<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">ABB</journal-id><journal-title-group><journal-title>Advances in Bioscience and Biotechnology</journal-title></journal-title-group><issn pub-type="epub">2156-8456</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/abb.2017.812036</article-id><article-id pub-id-type="publisher-id">ABB-81109</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  The Ciliate Protist &lt;i&gt;Tetrahymena pyriformis&lt;/i&gt; as a Cellular Adhesion Model for the Pathogenic Bacterium &lt;i&gt;Staphylococcus aureus&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Bouchra</surname><given-names>El Khalfi</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mohammed</surname><given-names>Benlahfid</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Sofia</surname><given-names>Jarmouni</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Nezha</surname><given-names>Senhaji</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Aurelio</surname><given-names>Serrano Delgado</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Abdelaziz</surname><given-names>Soukri</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Laboratory of Physiopathology, Genetics Molecular and Biotechnology (PGMB), Faculty of Sciences Ain Chock, Research Center: Health &amp;amp; Biotechnology, University Hassan II of Casablanca, Casablanca, Morocco</addr-line></aff><aff id="aff3"><addr-line>Institute of Biochemistry Vegetal and Photosynthesis (IBVF-CSIC University of Seville), Seville, Spain</addr-line></aff><aff id="aff2"><addr-line>Laboratory of Genetic and Molecular Pathology (LGPM), Medical School, Hassan II University, Casablanca, Morocco</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>ab.soukri@gmail.com(AS)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>06</day><month>12</month><year>2017</year></pub-date><volume>08</volume><issue>12</issue><fpage>491</fpage><lpage>507</lpage><history><date date-type="received"><day>16,</day>	<month>October</month>	<year>2017</year></date><date date-type="rev-recd"><day>15,</day>	<month>December</month>	<year>2017</year>	</date><date date-type="accepted"><day>18,</day>	<month>December</month>	<year>2017</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  &lt;i&gt;Staphylococcus aureus&lt;/i&gt;
   is one of the main pathogenic agents responsible for nosocomial and community-acquired bacterial infections. The pathogenicity of this Gram-positive bacterium is ensured by its different adhesion factors. Collagen and the extracellular glycoprotein adhesin are among the &lt;i&gt;Staphylococcus&lt;/i&gt; most important virulence factors. It has been shown that most of the &lt;i&gt;S. aureus&lt;/i&gt; strains carry the &lt;i&gt;ica&lt;/i&gt; operon, responsible for biofilm production. However, the coexpression of the &lt;i&gt;icaA&lt;/i&gt; and the &lt;i&gt;icaD&lt;/i&gt; genes is necessary for complete biofilm synthesis. The aim of our study was to study a collection of 15 clinical strains of &lt;i&gt;S. aureus&lt;/i&gt; from different sources for the presence of &lt;i&gt;can&lt;/i&gt; and &lt;i&gt;icaD&lt;/i&gt; genes coding intercellular adhesion proteins. We also intended to estimate the strains’ ability to form biofilms by the red Cong method and to test the adhesion ability of &lt;i&gt;S. aureus&lt;/i&gt; to the ciliated protist &lt;i&gt;Tetrahymena pyriformis&lt;/i&gt;, which we used as a novel cellular adhesion model. Finally, we checked the adhesion’s inhibition capacity of some plants extracts. The molecular detection of adhesion genes revealed that 80% of strains are cna positive, and 73% are &lt;i&gt;icaD&lt;/i&gt; positive. Qualitative biofilm production of &lt;i&gt;S. aureus&lt;/i&gt; revealed that 66.6% of strains were slime producers. The adhesion test revealed that 20% of strains are strongly adhering to &lt;i&gt;T. pyriformis&lt;/i&gt; and that the &lt;i&gt;Clematis cirrhosa&lt;/i&gt; extract has an anti-adhering effect of &lt;i&gt;S. aureus&lt;/i&gt; to the ciliate &lt;i&gt;T. pyriformis&lt;/i&gt;.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Staphylococcus aureus&lt;/i&gt;</kwd><kwd> Adhering Genes (&lt;i&gt;can&lt;/i&gt; and &lt;i&gt;icaD&lt;/i&gt;)</kwd><kwd> &lt;i&gt;Tetrahymena pyriformis&lt;/i&gt;</kwd><kwd> Biofilm Production</kwd><kwd> Plant Extract</kwd><kwd> Anti-Adhesion Effect</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Staphylococcus (from the Greek: σταφυλή, staphylē, “grape” and κόκκος, k&#243;kkos, “granule”) is a genus of Gram-positive bacteria in shells shape, without flagellum, which has a cellular envelope made of a unique plasma membrane, surrounded by a relatively thick cell wall [<xref ref-type="bibr" rid="scirp.81109-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref2">2</xref>] . Staphylococcus strains are able to grow in aerobic or anaerobic conditions. They are ubiquitous species: having the ability to live in soil, water or diverse animal tissues [<xref ref-type="bibr" rid="scirp.81109-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref4">4</xref>] .</p><p>Among the Staphylococci, there are three main human pathogenic species: S. aureus, S. epidermidis and S. saprophyticus. Staphylococcus aureus is usually called golden Staphylococcus because of the yellow colored colonies that it forms on the agar. As described in 1881 by Alexander Ogston, it is a Gram-positive spherical bacterium, optional anaerobic, immobile and making regular clusters like bunch of grapes of 0.5 to 1.5 &#181;m. It has the most important pathogenicity potential among the Staphylococci, and is the only strain able to produce coagulase, an exoenzyme able to coagulate blood plasma, which allows Staphylococcus fast and easy identification. It is also one of the main causes of nosocomial and community-acquired infections. Most often, these infections involve biofilms, which are multicellular communities omnipresent in natural, industrial and medical areas and can affect human health [<xref ref-type="bibr" rid="scirp.81109-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref4">4</xref>] .</p><p>S. aureus infection pathogenicity is related to its ability to colonize host tissues, to proliferate and to evade the immune defense system of the host thanks to specific virulence factors (adhesion factors, exoenzymes and toxin production) [<xref ref-type="bibr" rid="scirp.81109-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref6">6</xref>] .</p><p>Bacterial adhesion to host cells or surfaces is often an essential first stage in pathogenic mechanisms. S. aureus has a large number of surface proteins called adhesins, belonging to the MSCRAMMs class (Microbial Surface Components Recognizing Adhesive Matrix Molecules) [<xref ref-type="bibr" rid="scirp.81109-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref8">8</xref>] that enable specific adhesion to components of the host tissue, namely, the fibrinogen binding protein (Clumping factor A or ClfA), the fibronectin binding proteins FnBPA and FnBPB (fibronectin-binding protein A and B) [<xref ref-type="bibr" rid="scirp.81109-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref10">10</xref>] , the collagen binding protein (collagen adhesin or Cna) and the elastin binding protein (EbpS) [<xref ref-type="bibr" rid="scirp.81109-ref8">8</xref>] . Other surface proteins also described in S. aureus, such as Eap (extracellular adherence protein) [<xref ref-type="bibr" rid="scirp.81109-ref11">11</xref>] , Ebh (extracellular matrix binding homologue protein) [<xref ref-type="bibr" rid="scirp.81109-ref12">12</xref>] and Emp (extracellular matrix binding protein) [<xref ref-type="bibr" rid="scirp.81109-ref13">13</xref>] may have a role in colonization.</p><p>Biofilms formation is the outcome of a set of physical, chemical and biological processes. According to the model suggested by Mack et al. [<xref ref-type="bibr" rid="scirp.81109-ref14">14</xref>] , it consists of two phases: initial attachment and accumulation. The first phase is the initial attachment or adhesion of cells to a solid support, this support can either be the host tissue (skin, epithelium…), materials used in medical field (catheters, prosthesis∙∙∙) or a food industry support (cutting surface, floors, walls…). The initial adhesion is the result of non covalent physicochemical interactions between support and bacteria such as Van der Waals forces, electrostatic forces, Lewis acid-base properties and hydrophobic/hydrophilic properties [<xref ref-type="bibr" rid="scirp.81109-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref16">16</xref>] . Adhesion is also affected by components of the bacterial cell wall such as teichoic acids and surface proteins (adhesins and autolysins identified in S. aureus and S. epidermidis) [<xref ref-type="bibr" rid="scirp.81109-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref18">18</xref>] .</p><p>The second phase is the intercellular aggregation, which leads to micro colonies formation. This step includes cell division and exopolysaccharides production and leads to a mature biofilm establishment. Among the responsible factors for intercellular aggregation, there are three main surface compounds such as: polysaccharide intercellular adhesion (PIA) described in S. epidermidis, S. aureus and S. caprae [<xref ref-type="bibr" rid="scirp.81109-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref20">20</xref>] , Accumulation Associated Protein (AAP) described in S. epidermidis [<xref ref-type="bibr" rid="scirp.81109-ref21">21</xref>] and the Biofilm Associated Protein (BAP) originally described in bovine S. aureus strains [<xref ref-type="bibr" rid="scirp.81109-ref22">22</xref>] . Biofilm maturation is sometimes followed by a detachment phase that allows bacteria to colonize other sites. This phenomenon has been slightly studied in Staphylococci. In S. epidermidis, this phase has been studied using electric currents or enzymes that would reverse the establishment of biofilms on catheters, causing thereby the detachment [<xref ref-type="bibr" rid="scirp.81109-ref23">23</xref>] . In S. aureus, the biofilm viscoelasticity allows resistance to detachment caused by mechanical stress or surrounding flux [<xref ref-type="bibr" rid="scirp.81109-ref24">24</xref>] . In addition, this viscoelasticity leads to rolling phenomenon in micro-colonies that allows them to migrate to other sites. Stoodley et al. showed that cells spontaneous removal is divided into two processes: erosion and sloughing [<xref ref-type="bibr" rid="scirp.81109-ref25">25</xref>] . Erosion is a continual detachment of single cells and small cell aggregates while the sloughing is the rapid and massive loss of biofilm. Erosion occurs during the whole biofilm maturation period whereas sloughing occurs after a nutritional deficiency [<xref ref-type="bibr" rid="scirp.81109-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref27">27</xref>] . The detachment step seems to be genetically programmed, and would facilitates the propagation of the infection and/or the colonization of other sites [<xref ref-type="bibr" rid="scirp.81109-ref28">28</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref29">29</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref30">30</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref31">31</xref>] .</p><p>In the current study, we screened the presence of cna and icaD genes coding for adhesion proteins in 15 clinical S. aureus strains and assessed their ability to produce biofilms. We also tested, for the first time, the adhesion ability of S. aureus to ciliated protist Tetrahymena pyriformis, a well-known model organism in biomedical research with a cellular architecture similar to human cell [<xref ref-type="bibr" rid="scirp.81109-ref32">32</xref>] , and finally evaluated the anti-adhesion effect of some plant extracts.</p></sec><sec id="s2"><title>2. Material and Methods</title><p>1) Microorganisms and Culture Condition</p><p>Staphylococcus aureus</p><p>Fifteen Staphylococcus aureus bacterial strains of different origins have been studied, including a resistant strain to methicillin (SARM). These strains were provided by the molecular bacteriology laboratory of the Pasteur Institute of Morocco (IPM) and the bacteriology department of the Ibn Rochd hospital of Casablanca (Morocco).</p><p>Identification of the 15 strains of S. aureus was performed using primers specific for the AF gene, which is specific to the identification of Staphylococcus aureus.</p><p>The reference strain Staphylococcus aureus ATCC 25923, which was provided by the Laboratory of Analysis, Treatment and Valorization of Environmental and Products Pollutants, Faculty of Pharmacy, Monastir (Tunisia) was used as a control.</p><p>Culture of Staphylococcus aureus was performed on Nutrient Broth (NB) medium, and/or brain heart infusion broth (BHI) and incubated at 37˚C.</p><p>Tetrahymena pyriformis</p><p>The ciliate protist Tetrahymena pyriformis (strain GL, ATCC 30005) was grown in PPY medium composed of: meat Peptic digest (1.5%), yeast extract (0.25%) and was then incubated at 28˚C. Pseudomonas syringae and Eschericha coli BL21 strains were used as controls.</p><p>2) Plant Extracts</p><p>Plant extracts were prepared from the aerial part (stem + leaf) of Pisenlit (Taraxacum officinale), Clematis cirrhosa, Mesembryanthemum crystallinum and Rubia pergrina, and stored at 4˚C in the National Institute of Medicinal and Aromatic Plants, Taounate, Morocco.</p><p>3) Bacterial DNA Extraction</p><p>Colonies of S. aureus were scraped using an inoculation loop and mixed with 200 μl of distilled water in a conical centrifuge tube under sterile conditions. Tubes were placed in a water bath for 10 min at 100˚C, then immediately placed on ice for 5 min (heat shock), and centrifuged at 12,000 rpm for 10 min at 4˚C. The supernatant representing the DNA was collected in sterile Eppendorf tubes of 1.5 ml which were stored at −20˚C.</p><p>4) Polymerase Chain Reaction</p><p>Molecular detection of AF, icaD and can genes was performed with PCR using the primers shown in <xref ref-type="table" rid="table1">Table 1</xref>. For all the PCR experiments, reaction mixtures contained 10 &#181;M of each forward and reverse primer, 25 mM of MgCl<sub>2</sub>, 5&#215; flexi buffer Promega, 10 &#181;M of dNTPs and 5 U/μl of Taq DNA polymerase.</p><p>The PCR program used for strains identification was: 1 cycle of 3 min at 96˚C, 30 cycles (30 sec at 95˚C, 30 sec at 52˚C and 1 min at 72˚C) and a final elongation step of 10 min at 7˚C. For cna and icaD genes detection, we used the following PCR program: 1 cycle of 5 minutes at 94˚C, 30 cycles (30 sec at 94˚C, 30 sec at 57˚C (for the cna gene, 55˚C for the icaD gene) and 1 min at 72˚C) and a final elongation step of 10 min at 72˚C.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers sequences and PCR conditions</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" >Primer</th><th align="center" valign="middle" >5’-3’ Sequence</th><th align="center" valign="middle" >PCR product length (bp)</th><th align="center" valign="middle" >Annealing temperature</th><th align="center" valign="middle" >References</th></tr></thead><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >AF</td><td align="center" valign="middle" >AATCTTTGTCGGTACACGATATTCTTCACG CGTAATGAGATTTCAGTAGATAATACAACA</td><td align="center" valign="middle" >108</td><td align="center" valign="middle" >52˚C</td><td align="center" valign="middle" >Murdoch et al. 2004 (Num r&#233;f)</td></tr><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" >icaD</td><td align="center" valign="middle" >ATGGTCAAGCCCAGACAGAG AGTATTTTCAATGTTTAAAGCAA</td><td align="center" valign="middle" >198</td><td align="center" valign="middle" >55˚C</td><td align="center" valign="middle" >Rohde et al. 2001 (Num r&#233;f)</td></tr><tr><td align="center" valign="middle" >3</td><td align="center" valign="middle" >cna</td><td align="center" valign="middle" >AAAGCGTTGCCTAGTGGAGA AGTGCCTTCCCAAACCTTTT</td><td align="center" valign="middle" >192</td><td align="center" valign="middle" >57˚C</td><td align="center" valign="middle" >Arciola et al. 2005 (Num r&#233;f)</td></tr></tbody></table></table-wrap><p>5) Detection of Biofilm-Forming Strains</p><p>Biofilm-forming strains detection was performed on Congo Red Agar medium (CRA). 0.4 g of CRA (Panreac C.I 22120) was added to 500 ml of aqueous solution, which was autoclaved for 15 min at 120˚C. 26.5 g of BHI, 25 g of sucrose and 5 g of agar were then added to the solution that was autoclaved and poured into Petri dishes.</p><p>6) Adhesion Test of Staphylococcus aureus to Tetrahymena pyriformis Cells</p><p>Using the following protocol, we aimed to study the adhesion capacity of Staphylococcus aureus to the ciliated protist T. pyriformis cells. Seventeen cover slips were prepared: The first one served as a control in which the protist cells were incubated alone, in the second one T. pyriformis cells were incubated with Pseudomonas syringae and for the 15 remaining cover slips, the protist cells were incubated with the 15 strains of Staphylococcus aureus. Then, each cover slip was placed in a sterile Petri box and 100 μl of an exponential phase culture of T. pyriformis were added. Afterward, using a toothpick, 30 colonies of each bacterial culture were took from the gelose medium, spread over the entire cover slip and incubated for 2 h at 28˚C. Subsequently, the cover slips were fixed with 1 ml of methanol for 20 min, stained with 1 ml of Giemsa solution for 20 min and washed 2 - 3 times with 1 ml of PBS. After drying, cover slips were placed on slides. Finally, a drop of immersion oil was added and preparations were observed on light microscope. The experiment was carried out in triplicate.</p><p>7) Anti-Adhesion Effect of Plant Extracts</p><p>Study of the antibacterial effect of plant extracts</p><p>The antibacterial effect of Pisenlit, Clematis cirrhosa, Mesembryenthemum hallinum and Rubia peregrina plant extracts on S. aureus was determined by the well diffusion technique on solid medium. The antimicrobial activity is determined in terms of the inhibition zone diameter generated around the wells.</p><p>Three boxes were used, the first one contained only the culture medium (negative control), the second one contained the bacterial culture without plant extracts (positive control) and the third box contained bacterial suspension incubated with plant extracts. The experiment was carried out in triplicate for each plant extract.</p><p>Effects of plant extracts on bacterial adhesion</p><p>To study the anti-adhesion effect, 30 colonies of bacteria were incubated with T. pyriformis cells and plant extracts, as described above (Section 6. Adhesion test of Staphylococcus aureus to Tetrahymena pyriformis cells). 50 μl of one of the analyzed plant extracts (Pisenlit, Clematis cirrhosa, Mesembryentemum hallinum, and Rubia pergrina) were added to each coverslip before 2 h of incubation. The same steps of adhesion test were followed and the result was observed using a light microscope. The experiment was carried out in triplicate for each plant extract.</p></sec><sec id="s3"><title>3. Results and Discussion</title><p>Molecular identification of S. aureus strains</p><p>In this study, all the fifteen clinical bacterial strains collected were identified by PCR using the AF gene. The results were revealed by electrophoresis on 1% agarose gel. The <xref ref-type="fig" rid="fig1">Figure 1</xref> is a demonstrative profile representing the result of a set of selected clinical strains.</p><p>Thereby as shown in <xref ref-type="fig" rid="fig1">Figure 1</xref>, all strains presented the expected DNA fragment of 108 bp, which is in line with the microbiological identification (results not shown), indicating that all clinical strains belong to the Staphylococcus aureus species.</p><p>Molecular detection of cna and icaD genes</p><p>The cna gene</p><p>PCR amplification of the cna gene encoding the collagen-binding adhesin protein was performed for all Staphylococcus aureus clinical strains using genomic DNA as a template, and the results were revealed on 1% agarose gels. <xref ref-type="fig" rid="fig2">Figure 2</xref> shows an example of some selected strains.</p><p>Based on the results of PCR amplifications, out of the fifteen clinical strains available, twelve Staphylococcus aureus strains (80%) carried the cna gene as indicated by the amplified DNA fragment of 192 bp (<xref ref-type="fig" rid="fig2">Figure 2</xref>), while only three strains did not possess this gene.</p><p>According to literature, the staphylococcal collagen-binding adhesion has been described as one of the most important virulence factor proteins in the infection</p><p>pathogenesis of this bacterium [<xref ref-type="bibr" rid="scirp.81109-ref33">33</xref>] . [<xref ref-type="bibr" rid="scirp.81109-ref34">34</xref>] showed that cna gene is carried by 56.5% of the tested S. aureus strains while Nizami Duran et al. [<xref ref-type="bibr" rid="scirp.81109-ref35">35</xref>] found cna gene presence in 78.4% of the staphylococcal strains. However, Peacock et al. [<xref ref-type="bibr" rid="scirp.81109-ref36">36</xref>] underlined that the prevalence of cna-positive strains was 52% while Aricola et al. [<xref ref-type="bibr" rid="scirp.81109-ref37">37</xref>] showed that cna was carried by 46% of S. aureus strains. Furthermore, Tristan et al. [<xref ref-type="bibr" rid="scirp.81109-ref38">38</xref>] and Rohdet et al. [<xref ref-type="bibr" rid="scirp.81109-ref39">39</xref>] described the presence of cna gene in 36% and 22% of the strains respectively.</p><p>The icaD gene</p><p>PCR amplification of the icaD gene, which is a member of the ica operon encoding the proteins that synthesize the polysaccharide intercellular adhesin (PIA), was obtained for most tested Staphylococcus aureus clinical strains (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p><p>Eleven among fifteen Staphylococcus aureus strains (73%) presented the icaD gene, as revealed by the amplified band on agarose gel which corresponds to a DNA fragment of 198 bp (<xref ref-type="fig" rid="fig3">Figure 3</xref>). The remaining four strains did not show the highlighted gene.</p><p>Phenotypic determination of biofilm production</p><p>Slime production by Staphylococcus aureus clinical strains was assessed using Congo red agar technique; the results were interpreted according to what has been reported in the literature [<xref ref-type="bibr" rid="scirp.81109-ref37">37</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref40">40</xref>] . Strains forming biofilms presented crystalline dry colonies, in black, dark black or slightly black color. While those not forming biofilm developed pink, red or bordeaux colonies and sometimes can present red colonies with a black dot in the middle known as “bulls eye”.</p><p>We found that ten of the Staphylococcus aureus strains analyzed in this study (66.6%; including reference strain) were biofilm producing strains, giving dry</p><p>crystalline black, slightly black or dark black colonies (<xref ref-type="fig" rid="fig4">Figure 4</xref>), this difference in coloration intensity can be attributed to the different metabolic pathways incurred by S. aureus for biofilm formation [<xref ref-type="bibr" rid="scirp.81109-ref41">41</xref>] .</p><p>These strains demonstrated an intense biofilm production, indicating a high enzymatic activity of polysaccharide intercellular adhesin (PIA), while the remaining five clinical strains (33.3%) were classified as non-biofilm forming strains, and developed pink, red or bordeaux colored colonies (<xref ref-type="fig" rid="fig4">Figure 4</xref>).</p><p>Our results are close to those obtained by Arciola et al. [<xref ref-type="bibr" rid="scirp.81109-ref42">42</xref>] who reported 61% of icaA and icaD genes holders among S. aureus strains. While Tarek Zmantar et al. [<xref ref-type="bibr" rid="scirp.81109-ref43">43</xref>] found that 78.26% of the tested strains were icaA and icaD positive.</p><p>We also found that nine icaD positive strains (including the reference strain) were characterized as slime forming, whereas two strains were positive for this gene but were not producing biofilm. These results are inconsistent with those described by Arciola et al. [<xref ref-type="bibr" rid="scirp.81109-ref42">42</xref>] who found that icaA and icaD genes were only detected in slime forming strains. These differences may be caused by environmental conditions [<xref ref-type="bibr" rid="scirp.81109-ref44">44</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref45">45</xref>] . In the case of many biofilm-forming bacteria, differentiation from planktonic state to sessile state is associated to environmental stress factors [<xref ref-type="bibr" rid="scirp.81109-ref29">29</xref>] . However, biofilm formation by Staphylococcus is subject to complex regulation influenced by a number of environmental factors including osmolarity, glucose, anaerobiosis and temperature [<xref ref-type="bibr" rid="scirp.81109-ref46">46</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref47">47</xref>] .</p><p>On the other hand, Gundogan et al. [<xref ref-type="bibr" rid="scirp.81109-ref48">48</xref>] found that 58 out of 110 (52.7%) S. aureus strains were slime producing; furthermore, Vasudevan et al. [<xref ref-type="bibr" rid="scirp.81109-ref49">49</xref>] underlined that 32 out of 35 (91.42%) S. aureus strains were slime positive after 24 - 48 h of incubation, indicating that S. aureus biofilm production depends on the incubation time.</p><p>Staphylococcus aureus is able to adhere and form biofilms and therefore cause severe infections [<xref ref-type="bibr" rid="scirp.81109-ref6">6</xref>] . This pathogen has the ability to produce a number of exoenzymes, some of them are involved in virulence [<xref ref-type="bibr" rid="scirp.81109-ref50">50</xref>] . PIA production is responsible for the staphylococcal biofilm development [<xref ref-type="bibr" rid="scirp.81109-ref43">43</xref>] . Biofilm formation is considered as a two-step process that requires the adhesion of bacteria to a surface or substrate followed by a cell-cell adhesion, forming the multiple layers of the biofilm [<xref ref-type="bibr" rid="scirp.81109-ref18">18</xref>] .</p><p>It was shown by several authors that most of S. aureus strains have the entire ica operon [<xref ref-type="bibr" rid="scirp.81109-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref51">51</xref>] . Thereby, the single icaA expression induces only low enzyme activity, whereas the co-expression of icaA and icaD leads to a significant increase of activity and is related to the phenotypic expression of capsular polysaccharide PIA [<xref ref-type="bibr" rid="scirp.81109-ref52">52</xref>] .</p><p>S. aureus Adhesion Test to Tetrahymena pyriformis cells</p><p>Adhesion is an essential step in the development of the infectious process. It is recognized that, in order to adhere to human tissue surfaces, a bacterium must first adhere to appropriate host cells or to their extracellular matrix, in order to withstand the various mechanisms that may eliminate it [<xref ref-type="bibr" rid="scirp.81109-ref53">53</xref>] .</p><p>Different human cell lines were used to study the phenomenon of bacterial adhesion but most of them are very expensive and are likely to be contaminated during subcultures. For this reason, we chose to use the ciliated protist Tetrahymena pyriformis as a more suitable host to which S. aureus may adhere.</p><p>Comparative analysis of the obtained results showed that among the fifteen bacterial strains studied, three of them {Sa67, Sa99 and Sa114} (20%) showed a strong adhesion to protist cells, six {Sa65, Sa116, Sa122, SARM, Ria and the reference strain ATCC25923} (40%) had a moderate adhesion capacity, and the remaining six strains (40%) presented poor adhesion to the protist cells (<xref ref-type="fig" rid="fig5">Figure 5</xref>).</p><p>The capacity of S. aureus to adhere to host cells is considered the first step towards colonization and then cell infection. It is generally accepted that the ability of the bacteria to adhere to the host cells surface is an important factor in the initial interaction between S. aureus and its host [<xref ref-type="bibr" rid="scirp.81109-ref54">54</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref55">55</xref>] [<xref ref-type="bibr" rid="scirp.81109-ref56">56</xref>] .</p><p>Anti-adhesion effect of some plant extracts</p><p>The antibacterial effect of a number of plant extracts on S. aureus was first studied in order to search for the optimal concentration of each extract for which bacterial adhesion is inhibited without stressing the protist. For this purpose, the well diffusion technique was used. The obtained results are shown in <xref ref-type="table" rid="table2">Table 2</xref>.</p><p>The well diffusion technique revealed that all the tested plant extracts (Pisenlit, C. cirrhosa, M. crystallinum and R. peregrina) exhibit an antibacterial effect. Interestingly, the R. peregrina extract produced a growth inhibition zone of 1 cm and showed the strongest effect, followed by C. cirrhosa and M. crystallinum with an inhibition zone of 0.8 cm. Thereby, R. peregrina and C. cirrhosa extracts were selected for further tests.</p><p>Our results are consistent with a study on the antibacterial effect of R. peregrina, which showed that the ethyl acetate and chloroform fractions of the extract are effective against S. aureus and Escherichia coli, respectively [<xref ref-type="bibr" rid="scirp.81109-ref57">57</xref>] . The anti-adhesion effects of R. peregrina and C. cirrhosa extracts were assessed and the results are shown in <xref ref-type="fig" rid="fig6">Figure 6</xref>.</p><p>Our results clearly show that both plant extracts exhibit an anti-adhesion effect. However, it seems that C. cirrhosa features a better effect on S. aureus adhesion-inhibition without stressing T. pyriformis cells.</p><p>The results obtained with the S. aureus strains on the relationships between the presence of genes encoding adhesion proteins, biofilm formation phenotypes and adhesion tests with Tetrahymena pyriformis are summarized in <xref ref-type="table" rid="table3">Table 3</xref>.</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Antibacterial effect of plant extracts on the S. aureus strain “114” in solid medium. The antibacterial effect was determined by measuring the diameter of the growth inhibition zone. 50 &#181;l of plant extract were poured on the wells</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Ampicilline (100 &#181;g/ml)</th><th align="center" valign="middle" >Pisenlit</th><th align="center" valign="middle" >C. cirrhosa</th><th align="center" valign="middle" >M. crystallinum</th><th align="center" valign="middle" >R. peregrina</th></tr></thead><tr><td align="center" valign="middle" >0.4 cm</td><td align="center" valign="middle" >0.6 cm</td><td align="center" valign="middle" >0.8 cm</td><td align="center" valign="middle" >0.8 cm</td><td align="center" valign="middle" >1 cm</td></tr></tbody></table></table-wrap><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Summary of S. aureus strains features showing the relationships between presence of cna and icaD genes, biofilm formation and adhesion tests with Tetrahymena pyriformis</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Strains</th><th align="center" valign="middle" >AF</th><th align="center" valign="middle" >cna</th><th align="center" valign="middle" >icaD</th><th align="center" valign="middle" >Biofilm phenotype</th><th align="center" valign="middle" >Slime production</th><th align="center" valign="middle" >*Adhesion to Tetrahymena pyriformis</th></tr></thead><tr><td align="center" valign="middle" >ATCC 25923</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >Black</td><td align="center" valign="middle" >Producer</td><td align="center" valign="middle" >++</td></tr><tr><td align="center" valign="middle" >Sa 1</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >Almost Black</td><td align="center" valign="middle" >Producer</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >Sa 4</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >Dark Black</td><td align="center" valign="middle" >Producer</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >Sa 33</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >−</td><td align="center" valign="middle" >Red</td><td align="center" valign="middle" >Non Producer</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >Sa 65</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >Almost Black</td><td align="center" valign="middle" >Producer</td><td align="center" valign="middle" >++</td></tr><tr><td align="center" valign="middle" >Sa 100</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >bordeaux</td><td align="center" valign="middle" >Non Producer</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >Sa 91</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >−</td><td align="center" valign="middle" >−</td><td align="center" valign="middle" >bordeaux</td><td align="center" valign="middle" >Non Producer</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >Sa 114</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >Almost Black</td><td align="center" valign="middle" >Producer</td><td align="center" valign="middle" >+++</td></tr><tr><td align="center" valign="middle" >SARM</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >−</td><td align="center" valign="middle" >Red</td><td align="center" valign="middle" >Non Producer</td><td align="center" valign="middle" >++</td></tr><tr><td align="center" valign="middle" >Sa 67</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >Almost Black</td><td align="center" valign="middle" >Producer</td><td align="center" valign="middle" >+++</td></tr><tr><td align="center" valign="middle" >Sa 122</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >−</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >Black</td><td align="center" valign="middle" >Producer</td><td align="center" valign="middle" >++</td></tr><tr><td align="center" valign="middle" >Sa 99</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >Black</td><td align="center" valign="middle" >Producer</td><td align="center" valign="middle" >+++</td></tr><tr><td align="center" valign="middle" >Sa 116</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >Bordeaux</td><td align="center" valign="middle" >Non Producer</td><td align="center" valign="middle" >++</td></tr><tr><td align="center" valign="middle" >Sa 134</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >−</td><td align="center" valign="middle" >−</td><td align="center" valign="middle" >Dark black</td><td align="center" valign="middle" >Producer</td><td align="center" valign="middle" >+</td></tr><tr><td align="center" valign="middle" >Ria</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >Almost Black</td><td align="center" valign="middle" >Producer</td><td align="center" valign="middle" >++</td></tr></tbody></table></table-wrap><p>*+++: Strong adhesion capacity; ++: Moderate adhesion capacity; +: Low adhesion capacity.</p></sec><sec id="s4"><title>4. Conclusions</title><p>In conclusion, our study confirms variations in the presence and expression of genes encoding important adhesion proteins among clinical S. aureus strains. Slime production is also subjected to strain selection and can be affected by the environmental conditions.</p><p>In addition, we suggest that our study on S. aureus adhesion to Tetrahymena pyriformis cells may be considered as a first step in understanding the establishment of different adhesion mechanisms in the pathogenesis of medical device-associated staphylococcal infections. Furthermore, the anti-adhesion effect of plant extracts could be relevant in the development of new preventive and therapeutic approaches against staphylococcal infections.</p></sec><sec id="s5"><title>Cite this paper</title><p>El Khalfi, B., Benlahfid, M., Jarmouni, S., Senhaji, N., Delgado, A.S. and Soukri, A. (2017) The Ciliate Protist Tetrahymena pyriformis as a Cellular Adhesion Model for the Pathogenic Bacterium Staphylococcus aureus. Advances in Bioscience and Biotechnology, 8, 491-507. https://doi.org/10.4236/abb.2017.812036</p></sec></body><back><ref-list><title>References</title><ref id="scirp.81109-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Navarre, W.W. and Schneewind, O. (1999) Surface Proteins of Gram-Positive Bacteria and Mechanisms of Their Targeting to the Cell Wall Envelope. Microbiology and Molecular Biology Reviews, 63, 174-229.</mixed-citation></ref><ref id="scirp.81109-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Smith, E.J., Visai, L., Kerrigan, S.W., Speziale, P. and Foster, T.J. (2011) The Sbi Protein Is a Multifunctional Immune Evasion Factor of Staphylococcus aureus. Infection and Immunity, 79, 3801-3809. https://doi.org/10.1128/IAI.05075-11</mixed-citation></ref><ref id="scirp.81109-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Le Loir, Y., Baron, F. and Gautier, M. (2003) Staphylococcus aureus and Food Poisoning. Genetics and Molecular Research, 2, 63-76.</mixed-citation></ref><ref id="scirp.81109-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Stefani, S., Chung, D.R., Lindsay, J.A., Friedrich, A.W., Kearns, A.M., Westh, H. and MacKenzie, F.M. (2012) Meticillin-Resistant Staphylococcus aureus (MRSA): Global Epidemiology and Harmonisation of Typing Methods. International Journal of Antimicrobial Agents, 39, 273-282. https://doi.org/10.1016/j.ijantimicag.2011.09.030</mixed-citation></ref><ref id="scirp.81109-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Alegre, M.-L., Chen, L., David, M.Z., Bartman, C., Boyle-Vavra, S., Kumar, N., Chong, A.S. and Daum, R.S. (2016) Impact of Staphylococcus aureus USA300 Colonization and Skin Infections on Systemic Immune Responses in Humans. The Journal of Immunology, 197, 1118-1126. https://doi.org/10.4049/jimmunol.1600549</mixed-citation></ref><ref id="scirp.81109-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Doster, R.S., Kirk, L.A., Tetz, L.M., Rogers, L.M., Aronoff, D.M. and Gaddy, J.A. (2016) Staphylococcus aureus Infection of Human Gestational Membranes Induces Bacterial Biofilm Formation and Host Production of Cytokines. The Journal of Infectious Diseases, jiw300. https://doi.org/10.1093/infdis/jiw300</mixed-citation></ref><ref id="scirp.81109-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Chavakis, T., Preissner, K.T. and Herrmann, M. (2007) The Anti-Inflammatory Activities of Staphylococcus aureus. Trends in Immunology, 28, 408-418. https://doi.org/10.1016/j.it.2007.07.002</mixed-citation></ref><ref id="scirp.81109-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Foster, T.J. and H&amp;ouml;&amp;ouml;k, M. (1998) Surface Protein Adhesins of Staphylococcus aureus. Trends in Microbiology, 6, 484-488. https://doi.org/10.1016/S0966-842X(98)01400-0</mixed-citation></ref><ref id="scirp.81109-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Greene, C., McDevitt, D., Francois, P., Vaudaux, P.E., Lew, D.P. and Poster, T.J. (1995) Adhesion Properties of Mutants of Staphylococcus aureus Defective in Fibronectin-Binding Proteins and Studies on the Expression of Fnb Genes. Molecular Microbiology, 17, 1143-1152. https://doi.org/10.1111/j.1365-2958.1995.mmi_17061143.x</mixed-citation></ref><ref id="scirp.81109-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Vaudaux, P.E., Franois, P., Proctor, R.A., McDevitt, D., Foster, T.J., Albrecht, R.M., Lew, D.P., Wabers, H. and Cooper, S.L. (1995) Use of Adhesion-Defective Mutants of Staphylococcus aureus to Define the Role of Specific Plasma Proteins in Promoting Bacterial Adhesion to Canine Arteriovenous Shunts. Infection and Immunity, 63, 585-590.</mixed-citation></ref><ref id="scirp.81109-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Harraghy, N., Hussain, M., Haggar, A., Chavakis, T., Sinha, B., Herrmann, M. and Flock, J.-I. (2003) The Adhesive and Immunomodulating Properties of the Multifunctional Staphylococcus aureus Protein Eap. Microbiology, 149, 2701-2707. https://doi.org/10.1099/mic.0.26465-0</mixed-citation></ref><ref id="scirp.81109-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Clarke, S.R., Harris, L.G., Richards, R.G. and Foster, S.J. (2002) Analysis of Ebh, a 1.1-Megadalton Cell Wall-Associated Fibronectin-Binding Protein of Staphylococcus aureus. Infection and Immunity, 70, 6680-6687. https://doi.org/10.1128/IAI.70.12.6680-6687.2002</mixed-citation></ref><ref id="scirp.81109-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Hussain, M., Becker, K., von Eiff, C., Schrenzel, J., Peters, G. and Herrmann, M. (2001) Identification and Characterization of a Novel 38.5-Kilodalton Cell Surface Protein of Staphylococcus aureus with Extended-Spectrum Binding Activity for Extracellular Matrix and Plasma Proteins. Journal of Bacteriology, 183, 6778-6786. https://doi.org/10.1128/JB.183.23.6778-6786.2001</mixed-citation></ref><ref id="scirp.81109-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Mack, D., Fischer, W., Krokotsch, A., Leopold, K., Hartmann, R., Egge, H. and Laufs, R. (1996) The Intercellular Adhesin Involved in Biofilm Accumulation of Staphylococcus epidermidis Is a Linear Beta-1,6-Linked Glucosaminoglycan: Purification and Structural Analysis. Journal of Bacteriology, 178, 175-183. https://doi.org/10.1128/jb.178.1.175-183.1996</mixed-citation></ref><ref id="scirp.81109-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Bellon-Fontaine, M.-N., Rault, J. and van Oss, C.J. (1996) Microbial Adhesion to Solvents: A Novel Method to Determine the Electron-Donor/Electron-Acceptor or Lewis Acid-Base Properties of Microbial Cells. Colloids and Surfaces B: Biointerfaces, 7, 47-53. https://doi.org/10.1016/0927-7765(96)01272-6</mixed-citation></ref><ref id="scirp.81109-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Briandet, R., Lacroix-Gueu, P., Renault, M., Lecart, S., Meylheuc, T., Bidnenko, E., Steenkeste, K., Bellon-Fontaine, M.-N. and Fontaine-Aupart, M.-P. (2008) Fluorescence Correlation Spectroscopy to Study Diffusion and Reaction of Bacteriophages inside Biofilms. Applied and Environmental Microbiology, 74, 2135-2143. https://doi.org/10.1128/AEM.02304-07</mixed-citation></ref><ref id="scirp.81109-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Gross, M. (2011) Revived Interest in Bacteriophages. Current Biology, 21, R267-R270. https://doi.org/10.1016/j.cub.2011.04.008</mixed-citation></ref><ref id="scirp.81109-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Heilmann, C., Gerke, C., Perdreau-Remington, F. and G&amp;ouml;tz, F. (1996) Characterization of Tn917 Insertion Mutants of Staphylococcus epidermidis Affected in Biofilm Formation. Infection and Immunity, 64, 277-282.</mixed-citation></ref><ref id="scirp.81109-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Allignet, J., Aubert, S., Dyke, K.G.H. and Solh, N.E. (2001) Staphylococcus caprae Strains Carry Determinants Known to Be Involved in Pathogenicity: A Gene Encoding an Autolysin-Binding Fibronectin and the Ica operon Involved in Biofilm Formation. Infection and Immunity, 69, 712-718. https://doi.org/10.1128/IAI.69.2.712-718.2001</mixed-citation></ref><ref id="scirp.81109-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Cramton, S.E., Gerke, C., Schnell, N.F., Nichols, W.W. and G&amp;ouml;tz, F. (1999) The Intercellular Adhesion (ica) Locus Is Present in Staphylococcus aureus and Is Required for Biofilm Formation. Infection and Immunity, 67, 5427-5433.</mixed-citation></ref><ref id="scirp.81109-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Hussain, M., Herrmann, M., von Eiff, C., Perdreau-Remington, F. and Peters, G. (1997) A 140-Kilodalton Extracellular Protein Is Essential for the Accumulation of Staphylococcus epidermidis Strains on Surfaces. Infection and Immunity, 65, 519-524.</mixed-citation></ref><ref id="scirp.81109-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Cucarella, C., Solano, C., Valle, J., Amorena, B., Lasa, í. and Penadés, J.R. (2001) Bap, a Staphylococcus aureus Surface Protein Involved in Biofilm Formation. Journal of Bacteriology, 183, 2888-2896. https://doi.org/10.1128/JB.183.9.2888-2896.2001</mixed-citation></ref><ref id="scirp.81109-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">van der Borden, A.J., van der Werf, H., van der Mei, H.C. and Busscher, H.J. (2004) Electric Current-Induced Detachment of Staphylococcus epidermidis Biofilms from Surgical Stainless Steel. Applied and Environmental Microbiology, 70, 6871-6874. https://doi.org/10.1128/AEM.70.11.6871-6874.2004</mixed-citation></ref><ref id="scirp.81109-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Stoodley, P., Cargo, R., Rupp, C.J., Wilson, S. and Klapper, I. (2002) Biofilm Material Properties as Related to Shear-Induced Deformation and Detachment Phenomena. Journal of Industrial Microbiology &amp; Biotechnology, 29, 361-367. https://doi.org/10.1038/sj.jim.7000282</mixed-citation></ref><ref id="scirp.81109-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Stoodley, P., Wilson, S., Hall-Stoodley, L., Boyle, J.D., Lappin-Scott, H.M. and Costerton, J.W. (2001) Growth and Detachment of Cell Clusters from Mature Mixed-Species Biofilms. Applied and Environmental Microbiology, 67, 5608-5613. https://doi.org/10.1128/AEM.67.12.5608-5613.2001</mixed-citation></ref><ref id="scirp.81109-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Donlan, R.M. (2002) Biofilms: Microbial Life on Surfaces. Emerging Infectious Diseases, 8, 881-890. https://doi.org/10.3201/eid0809.020063</mixed-citation></ref><ref id="scirp.81109-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Stoodley, P., Sauer, K., Davies, D.G. and Costerton, J.W. (2002) Biofilms as Complex Differentiated Communities. Annual Review of Microbiology, 56, 187-209. https://doi.org/10.1146/annurev.micro.56.012302.160705</mixed-citation></ref><ref id="scirp.81109-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Allison, K.R., Brynildsen, M.P. and Collins, J.J. (2011) Metabolite-Enabled Eradication of Bacterial Persisters by Aminoglycosides. Nature, 473, 216-220. https://doi.org/10.1038/nature10069</mixed-citation></ref><ref id="scirp.81109-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Costerton, J.W., Stewart, P.S. and Greenberg, E.P. (1999) Bacterial Biofilms: A Common Cause of Persistent Infections. Science, 284, 1318-1322. https://doi.org/10.1126/science.284.5418.1318</mixed-citation></ref><ref id="scirp.81109-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Lee, J.C., Park, J.S., Shepherd, S.E., Carey, V. and Fattom, A. (1997) Protective Efficacy of Antibodies to the Staphylococcus aureus Type 5 Capsular Polysaccharide in a Modified Model of Endocarditis in Rats. Infection and Immunity, 65, 4146-4151.</mixed-citation></ref><ref id="scirp.81109-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Wrangstadh, M., Conway, P.L. and Kjelleberg, S. (1986) The Production and Release of an Extracellular Polysaccharide during Starvation of a Marine Pseudomonas sp. and the Effect Thereof on Adhesion. Archives of Microbiology, 145, 220-227. https://doi.org/10.1007/BF00443649</mixed-citation></ref><ref id="scirp.81109-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, Y.-Y., Yang, J., Yin, X.-X., Yang, S.-P. and Zhu, Y.-G. (2012) Arsenate Toxicity and Stress Responses in the Freshwater Ciliate Tetrahymena pyriformis. European Journal of Protistology, 48, 227-236. https://doi.org/10.1016/j.ejop.2012.01.005</mixed-citation></ref><ref id="scirp.81109-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Holderbaum, D., Spech, T., Ehrhart, L.A., Keys, T. and Hall, G.S. (1987) Collagen Binding in Clinical Isolates of Staphylococcus aureus. Journal of Clinical Microbiology, 25, 2258-2261.</mixed-citation></ref><ref id="scirp.81109-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Zmantar, T., Chaieb, K., Makni, H., Miladi, H., Abdallah, F.B., Mahdouani, K. and Bakhrouf, A. (2008) Detection by PCR of Adhesins Genes and Slime Production in Clinical Staphylococcus aureus. Journal of Basic Microbiology, 48, 308-314. https://doi.org/10.1002/jobm.200700289</mixed-citation></ref><ref id="scirp.81109-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Duran, N., Dogramaci, Y., Ozer, B., Demir, C. and Kalaci, A. (2010) Detection of Adhesin Genes and Slime Production among Staphylococci in Orthopaedic Surgical Wounds. African Journal of Microbiology Research, 4, 708-715.</mixed-citation></ref><ref id="scirp.81109-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Peacock, S.J., de Silva, I. and Lowy, F.D. (2001) What Determines Nasal Carriage of Staphylococcus aureus? Trends in Microbiology, 9, 605-610. https://doi.org/10.1016/S0966-842X(01)02254-5</mixed-citation></ref><ref id="scirp.81109-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Arciola, C.R., Campoccia, D., Gamberini, S., Baldassarri, L. and Montanaro, L. (2005) Prevalence of cna fnbA and fnbB Adhesin Genes among Staphylococcus aureus Isolates from Orthopedic Infections Associated to Different Types of Implant. FEMS Microbiology Letters, 246, 81-86. https://doi.org/10.1016/j.femsle.2005.03.035</mixed-citation></ref><ref id="scirp.81109-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Tristan, A., Ying, L., Bes, M., Etienne, J., Vandenesch, F. and Lina, G. (2003) Use of Multiplex PCR to Identify Staphylococcus aureus Adhesins Involved in Human Hematogenous Infections. Journal of Clinical Microbiology, 41, 4465-4467. https://doi.org/10.1128/JCM.41.9.4465-4467.2003</mixed-citation></ref><ref id="scirp.81109-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Rohde, H., Knobloch, J.K.M., Horstkotte, M.A. and Mack, D. (2001) Correlation of Staphylococcus aureus icaADBC Genotype and Biofilm Expression Phenotype. Journal of Clinical Microbiology, 39, 4595-4596. https://doi.org/10.1128/JCM.39.12.4595-4596.2001</mixed-citation></ref><ref id="scirp.81109-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Freeman, D.J., Falkiner, F.R. and Keane, C.T. (1989) New Method for Detecting Slime Production by Coagulase Negative Staphylococci. Journal of Clinical Pathology, 42, 872-874. https://doi.org/10.1136/jcp.42.8.872</mixed-citation></ref><ref id="scirp.81109-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Zapotoczna, M., O’Neill, E. and O’Gara, J.P. (2016) Untangling the Diverse and Redundant Mechanisms of Staphylococcus aureus Biofilm Formation. PLOS Pathogens, 12, e1005671. https://doi.org/10.1371/journal.ppat.1005671</mixed-citation></ref><ref id="scirp.81109-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Arciola, C.R., Baldassarri, L. and Montanaro, L. (2001) Presence of icaA and icaD Genes and Slime Production in a Collection of Staphylococcal Strains from Catheter-Associated Infections. Journal of Clinical Microbiology, 39, 2151-2156. https://doi.org/10.1128/JCM.39.6.2151-2156.2001</mixed-citation></ref><ref id="scirp.81109-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Zmantar, T., Kouidhi, B., Miladi, H., Mahdouani, K. and Bakhrouf, A. (2010) A Microtiter Plate Assay for Staphylococcus aureus Biofilm Quantification at Various pH Levels and Hydrogen Peroxide Supplementation. New Microbiologica, 33, 137.</mixed-citation></ref><ref id="scirp.81109-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Chaieb, K., Hajlaoui, H., Zmantar, T., Kahla-Nakbi, A.B., Rouabhia, M., Mahdouani, K. and Bakhrouf, A. (2007) The Chemical Composition and Biological Activity of Clove Essential Oil, Eugenia caryophyllata (Syzigium aromaticum L. Myrtaceae): A Short Review. Phytotherapy Research, 21, 501-506. https://doi.org/10.1002/ptr.2124</mixed-citation></ref><ref id="scirp.81109-ref45"><label>45</label><mixed-citation publication-type="other" xlink:type="simple">Rashid, M.H., Rumbaugh, K., Passador, L., Davies, D.G., Hamood, A.N., Iglewski, B.H. and Kornberg, A. (2000) Polyphosphate Kinase Is Essential for Biofilm Development, Quorum Sensing, and Virulence of Pseudomonas aeruginosa. Proceedings of the National Academy of Sciences, 97, 9636-9641. https://doi.org/10.1073/pnas.170283397</mixed-citation></ref><ref id="scirp.81109-ref46"><label>46</label><mixed-citation publication-type="other" xlink:type="simple">Schlag, S., Nerz, C., Birkenstock, T.A., Altenberend, F. and G&amp;ouml;tz, F. (2007) Inhibition of Staphylococcal Biofilm Formation by Nitrite. Journal of Bacteriology, 189, 7911-7919. https://doi.org/10.1128/JB.00598-07</mixed-citation></ref><ref id="scirp.81109-ref47"><label>47</label><mixed-citation publication-type="other" xlink:type="simple">Shanks, R.M.Q., Meehl, M.A., Brothers, K.M., Martinez, R.M., Donegan, N.P., Graber, M.L., Cheung, A.L. and O’Toole, G.A. (2008) Genetic Evidence for an Alternative Citrate-Dependent Biofilm Formation Pathway in Staphylococcus aureus That Is Dependent on Fibronectin Binding Proteins and the GraRS Two-Component Regulatory System. Infection and Immunity, 76, 2469-2477. https://doi.org/10.1128/IAI.01370-07</mixed-citation></ref><ref id="scirp.81109-ref48"><label>48</label><mixed-citation publication-type="other" xlink:type="simple">Gündogan, N., Citak, S. and Turan, E. (2006) Slime Production, DNase Activity and Antibiotic Resistance of Staphylococcus aureus Isolated from Raw Milk, Pasteurised Milk and Ice Cream Samples. Food Control, 17, 389-392. https://doi.org/10.1016/j.foodcont.2005.01.006</mixed-citation></ref><ref id="scirp.81109-ref49"><label>49</label><mixed-citation publication-type="other" xlink:type="simple">Vasudevan, P., Nair, M.K.M., Annamalai, T. and Venkitanarayanan, K.S. (2003) Phenotypic and Genotypic Characterization of Bovine Mastitis Isolates of Staphylococcus aureus for Biofilm Formation. Veterinary Microbiology, 92, 179-185. https://doi.org/10.1016/S0378-1135(02)00360-7</mixed-citation></ref><ref id="scirp.81109-ref50"><label>50</label><mixed-citation publication-type="other" xlink:type="simple">Dinges, M.M., Orwin, P.M. and Schlievert, P.M. (2000) Exotoxins of Staphylococcus aureus. Clinical Microbiology Reviews, 13, 16-34. https://doi.org/10.1128/CMR.13.1.16-34.2000</mixed-citation></ref><ref id="scirp.81109-ref51"><label>51</label><mixed-citation publication-type="other" xlink:type="simple">Martín-López, J.V., Pérez-Roth, E., Claverie-Martín, F., Gil, O.D., Batista, N., Morales, M. and Méndez-álvarez, S. (2002) Detection of Staphylococcus aureus Clinical Isolates Harboring the ica Gene Cluster Needed for Biofilm Establishment. Journal of Clinical Microbiology, 40, 1569-1570. https://doi.org/10.1128/JCM.40.4.1569-1570.2002</mixed-citation></ref><ref id="scirp.81109-ref52"><label>52</label><mixed-citation publication-type="other" xlink:type="simple">Gerke, C., Kraft, A., Sü&amp;szlig;muth, R., Schweitzer, O. and G&amp;ouml;tz, F. (1998) Characterization of the N-Acetylglucosaminyltransferase Activity Involved in the Biosynthesis of the Staphylococcus epidermidis Polysaccharide Intercellular Adhesin. The Journal of Biological Chemistry, 273, 18586-18593. https://doi.org/10.1074/jbc.273.29.18586</mixed-citation></ref><ref id="scirp.81109-ref53"><label>53</label><mixed-citation publication-type="other" xlink:type="simple">Jiang, X., Qin, Y.X., Lin, G.F., Huang, L., Huang, B., Huang, W.S. and Yan, Q.P. (2015) FlgN Plays Important Roles in the Adhesion of Aeromonas hydrophila to Host Mucus. Genetics and Molecular Research, 14, 6376-6386. https://doi.org/10.4238/2015.June.11.13</mixed-citation></ref><ref id="scirp.81109-ref54"><label>54</label><mixed-citation publication-type="other" xlink:type="simple">Agerer, F., Lux, S., Michel, A., Rohde, M., Ohlsen, K. and Hauck, C.R. (2005) Cellular Invasion by Staphylococcus aureus Reveals a Functional Link between Focal Adhesion Kinase and Cortactin in Integrin-Mediated Internalisation. Journal of Cell Science, 118, 2189-2200. https://doi.org/10.1242/jcs.02328</mixed-citation></ref><ref id="scirp.81109-ref55"><label>55</label><mixed-citation publication-type="other" xlink:type="simple">Hauck, C.R., Agerer, F., Muenzner, P. and Schmitter, T. (2006) Cellular Adhesion Molecules as Targets for Bacterial Infection. European Journal of Cell Biology, 85, 235-242. https://doi.org/10.1016/j.ejcb.2005.08.002</mixed-citation></ref><ref id="scirp.81109-ref56"><label>56</label><mixed-citation publication-type="other" xlink:type="simple">Hauck, C.R. and Ohlsen, K. (2006) Sticky Connections: Extracellular Matrix Protein Recognition and Integrin-Mediated Cellular Invasion by Staphylococcus aureus. Current Opinion in Microbiology, 9, 5-11. https://doi.org/10.1016/j.mib.2005.12.002</mixed-citation></ref><ref id="scirp.81109-ref57"><label>57</label><mixed-citation publication-type="other" xlink:type="simple">&amp;Ouml;zgen, U., Houghton, P.J., Ogundipe, Y. and Coskun, M. (2003) Antioxidant and Antimicrobial Activities of Onosma argentatum and Rubia peregrine. Fitoterapia, 74, 682-685. https://doi.org/10.1016/S0367-326X(03)00161-8</mixed-citation></ref></ref-list></back></article>