<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2017.711056</article-id><article-id pub-id-type="publisher-id">AiM-80225</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Phenazine Methosulphate Modulating the Expression of Genes Involved in Yeast to Hyphal Form Signal Transduction in &lt;i&gt;Candida albicans&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ashwini</surname><given-names>Khanderao Jadhav</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Priyanka</surname><given-names>Jangid</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Rajendra</surname><given-names>Patil</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Wasudev</surname><given-names>Gade</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Kiran</surname><given-names>Kharat</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Sankunny</surname><given-names>Mohan Karuppayil</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff3"><addr-line>Department of Biotechnology, Deogiri College, Aurangabad, India</addr-line></aff><aff id="aff2"><addr-line>Department of Biotechnology, Savitribai Phule Pune Univesity, Pune, India</addr-line></aff><aff id="aff1"><addr-line>School of Life Sciences, SRTM University, Nanded, India</addr-line></aff><pub-date pub-type="epub"><day>10</day><month>11</month><year>2017</year></pub-date><volume>07</volume><issue>11</issue><fpage>707</fpage><lpage>718</lpage><history><date date-type="received"><day>2,</day>	<month>October</month>	<year>2017</year></date><date date-type="rev-recd"><day>7,</day>	<month>November</month>	<year>2017</year>	</date><date date-type="accepted"><day>10,</day>	<month>November</month>	<year>2017</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
   
   Candida albicans has ability to switch from yeast to hyphal form which is an important virulence factor. The objective of the research is to study the effect of Phenazine Methosulphate (PMS) on virulence factors and to study expression profile in yeast to hyphal form transition in 
   C. albicans. Phenazine Methosulphate (PMS) acted as an inhibitor of yeast to hyphal form transition, adhesion and biofilm formation in 
   C. albicans. RTPCR study demonstrated that PMS Modulate the expression of genes involved in Ras1-cAMP-Efg1 and Cek1-MAPK signal transduction pathways. Cell cycle of 
   C. albicans was arrested at S phase on treatment of PMS. Hyphal suppressor genes like Tup1, Mig1 and Nrg1 were upregulated by PMS. Based on our data on expression of genes during yeast to hyphal form transition in presence and absence of PMS, we hypothesize that inhibition of hyphal formation may be due to the overexpression of negative regulators of hyphal growth. Targeting of hyphal specific genes involved in these pathways may be a promising strategy for anti-candida drug development. 
  
 
</p></abstract><kwd-group><kwd>Phenazine Methosulphate</kwd><kwd> &lt;i&gt;Candida albicans&lt;/i&gt; Y-H Form Transition</kwd><kwd> Biofilm</kwd><kwd> Tup1</kwd><kwd> Mig1 and Nrg1</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Yeast to Hyphal (Y-H) form morphogenesis is one of the major virulence factors in C. albicans and this may facilitate penetration of epithelial tissues and escape from host immune response [<xref ref-type="bibr" rid="scirp.80225-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.80225-ref2">2</xref>] . Serum induced Ras mediated signaling pathways involve Ras1-cAMP-PKA and Cek1-MAPK pathway responsible for Y-H form transition [<xref ref-type="bibr" rid="scirp.80225-ref3">3</xref>] . Y-H transition is negatively regulated by the hyphal suppressor genes, Nrg1, Mig1, Tup1 and Rfg1 [<xref ref-type="bibr" rid="scirp.80225-ref4">4</xref>] . Upregulation of hyphal specific genes are reported during yeast to hyphal form transformation [<xref ref-type="bibr" rid="scirp.80225-ref5">5</xref>] . Targeting of hyphal specific genes involved in these pathways may be a promising strategy for anti-Candida drug development [<xref ref-type="bibr" rid="scirp.80225-ref6">6</xref>] . In this study the effect of Phenazine methosulphate (PMS) on the expression of genes involved in Yeast to hyphal transition is explored.</p><p>Phenazine methosulphate (PMS), an analog of 5-methylphenazine-1-carboxylic acid (5 MPCA) is reported to exhibit antifungal activity against hyphal growth and biofilm formation of C. albicans in Candida albicans [<xref ref-type="bibr" rid="scirp.80225-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.80225-ref8">8</xref>] . PMS generate reactive oxygen species (ROS) which is responsible for killing or inhibition of growth in C. albicans [<xref ref-type="bibr" rid="scirp.80225-ref7">7</xref>] . PMS and 5MPCA generally bind with cellular amines covalently and accumulate in the cell leads to killing of C. albicans [<xref ref-type="bibr" rid="scirp.80225-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.80225-ref9">9</xref>] .</p><p>In this study we have identified the potential targets of PMS in C. albicans. The repositioning of PMS as an antifungal agent could be a promising strategy for the treatment of fungal infections.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Medium and Culture Conditions</title><p>The standard strain of Candida albicans ATCC 90028 provided by Institute of Microbial Technology, Chandigarh, India. Yeast extract Peptone Dextrose (YPD) agar medium was used to maintain culture and the culture was stored at 4˚C. PMS and all the media components purchased from HiMedia, India. A single isolated colony of C. albicans from YPD agar plate was used to inoculate 50 ml YPD broth in a 250 ml conical flask. The flasks were incubated for 24 h in an orbital shaking incubator (100 rpm) at 30˚C [<xref ref-type="bibr" rid="scirp.80225-ref10">10</xref>] .</p></sec><sec id="s2_2"><title>2.2. Minimum Inhibitory Concentration</title><p>The effect of PMS on the growth of C. albicans in planktonic form was studied by using the standard broth microdilution methodology based on the Clinical Laboratory Standards Institute guidelines (Pfaller et al., 1994). Various concentrations of PMS ranging from 0.062 to 2 mg/ml were prepared in RPMI-1640 medium in 96 well plates (Costar, Corning Inc. USA). Cell suspension (1 &#215; 10<sup>3</sup> cells ml<sup>−1</sup>) was added to 100 μl of RPMI-1640 medium in each well. The plates were incubated at 35˚C for 48 h and growth was analyzed by measuring absorbance at 620 nm using a microplate reader (Multiskan EX, Thermo Electron Corp. USA). The lowest concentration of PMS which caused a 50% reduction in the absorbance compared to the control was considered as the minimum inhibitory concentration (MIC) for the growth of C. albicans [<xref ref-type="bibr" rid="scirp.80225-ref10">10</xref>] .</p></sec><sec id="s2_3"><title>2.3. Minimum Fungicidal Concentration (MFC)</title><p>To determine the MFC, Candida cells from the wells containing MIC and above the MIC were used. Aliquots of 10 μl from these wells were spread on YPD agar. These plates were incubated for 48 h at 30˚C and observed for the presence of colonies. No appearance of colonies on the agar plates was noted as fungicidal effect. The lowest concentration of the test molecule in the microplate well from which an aliquot showing no growth was considered as the MFC [<xref ref-type="bibr" rid="scirp.80225-ref11">11</xref>] .</p></sec><sec id="s2_4"><title>2.4. Adhesion Assay</title><p>The effect of Capric and Caprylic acid on the adherence of C. albicans to a solid surface (i.e. polystyrene) was studied using a microplate-based assay. Different series of concentrations were prepared in Phosphate buffered saline (PBS) and of 50 μl of aliquots were added in to wells of microtiter plates. The final volume of the assay system in each well was kept at 100 μl. The plate is incubated at 37˚C for 90 min at 100 rpm in an orbital shaking incubator to allow adherence of cells. The adherence of cells were observed in each well by relative metabolic activity (RMA) using the XTT-assay [<xref ref-type="bibr" rid="scirp.80225-ref10">10</xref>] .</p></sec><sec id="s2_5"><title>2.5. Biofilm Development Assay</title><p>Biofilm formation was done on tissue culture treated 96-well polystyrene plates. 100 μl of Cell suspensions of 1 &#215; 10<sup>7</sup> cells ml<sup>−1</sup> were added into each well and allowed to adhere on solid surface at 37˚C for 90 min at 100 rpm. After adhesion wells were washed with PBS two times. RPMI-1640 medium (200 μl) along with various concentrations of PMS were incubated for 48 h at 37˚C. Developed biofilms were observed under an inverted light microscope (Metzer, India). XTT metabolic assay was used Quantitation of Biofilm growth. Photographs were taken with a Labomed microphotography system (Labomed, India) at 200 X magnification [<xref ref-type="bibr" rid="scirp.80225-ref12">12</xref>] .</p></sec><sec id="s2_6"><title>2.6. Mature Biofilm Assay</title><p>To determine the activity of the PMS against mature C. albicans biofilms, 24 h old biofilm was used. Wells were washed with PBS to remove nonadhered planktonic cells. Various concentrations of PMS prepared in RPMI 1640 were added to wells. Plates were incubated for 48 h and then washed with PBS. Wells were observed for the presence or absence of biofilm using an inverted light microscope (Metzer, India). XTT metabolic assay was used to analyze the biofilm growth [<xref ref-type="bibr" rid="scirp.80225-ref12">12</xref>] .</p></sec><sec id="s2_7"><title>2.7. XTT Metabolic Assay</title><p>Biofilm growth was quantified using XTT metabolic assay. XTT solution was prepared by mixing 1 mg/ml of XTT salt in PBS and stored at 20˚C. Menadione (Sigma Aldrich, India) solution was prepared in acetone (4 μM) and added to the XTT salt solution. The wells containing biofilms were washed with PBS to remove non-adhered cells and incubated with 100 μl of XTT-menadione solution in dark, at 37˚C for 5 h. Color formation by the water soluble formazan product was measured at 450 nm using a microplate reader (Multiskan EX, Thermo Electron Corp. USA) [<xref ref-type="bibr" rid="scirp.80225-ref12">12</xref>] .</p></sec><sec id="s2_8"><title>2.8. Yeast to Hyphal (Y-H) Form Morphogenesis Assay</title><p>Serum-induced Y-H transition in C. albicans was studied in a microplate-based assay. A series of concentrations of PMS was prepared in deionized distilled water with 20% serum. 1 &#215; 10<sup>6</sup> cells ml<sup>−1</sup> Cells were inoculated in test and control wells. The final volume of the assay was 200 μl. After incubation for 2 h at 37˚C in an orbital shaker at 200 rpm, formation of germ tubes were observed microscopically. Numbers of yeast cells and hyphae were counted by using an inverted microscope (Metzer, India). Photographs were taken with a Labomed microphotography system at 200 X magnification. Inhibition of 50% hyphae formation was compared with control and considered as MIC for morphogenesis. [<xref ref-type="bibr" rid="scirp.80225-ref10">10</xref>] .</p></sec><sec id="s2_9"><title>2.9. Scanning Electron Microscopy</title><p>Adhesion of Candida albicans cells on polystyrene discs (1 &#215; 10<sup>7</sup> cells/ml) were carried out in 12-well plates at 37˚C at 50 rpm for 90 min. Samples were fixed in 2.5% of glutaraldehyde in 0.1 mol phosphate buffer (pH 7.2) for 24 h at 4˚C. Samples were post fixed in 2% aqueous solution of osmium tetraoxide for 4 h, and then dehydrated in a series of graded alcohols. The samples were mounted over stubs and gold coating was performed using an automated gold coater. Images were obtained by JOEL 6360 (Japan) scanning electron microscope [<xref ref-type="bibr" rid="scirp.80225-ref12">12</xref>] .<sup> </sup></p></sec><sec id="s2_10"><title>2.10. Hemolytic Activity</title><p>Hemolytic activity was determined by using human red blood cells [<xref ref-type="bibr" rid="scirp.80225-ref13">13</xref>] . Suspension of RBC was diluted 1:10 in PBS. Aliquotes of 100 μL from this suspension was added in to 100 μL of a different concentration of test molecules in the same buffer in Eppendorff tubes. 1% Triton X 100 was used for total hemolysis. After incubation of 1 h at 37˚C it was centrifuged for 10 min at 2000 rpm at 20˚C. 150 μL from supernatant was transferred to a flat-bottomed microtiter plate, and O.D. is taken at 450 nm. All the experiments were done in triplicates.</p><p>The hemolysis percentage was calculated by following formula:</p><p>% of hemolysis = [(A<sub>450</sub> of test compound treated Sample − A<sub>450</sub> of buffer treated sample)/(A<sub>450</sub> of 1% Triton X 100 treated sample − A<sub>450</sub> of buffer treated sample)] &#215; 100</p></sec><sec id="s2_11"><title>2.11. Cell Cycle Studies</title><p>C. albicans yeast cells from the log phase were harvested, washed and starved for nutrients for 1 h. cells (10<sup>3</sup> cfu/ml) were inoculated to each flask containing 50 ml YPD broth and MIC of PMS. Flask without treatment of PMS was considered as Control. All the flasks were incubated at 30˚C for 3 h. Cells were centrifuged at 1000 rpm for 5 min. washed and fixed in 1 ml of 70% ethanol by incubating at room temperature on a rotary shaker (REMI, India) for 30 min. Cells were harvested by centrifugation (Genei, Bangalore, India) at 1000 rpm for 5 min, washed twice with 1 ml of 50 mM Tris (pH 7.8). Washed cells were resuspended in 500 μl of 50 mM Tris containing 10 μg RNase A and incubated for 2 h at 37˚C. After incubation samples were subjected to protease treatment (5 mg/ml pepsin in 0.05 M HCl) for 1 h at 25˚C to reduce cellular clumps. Cells were harvested by centrifugation and resuspended in 500 μl FACS-buffer (200 mM Tris/HCl pH 7.5; 200 mM NaCl; 78 mM MgCl<sub>2</sub>). 15 μl of propidium iodide (1 mg/ml) was added to each tube and incubated for 30 min and stored at 4˚C. Before analysis, cells were sonicated for 10 s and analyzed using a FACS Calibur cytometer (Becton-Dickinson, San Jose, Calif.) and analyzed with Cell Quest 3.0 software [<xref ref-type="bibr" rid="scirp.80225-ref14">14</xref>] .</p></sec><sec id="s2_12"><title>2.12. Gene Expression Assay</title><p>The expression of hyphal genes during serum induced morphogenesis was measured by using Real Time PCR. C. albicans yeast phase cells (1 &#215; 10<sup>6</sup> cells/ml) were inoculated and incubated for 90 min in 20% serum containing PMS (0.062 mg/ml). Total RNA was isolated by using RNeasy<sup>&#174;</sup> Mini Kit (QIAGEN, USA) and converted to cDNA by using SuperScript<sup>&#174;</sup> III for first strand synthesis (Invitrogen, Life technologies, USA). PCR reactions were conducted by using KAPA SYBR<sup>&#174;</sup> Fast qPCR Kit Master mix (2x) (BIOSYSTEMS, South Africa) in 96 well PCR plates with preliminary denaturation for 3 min at 95˚C. This was followed by 32 amplifications cycles of denaturation at 95˚C for 30 s, annealing at 60˚C for 20 s and primer extension at 72˚C for 30 s (CFX 96 Real time System, Bio-Rad, USA). Primers were purchased from Eurofins Genomics India Pvt. Ltd. (<xref ref-type="table" rid="table1">Table 1</xref>). Actin was used as an internal control and the transcript levels of selected genes were calculated using the formula 2<sup>-ΔΔCT</sup> [<xref ref-type="bibr" rid="scirp.80225-ref15">15</xref>] .</p></sec><sec id="s2_13"><title>2.13. Statistical Analysis</title><p>Values mentioned are the mean with standard deviations, obtained from three different observations. Values in the control and treatment groups were compared using Student’s t-test. A value of p &lt; 0.05 was considered statistically significant [<xref ref-type="bibr" rid="scirp.80225-ref10">10</xref>] .</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. The Anti-Candida Efficacy of Phenazine Methosulphate (PMS)</title><p>PMS inhibited planktonic growth of Candida albicans ATCC 90028 in a concentration dependent fashion (<xref ref-type="fig" rid="fig1">Figure 1</xref>). More than 90% (p &lt; 0.05) of the growth was inhibited at 0.062 mg/ml. 99% of planktonic growth was inhibited by PMS after 48 hrs of exposure at 0.25 mg/ml (<xref ref-type="table" rid="table1">Table 1</xref>). PMS caused significant inhibition of developing as well as mature biofilm formation (<xref ref-type="fig" rid="fig1">Figure 1</xref>, <xref ref-type="fig" rid="fig2">Figure 2</xref>). MIC values for developing biofilm and mature biofilm were 0.25 mg/ml and 0.5 mg/ml respectively. &gt;70% of 48 h old mature biofilm growth was eradicated at 0.5 mg/ml (<xref ref-type="fig" rid="fig1">Figure 1</xref>). MIC values were established for Adhesion for PMS (<xref ref-type="table" rid="table2">Table 2</xref>). Adhesion of C. albicans ATCC 90,028 to polystyrene plate surface was inhibited significantly (p &lt; 0.05) by PMS at &gt;16 &#181;g /ml (<xref ref-type="fig" rid="fig1">Figure 1</xref>). MIC50 for inhibition of adhesion was 16 &#181;g /ml (<xref ref-type="table" rid="table2">Table 2</xref>). After treatment of PMS (0.031 mg/ml) on C. albicans caused cell cycle arrest in S phase (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Gene specific primers used in qRT-PCR</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primers</th><th align="center" valign="middle" >Sequence (5’ → 3’)</th></tr></thead><tr><td align="center" valign="middle" >ACTIN-F</td><td align="center" valign="middle" >5’ATGGACGGTGAAGAAGTTGC 3’</td></tr><tr><td align="center" valign="middle" >ACTIN-R</td><td align="center" valign="middle" >5’ACCTCTTTTGGATTGGGCTTCA 3’</td></tr><tr><td align="center" valign="middle" >RAS1-F</td><td align="center" valign="middle" >5’GGCCATGAGAGAACAATATA 3’</td></tr><tr><td align="center" valign="middle" >RAS1-R</td><td align="center" valign="middle" >5’GTCTTTCCATTTCTAAATCAC 3’</td></tr><tr><td align="center" valign="middle" >PDE 2-F</td><td align="center" valign="middle" >5’ ACCACCACCACTACTACTAC 3’</td></tr><tr><td align="center" valign="middle" >PDE 2-R</td><td align="center" valign="middle" >5’ AAAATGAGTTGTTCCTGTCC 3’</td></tr><tr><td align="center" valign="middle" >BCY 1-F</td><td align="center" valign="middle" >5’ CCC AAGCTTATGTCTAATCCTCAACAGCA 3’</td></tr><tr><td align="center" valign="middle" >BCY 1-R</td><td align="center" valign="middle" >5’ GGG CTGCAGTTAATGACCAGCAGTTGGGT 3’</td></tr><tr><td align="center" valign="middle" >EFG 1-F</td><td align="center" valign="middle" >5’ TATGCCCCAGCAAACAACTG 3’</td></tr><tr><td align="center" valign="middle" >EFG 1-R</td><td align="center" valign="middle" >5’ TTGTTGTCCTGCTGTCTGTC3’</td></tr><tr><td align="center" valign="middle" >TEC 1-F</td><td align="center" valign="middle" >5’ AGGTTCCCTGGTTTAAGTG 3’</td></tr><tr><td align="center" valign="middle" >TEC 1-R</td><td align="center" valign="middle" >5’ ACTGGTATGTGTGGGTGAT 3’</td></tr><tr><td align="center" valign="middle" >ECE 1-F</td><td align="center" valign="middle" >5’-CCCTCAACTTGCTCCTTCACC-3’</td></tr><tr><td align="center" valign="middle" >ECE 1-R</td><td align="center" valign="middle" >5’-GATCACTTGTGGGATGTTGGTAA-3’</td></tr><tr><td align="center" valign="middle" >CEK 1-F</td><td align="center" valign="middle" >5’ AGCTATACAACGACCAATTAA 3’</td></tr><tr><td align="center" valign="middle" >CEK 1-R</td><td align="center" valign="middle" >5’ CATTAGCTGA ATGCATAGCT 3’</td></tr><tr><td align="center" valign="middle" >HST 7-F</td><td align="center" valign="middle" >5’ ACTCCAACATCCAATATAACA 3’</td></tr><tr><td align="center" valign="middle" >HST 7-R</td><td align="center" valign="middle" >5’ TTGATTGACGTTCAATGAAGA 3’</td></tr><tr><td align="center" valign="middle" >CPH1-F</td><td align="center" valign="middle" >5’ATGCAACACTATTTATACCTC 3’</td></tr><tr><td align="center" valign="middle" >CPH2-R</td><td align="center" valign="middle" >5’CGGATATTGTTGATGATGATA 3’</td></tr><tr><td align="center" valign="middle" >CDC35-F</td><td align="center" valign="middle" >5’TTCATCAGGGGTTATTTCAC 3’</td></tr><tr><td align="center" valign="middle" >CDC35-R</td><td align="center" valign="middle" >5’CTCTATCAACCCGCCATTTC 3’</td></tr><tr><td align="center" valign="middle" >HWP1-F</td><td align="center" valign="middle" >5’TGGTGCTATTACTATTCCGG</td></tr><tr><td align="center" valign="middle" >HWP1-R</td><td align="center" valign="middle" >5’CAATAATAGCAGCACCGAAG</td></tr><tr><td align="center" valign="middle" >MIG1</td><td align="center" valign="middle" >5’CTTCAACTAGCCTATATTCCGATGG 3’</td></tr><tr><td align="center" valign="middle" >MIG1</td><td align="center" valign="middle" >5’-CTTTCT GTAGGTACCAACAACTAC 3’</td></tr><tr><td align="center" valign="middle" >NRG1-F</td><td align="center" valign="middle" >5’CACCTCACTTGCAACCCC</td></tr><tr><td align="center" valign="middle" >NRG1-R</td><td align="center" valign="middle" >5’GCCCTGGAGATGGTCTGA</td></tr><tr><td align="center" valign="middle" >TUP1</td><td align="center" valign="middle" >5’ GAGGATCCCATGTATCCCCAACGCACCCAG 3’</td></tr><tr><td align="center" valign="middle" >TUP1</td><td align="center" valign="middle" >5’GGCGACGCGTCGTTTTTTGGTCCATTTCCAAATTCTG 3’</td></tr></tbody></table></table-wrap><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> The efficacies of PMS against C. albicans ATCC 90,028, showing the MICs for growth, adhesion, morphogenesis, and biofilm formation and MFCs for planktonic growth</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Test Molecule</th><th align="center" valign="middle"  colspan="5"  >MIC (mg/ml)</th><th align="center" valign="middle"  rowspan="2"  >MFC (mg/ml)</th></tr></thead><tr><td align="center" valign="middle" >Planktonic Growth</td><td align="center" valign="middle" >Developing Biofilm</td><td align="center" valign="middle" >Mature Biofilm</td><td align="center" valign="middle" >Adhesion</td><td align="center" valign="middle" >Yeast to Hyphae Morphogenesis</td></tr><tr><td align="center" valign="middle" >PMS</td><td align="center" valign="middle" >0.031</td><td align="center" valign="middle" >0.25</td><td align="center" valign="middle" >0.5</td><td align="center" valign="middle" >0.016</td><td align="center" valign="middle" >0.062</td><td align="center" valign="middle" >0.25</td></tr></tbody></table></table-wrap></sec><sec id="s3_2"><title>3.2. PMS Inhibited Serum Induced Yeast to Hyphal Form Morphogenesis</title><p>Significant (p &lt; 0.05) inhibition of serum induced yeast to hyphal form transition was observed in presence of PMS in a concentration dependent manner. More than fifty percentage inhibition of germ tube induction was found at 0.062 mg/ml (<xref ref-type="fig" rid="fig4">Figure 4</xref>).</p></sec><sec id="s3_3"><title>3.3. PMS Altered the Expression of Genes Involved in Yeast to Hyphal Form transition Pathways</title><p>Since PMS has shown inhibition of serum induced hyphal induction in C. albicans, we analyzed changes in expression levels of the genes involved in Ras1- cAMP-Efg1, Cek1-MAPK pathways with quantitative real-time PCR. It was found that the expression of Ras1 which is a master regulator was downregulated up to 1.14 fold (p &lt; 0.05) by treatment with PMS. Cdc35 and Pde2, the upstream components of cAMP dependent PKA pathway were upregulated by 1.09 and 1.46 fold respectively. Similarly expression of its downstream components Bcy1, Efg1 and Tec1 were upregulated by 2.75, 1.12, 1.65 fold. Ece1 and Hwp1 downstream of Efg1 were significantly downregulated by 1.56 and 11.16 fold respectively (<xref ref-type="fig" rid="fig5">Figure 5</xref>). Expression of Hst7, Cek1 and Cph1 involved in Cek1-MAPK pathways were upregulated by 1.44, 1.43 and 2.57 fold in presence of PMS respectively (<xref ref-type="fig" rid="fig5">Figure 5</xref>). Negative regulators of hyphal induction, Nrg1, Mig1 and Tup1 were upregulated by 1.53, 2.96 fold and 17.95 fold respectively (<xref ref-type="fig" rid="fig5">Figure 5</xref>).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>PMS, Phenazine derivative showed inhibition of Candida growth and killing of Candida biofilm [<xref ref-type="bibr" rid="scirp.80225-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.80225-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.80225-ref16">16</xref>] . PMS inhibited planktonic growth, morphogenesis, biofilm formation and adhesion of Candida albicans ATCC 90,028 (<xref ref-type="fig" rid="fig1">Figure 1</xref>). Serum induced yeast to hyphal transition was also inhibited by PMS at 0.062 mg/ml (<xref ref-type="fig" rid="fig4">Figure 4</xref>). After 3 hr of PMS treatment, it was found that cell cycle of C. albicans was arrested at the S phase (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p><p>Adherence of Candida cells to surface of polystyrene Microtitre plates was analyzed by microscopically and XTT assay. It was found that adhesion was</p><p>significantly inhibited by PMS treatment. Adhesion may be inhibited by PMS due to the downregulation of Hwp1 expression by 11.16 fold (<xref ref-type="fig" rid="fig5">Figure 5</xref>). Hwp1 encodes a glycosylphosphatidylinositol-modified cell wall protein that can serve as a target for mammalian transglutaminases to form covalent attachments between C. albicans and host epithelial cells [<xref ref-type="bibr" rid="scirp.80225-ref17">17</xref>] .</p><p>To know the effect of PMS at the transcription levels during yeast to hypha switching we performed qPCR. Ras1 gene which is a master regulator of both the pathways [<xref ref-type="bibr" rid="scirp.80225-ref18">18</xref>] was downreguated up to 1.14 fold by treatment with PMS. Expression its downstream components like Efg1 [<xref ref-type="bibr" rid="scirp.80225-ref4">4</xref>] which is a strong inducer of hyphal development was unaffected by the treatment of PMS. The expression of Tec1 was upregulated by 1.65 fold. Ece1 and Hwp1 are downstream of Efg1 were significantly downregulated by 1.56 and 11.16 fold respectively (<xref ref-type="fig" rid="fig5">Figure 5</xref>). Ece1 is required for cell elongation in C. albicans and Hwp1 is associated with adhesion and biofilm formation [<xref ref-type="bibr" rid="scirp.80225-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.80225-ref19">19</xref>] . In addition Cek1-MAPK pathway was affected by change in expression of Hst7 followed by Cek1 and Cph1. Their expression was slightly upregulated by 1.44, 1.43 and 2.57 fold respectively. Cph1 in C. albicans is regulated by a mitogen-activated protein MAP kinase cascade that includes Cst20, Hst7, and Cek1 [<xref ref-type="bibr" rid="scirp.80225-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.80225-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.80225-ref22">22</xref>] .</p><p>Hyphal suppressor gene like Nrg1, Mig1 and Rfg1 suppresses hyphal induction [<xref ref-type="bibr" rid="scirp.80225-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.80225-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.80225-ref24">24</xref>] and Tup1 repressor which is constitutively expressed forms a complex with MIG1, RFG1 and NRG1 negative regulators and thereby inhibit the activity of hyphal specific gene [<xref ref-type="bibr" rid="scirp.80225-ref4">4</xref>] . Tup1 encodes a transcriptional repressor that negatively controls filamentous growth in Candida albicans [<xref ref-type="bibr" rid="scirp.80225-ref4">4</xref>] . Expression of Nrg1, a negative regulator of hyphal induction was upregulated by 1.53 fold by treatment of PMS. Similarly Mig1 and Tup1 over expressed by 2.96 fold and 17.95 fold (<xref ref-type="fig" rid="fig5">Figure 5</xref>).</p></sec><sec id="s5"><title>5. Conclusion</title><p>Our in vitro study revealed that PMS inhibited major virulence factors in C. albicans like morphogenesis and adhesion. qPCR studies showed that PMS affects the signal transduction pathways in yeast to hyphal transition in C. albicans. Most of the genes involved in serum induced Ras1-cAMP-Efg1 and Cek1-MAPK pathway were affected differentially by the treatment with PMS. Upregulation of Hyphal suppressor gene like Tup1 may result in inhibition of yeast to hyphal induction. PMS arrested the cell cycle of C. albicans at S phase. PMS did not cause hemolysis of RBCs at the effective concentrations. PMS like molecules could be good molecules to treat candidiasis. In vivo studies need to be done to confirm the anti-Candida efficacy of PMS.</p></sec><sec id="s6"><title>Acknowledgements</title><p>AKJ and SMK are thankful to Prof. Pandit Vidyasagar, Vice Chancellor, SRTM University, Nanded for his kind support. SMK is also thankful to UGC, New Delhi for SAP DRS II Program for infrastructural support. WNG and RP are thankful to the Department of Biotechnology Research and Development grant, Savitribai Phule Pune University, Pune, India.</p></sec><sec id="s7"><title>Conflict of Interest</title><p>Authors declare that there is no Conflict of Interest.</p></sec><sec id="s8"><title>Cite this paper</title><p>Jadhav, A.K., Jangid, P., Patil, R., Gade, W., Kharat, K. and Karuppayil, S.M. (2017) Phenazine Methosulphate Modulating the Expression of Genes Involved in Yeast to Hyphal Form Signal Transduction in Candida albicans. Advances in Microbiology, 7, 707-718. https://doi.org/10.4236/aim.2017.711056</p></sec></body><back><ref-list><title>References</title><ref id="scirp.80225-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Calderone, R.A. and Fonzi, W.A. (2001) Virulence Factors of Candida albicans. Current Trends in Microbiology, 9, 327-335.  
https://doi.org/10.1016/S0966-842X(01)02094-7</mixed-citation></ref><ref id="scirp.80225-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Kumamoto, C.A. and Vinces, M.D. (2005) Contributions of Hyphae and Hypha-Co-Regulated Genes to Candida albicans Virulence. Cellular Microbiology, 7, 1546-1554. https://doi.org/10.1111/j.1462-5822.2005.00616.x</mixed-citation></ref><ref id="scirp.80225-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Biswas S., Van Dijck P. and Datta, A. (2007) Environmental Sensing and Signal Transduction Pathways Regulating Morphopathogenic Determinants of Candida albicans. Microbiology and Molecular Biology Reviews, 71, 348-376.  
https://doi.org/10.1128/MMBR.00009-06</mixed-citation></ref><ref id="scirp.80225-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Braun, B.R., Kadosh, D. and Johnson, A.D. (2001) NRG1, a Repressor of Filamentous Growth in C. albicans, is Down-Regulated during Filament Induction. EMBO Journal, 20, 4753-4761. https://doi.org/10.1093/emboj/20.17.4753</mixed-citation></ref><ref id="scirp.80225-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Carlisle, P.L., Banerjee, M., Lazzell, A., Monteagudo, C., López-Ribot, J.L. and Kadosh, D (2009) Expression Levels of a Filament-Specific Transcriptional Regulator Are Sufficient to Determine Candida albicans Morphology and Virulence. Proceedings of the National Academy of Sciences, 106, 599-604.  
https://doi.org/10.1073/pnas.0804061106</mixed-citation></ref><ref id="scirp.80225-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Jacobsen, I.D., Wilson, D., W&amp;auml;chtler, B., Brunke, S., Naglik, J.R. and Hube, B. (2012) Candida albicans Dimorphism as a Therapeutic Target. Expert Review of Anti-Infective Therapy, 10, 85-93. https://doi.org/10.1586/eri.11.152</mixed-citation></ref><ref id="scirp.80225-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Morales, D.K. and Hogan, D.A. (2010) Candida albicans Interactions with Bacteria in the Context of Human Health and Disease. PLOS Pathogens, 6, 1-4.  
https://doi.org/10.1371/journal.ppat.1000886</mixed-citation></ref><ref id="scirp.80225-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Morales, D.K., Jacobs, N.J., Rajamani, S., Krishnamurthy, M., Cubillos-Ruiz, J.R. and Hogan, D.A. (2010) Antifungal Mechanisms by Which a Novel Pseudomonas aeruginosa Phenazine Toxin Kills Candida albicans in Biofilms. Molecular Microbiology, 78, 1379-1392. https://doi.org/10.1111/j.1365-2958.2010.07414.x</mixed-citation></ref><ref id="scirp.80225-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Gibson, J., Sood, A. and Hogan, D.A. (2009) Pseudomonas aeruginosa-Candida albicans Interactions: Localization and Fungal Toxicity of a Phenazine Derivative. Applied and Environmental Microbiology, 75, 504-513.  
https://doi.org/10.1128/AEM.01037-08</mixed-citation></ref><ref id="scirp.80225-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Raut, J.S., Shinde, R.B., Chauhan, N.M. and Mohan Karuppayil, S. (2013) Terpenoids of Plant Origin Inhibit Morphogenesis, Adhesion, and Biofilm Formation by Candida albicans. Biofouling, 29, 87-96.  
https://doi.org/10.1080/08927014.2012.749398</mixed-citation></ref><ref id="scirp.80225-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Routh, M.M., Raut, J.S. and Karuppayil, S.M. (2011) Dual Properties of Anticancer Agents: An Exploratory Study on the in Vitro Anti-Candida Properties of Thirty Drugs. Chemother, 57, 372-380. https://doi.org/10.1159/000330454</mixed-citation></ref><ref id="scirp.80225-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Shinde, R.B., Raut, J.S. and Karuppayil, S.M. (2012) Biofilm Formation by Candida albicans on Various Prosthetic Materials and Its Fluconazole Sensitivity: A Kinetic Study. Mycoscience, 53, 220-226. https://doi.org/10.1007/S10267-011-0155-Y</mixed-citation></ref><ref id="scirp.80225-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Rajput, S.B. and Karuppayil, S.M. (2013) β-Asarone, an Active Principle of Acorus calamus Rhizome, Inhibits Morphogenesis, Biofilm Formation and Ergosterol Biosynthesis in Candida albicans. Phytomedicine, 20, 139-142.</mixed-citation></ref><ref id="scirp.80225-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Zore, G.B., Thakre, A.D., Jadhav, S. and Karuppayil, S.M. (2011) Terpenoids Inhibit Candida albicans Growth by Affecting Membrane Integrity and Arrest of Cell Cycle. Phytomedicine, 18, 1181-1190.</mixed-citation></ref><ref id="scirp.80225-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Chang, W., Li, Y., Zhang, L., Cheng, A. and Lou, H. (2012) Retigeric Acid B Attenuates the Virulence of Candida albicans via Inhibiting Adenylyl Cyclase Activity Targeted by Enhanced Farnesol Production. PLoS ONE, 7, 1-10.</mixed-citation></ref><ref id="scirp.80225-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Tupe, S.G., Kulkarni, R.R., Shirazi, F., Sant, D., Joshi, S.P. and Deshpande, M.V. (2015) Possible Mechanism of Antifungal Phenazine-1-Carboxamide from Pseudomonas sp. against Dimorphic Fungi Benjaminiella poitrasii and Human Pathogen Candida albicans. Journal of Applied Microbiology, 118, 39-48.  
https://doi.org/10.1111/jam.12675</mixed-citation></ref><ref id="scirp.80225-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Staab, J.F., Bradway, S.D., Fidel, P.L. and Sundstrom, P. (1999) Adhesive and Mammalian Transglutaminase Substrate Properties of Candida albicans Hwp1. Science, 283, 1535-1538. https://doi.org/10.1126/science.283.5407.1535</mixed-citation></ref><ref id="scirp.80225-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Feng, Q., Summers, E., Guo, B. and Fink, G. (1999) Ras Signaling Is Required for Serum-Induced Hyphal Differentiation in Candida albicans. Journal of Bacteriology, 181, 6339-6346.</mixed-citation></ref><ref id="scirp.80225-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Nobile, C.J., Andes, D.R., Nett, J.E., Smith, F.J., Yue, F., Phan, Q.T., Edwards, J.E., Filler, S.G. and Mitchell, A.P. (2006) Critical Role of Bcr1-Dependent Adhesins in C. albicans Biofilm Formation in Vitro and in Vivo. PLOS Pathogens, 2, 636-649.  
https://doi.org/10.1371/journal.ppat.0020063</mixed-citation></ref><ref id="scirp.80225-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Csank, C., Schr&amp;ouml;ppel, K., Leberer, E., Harcus, D., Mohamed, O., Meloche, S., Thomas, D.Y. and Whiteway, M. (1998) Roles of the Candida albicans Mitogen-Activated Protein Kinase Homolog, Cek1p, in Hyphal Development and Systemic Candidiasis. Infection and Immunity, 66, 2713-2721.</mixed-citation></ref><ref id="scirp.80225-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">K&amp;ouml;hler, J.R. and Fink, G.R. (1996) Candida albicans Strains Heterozygous and Homozygous for Mutations in Mitogen-Activated Protein Kinase Signaling Components Have Defects in Hyphal Development. Proceedings of the National Academy of Sciences, 93, 13223-13228. https://doi.org/10.1073/pnas.93.23.13223</mixed-citation></ref><ref id="scirp.80225-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Leberer, E., Harcus, D., Broadbent, I.D., Clark, K.L., Dignard, D., Ziegelbauer, K., Schmidt, A., Gow, N.A., Brown, A.J. and Thomas, D.Y. (1996) Signal Transduction through Homologs of the Ste20p and Ste7p Protein Kinases Can Trigger Hyphal Formation in the Pathogenic Fungus Candida albicans. Proceedings of the National Academy of Sciences, 93, 13217-13222. https://doi.org/10.1073/pnas.93.23.13217</mixed-citation></ref><ref id="scirp.80225-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Kadosh, D. and Johnson, A.D. (2005) Induction of the Candida albicans Filamentous Growth Program by Relief of Transcriptional Repression: A Genome-Wide Analysis. Molecular Biology of the Cell, 16, 2903-2912.  
https://doi.org/10.1091/mbc.E05-01-0073</mixed-citation></ref><ref id="scirp.80225-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Murad, A.M., Leng, P., Straffon, M., Wishart, J., Macaskill, S., MacCallum, D., Schnell, N., Talibi, D., Marechal, D., Tekaia, F. and d’Enfert, C. (2001) NRG1 Represses Yeast-Hypha Morphogenesis and Hypha-Specific Gene Expression in Candida albicans. The EMBO Journal, 20, 4742-4752.  
https://doi.org/10.1093/emboj/20.17.4742</mixed-citation></ref></ref-list></back></article>