Disease Symptoms. Archives of Virology, 157, 107-120. &lt;/br&gt;https://doi.org/10.1007/s00705-011-1139-0</mixed-citation></ref><ref id="scirp.81478-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Tiendrébéogo, F., Lefeuvre, P., Hoareau, M., Traoré, V.S., Barro, N., Péréfarres, F., Reynaud, B., Traoré, A.S., Konaté, G., Lett, J.M. and Traoré, O. (2011) Molecular and Biological Characterization of Pepper Yellow Vein Mali Virus (PepYVMV) Isolates Associated with Pepper Yellow Vein Disease in Burkina Faso. Archives of Virology, 156, 483-487. &lt;/br&gt;https://doi.org/10.1007/s00705-010-0854-2</mixed-citation></ref><ref id="scirp.81478-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Ha, C., Coombs, S., Revill, P., Harding, R., Vu, M. and Dale, J. (2008) Molecular Characterization of Begomoviruses and DNA satellites from Vietnam: Additional Evidence That the New World Geminiviruses Were Present in the Old World Prior to Continental Separation. Journal of General Virology, 89, 312-326.  
&lt;/br&gt;https://doi.org/10.1099/vir.0.83236-0</mixed-citation></ref></ref-list></back></article>