<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">OJAS</journal-id><journal-title-group><journal-title>Open Journal of Animal Sciences</journal-title></journal-title-group><issn pub-type="epub">2161-7597</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ojas.2017.74030</article-id><article-id pub-id-type="publisher-id">OJAS-79068</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  ADSL, AMPD1, and ATIC Expression Levels in Muscle and Their Correlations with Muscle Inosine Monophosphate Content in Dapulian and Hybridized Pig Species
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Rongsheng</surname><given-names>Zhu</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yanping</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Huaizhong</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Song</surname><given-names>Lin</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Shouli</surname><given-names>Sun</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Baohua</surname><given-names>Huang</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hongmei</surname><given-names>Hu</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Institute of Animal Science and Veterinary Medicine, Shandong Academy of Agricultural Sciences, Jinan, China</addr-line></aff><aff id="aff2"><addr-line>Shandong Key Laboratory of Animal Disease Control and Breeding, Jinan, China</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>huhongmeipatty@163.com(HH)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>04</day><month>09</month><year>2017</year></pub-date><volume>07</volume><issue>04</issue><fpage>393</fpage><lpage>404</lpage><history><date date-type="received"><day>16,</day>	<month>July</month>	<year>2017</year></date><date date-type="rev-recd"><day>11,</day>	<month>September</month>	<year>2017</year>	</date><date date-type="accepted"><day>14,</day>	<month>September</month>	<year>2017</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  We investigated the relationship between muscle inosine monophosphate (IMP) content and mRNA levels of ADSL, AMPD1, and ATIC in Dapulian (DPL), Landrace &#215; Dapulian (LDPL), and Duroc &#215; Landrace &#215; Dapulian (DLDPL) hybridized pigs. Methods:
   
  The total RNA in longissimus dorsi 
  was
   isolated from Dapulian (DPL), Landrace &#215; Dapulian (LDPL) and Duroc &#215; Landrace &#215; Dapulian (DLDPL) hybridized pigs, weighed about 95.0 kg, n = 8/species. The internal genes with highest stability (YWHAZ and RPL4) were chosen from 11 common internal genes using Quantitative real-time PCR (qPCR) and geNorm software. The mRNA level
  s
   of ADSL, AMPD1 and ATIC genes were corrected with YWHAZ and RPL4 genes. The muscular IMP content was determined by HPLC.
   
  The muscular IMP content in DPL was higher than that in LDPL and DLDPL, 25.00% (p
   
  &lt;
   
  0.05) and 15.56% (p
   
  &gt;
   
  0.05), respectively. The muscular mRNA level of ADSL gene in DPL and LDPL 
  was
   higher than that in DLDPL, 24.14% and 12.07%, respectively (p
   
  &lt;
   
  0.05). The muscular mRNA level of ATIC gene in DPL and LDPL 
  was
   higher than that in DLDPL, 66.67% and 33.33%, respectively (p
   
  &lt;
   
  0.05). The muscular mRNA level of AMPD1 gene in DPL and LDPL 
  was
   higher than that in DLDPL, 14.49% and 33.26%, respectively. Furthermore, the IMP content was positively correlated with the mRNA level of ADSL, AMPD1 and ATIC genes, respectively (p
   
  &lt;
   
  0.05). The mRNA level of ADSL gene was highly related to that of AMPD1 and ATIC gene, respectively
   
  (p
   
  &lt;
   
  0.01), while that of AMPD1 gene was not strongly correlated with that of ATIC gene (p
   
  &gt;
   
  0.05). The muscular mRNA level of AMPD1, ADSL and ATIC genes and the muscular IMP content in DPL were highest, followed by those in LDPL and DLDPL. The muscular IMP content was positively correlated with the muscular mRNA level of ADSL, AMPD1 and ATIC genes, respectively.
 
</p></abstract><kwd-group><kwd>Pigs</kwd><kwd> ADSL Gene</kwd><kwd> AMPD1 Gene</kwd><kwd> ATIC Gene</kwd><kwd> Correlation</kwd><kwd> Inosine Monophosphate</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Inosine monophosphate (IMP) is a key aroma component present in livestock and poultry muscle and an indicator of meat quality [<xref ref-type="bibr" rid="scirp.79068-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref2">2</xref>] . The de novo synthesis of IMP in livestock and poultry requires a ten-step reaction, of which adenosuccinate lyase (ADSL) and 5-aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase (ATIC) catalyze the last three steps [<xref ref-type="bibr" rid="scirp.79068-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref6">6</xref>] . AMP deaminase 1 (AMPD1), which is highly expressed in muscle, catalyzes the hydrolysis of AMP into IMP and ammonia post-slaughter [<xref ref-type="bibr" rid="scirp.79068-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref8">8</xref>] . Studies on IMP metabolism have mainly focused on the polymorphisms and mRNA levels of AMPD1, ADSL, and ATIC and their association with IMP content in chickens [<xref ref-type="bibr" rid="scirp.79068-ref7">7</xref>] - [<xref ref-type="bibr" rid="scirp.79068-ref16">16</xref>] . The study findings revealed that the expression levels of these genes are higher in muscle than in other tissues [<xref ref-type="bibr" rid="scirp.79068-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref17">17</xref>] and that IMP content is associated with these three genes [<xref ref-type="bibr" rid="scirp.79068-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref15">15</xref>] . The polymorphisms of ADSL, AMPD1, and ATIC in different swine species and their associations with IMP metabolism have been reported [<xref ref-type="bibr" rid="scirp.79068-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref20">20</xref>] . In porcine muscle, researchers have studied the factors that affect IMP content, including swine species and storage temperature post-slaughter [<xref ref-type="bibr" rid="scirp.79068-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref23">23</xref>] . However, no study has focused on the relationship between ADSL, AMPD1, and ATIC and IMP content. The correlation between mRNA levels of ADSL and IMP content has been reported [<xref ref-type="bibr" rid="scirp.79068-ref20">20</xref>] , but not the correlation between mRNA levels of ATIC and AMPD1 and IMP content.</p><p>To determine the molecular mechanism of aroma component formation in native pigs and support the breeding of high-quality pigs, we measured the muscle mRNA levels of ADSL, AMPD1, and ATIC and determined their correlations with muscle IMP content in Dapulian (DPL), Landrace &#215; Dapulian (LDPL), and Duroc &#215; Landrace &#215; Dapulian (DLDPL) hybridized pigs.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Animals and Sampling</title><p>All experimental procedures with animals were conducted in accordance with the standards specified by Administrative Committee for Laboratory Animals of the Institute of Animal Husbandry &amp; Veterinary Science, Shandong Academy of Agricultural Sciences (IACC20060101, 1 Jan, 2006). DPL, LDPL, and DLDPL hybridized pigs of similar parity (~25.0 kg; n = 8 per species) were bred in Dongsan Dapulian Pig Seed Farm (Jining, Shandong, China). The animals had ad libitum access to water and feed and were sacrificed in Yinbao Food Co. Ltd. (Shandong, China), when the body weight was ~ 95.0 kg . Longissimus thoracis ( 6 g ) was excised 30 min post-slaughter and stored in liquid nitrogen.</p></sec><sec id="s2_2"><title>2.2. Measurement of IMP Content</title><p>Muscle IMP content was measured by HPLC [<xref ref-type="bibr" rid="scirp.79068-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref23">23</xref>] . Briefly, 0.2 g of longissimus dorsi was ground in liquid nitrogen, dissolved in 5% perchloric acid, and transferred into a volumetric flask. After 10 min, 10 mL of supernatant was transferred into another volumetric flask. The pH of the supernatant was adjusted to 6.5 with 0.5 mol/L NaOH, and the volume was adjusted to 50 mL with distilled water. An aliquot (1.5 mL) of the solution was centrifuged at 15,000 r/min for 10 min at 4˚C (Eppendorf Centrifuge 5415R). The resulting supernatant was passed through a 0.45-μm filter membrane (MILLEX GP) and analyzed by HPLC (Waters e2695 Separations Module, Waters 2489 UV/Visible Detector) coupled to a C18 column (250 &#215; 4.6 mm ) and a UV detector set at 254 nm.</p></sec><sec id="s2_3"><title>2.3. Total RNA Isolation and RT</title><p>Total RNA was isolated from longissimus dorsi using RNAiso Plus reagents (TaKaRa) and subjected to 0.8% denaturing agarose gel electrophoresis. RNA content was measured using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). Residual DNA was removed, and cDNA was synthesized using a PrimeScript RT reagent kit (RR 047A , Takara).</p></sec><sec id="s2_4"><title>2.4. Primer Design and Synthesis and Real-Time PCR</title><p>Eleven genes (ACTB, GAPDH, B 2M , TBP, RPL4, TOP2B, HMBS, HPRT1, SDHA, YWHAZ, and PPIA) were selected (<xref ref-type="table" rid="table1">Table 1</xref>) for stability analysis [<xref ref-type="bibr" rid="scirp.79068-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref25">25</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref27">27</xref>] . The specific primers of ADSL, AMPD1, and ATIC were designed using Primer Premier 5.0 software (<xref ref-type="table" rid="table2">Table 2</xref>) and synthesized by Sangon Biotech Co. Ltd. (Shanghai, China).</p><p>Quantitative real-time PCR (qPCR) of cDNA was performed in triplicate using LightCycler<sup>&#174;</sup> 480 SYBR Green I Master (Roche). The reaction mixture (20 &#181;L) contained Blue-SYBR-Green mix (10 μL), 1 &#181;L of each forward and reverse primers (10 μM/μL), cDNA (1 μL), and distilled water (7 μL). The PCR program consisted of a pre-denaturation step at 95˚C for 5 min, followed by 40 cycles at 95˚C for 10 s (denaturation) and 60˚C for 20 s (annealing and extension). The melting curve was performed at 95˚C for 5 s (denaturation), 65˚C for 60 s (annealing), and 97˚C for 10 s (melting). The CT values of the internal genes and target genes were quantified using Roche LightCycler<sup>&#174;</sup> 480 (Roche).</p></sec><sec id="s2_5"><title>2.5. Statistical Analysis</title><p>For the candidate internal gene, the minimal Ct value was set to 1. The relative value of genes was calculated by 2<sup>−ΔCt</sup>, where ΔCt = Ct value of other samples −</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Selected reference genes</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene</th><th align="center" valign="middle" >Full name</th><th align="center" valign="middle" >Primer (5’-3’)</th><th align="center" valign="middle" >Length (bp)</th><th align="center" valign="middle" >GenBank accession number</th><th align="center" valign="middle" >Reference</th></tr></thead><tr><td align="center" valign="middle" >GAPDH</td><td align="center" valign="middle" >Glyceraldehyde-3-phosphate dehydrogenase</td><td align="center" valign="middle" >F: TCGGAGTGAACGGATTTG R: CCTGGAAGATGGTGATGG</td><td align="center" valign="middle" >219</td><td align="center" valign="middle" >AF017079</td><td align="center" valign="middle" >Martino et al. 2011 [<xref ref-type="bibr" rid="scirp.79068-ref25">25</xref>]</td></tr><tr><td align="center" valign="middle" >ACTB</td><td align="center" valign="middle" >Beta-actin</td><td align="center" valign="middle" >F: TCTGGCACCACACCTTCT R: GATCTGGGTCATCTTCTCAC</td><td align="center" valign="middle" >114</td><td align="center" valign="middle" >DQ178130</td><td align="center" valign="middle" >Martino et al. 2011 [<xref ref-type="bibr" rid="scirp.79068-ref25">25</xref>]</td></tr><tr><td align="center" valign="middle" >B 2M</td><td align="center" valign="middle" >Beta-2-microglobulin</td><td align="center" valign="middle" >F: TTCACACCGCTCCAGTAG R:CCAGATACATAGCAGTTCAGG</td><td align="center" valign="middle" >166</td><td align="center" valign="middle" >NM 213978</td><td align="center" valign="middle" >Martino et al. 2011 [<xref ref-type="bibr" rid="scirp.79068-ref25">25</xref>]</td></tr><tr><td align="center" valign="middle" >TBP</td><td align="center" valign="middle" >TATA binding protein</td><td align="center" valign="middle" >F: GATGGACGTTCGGTTTAGG R: AGCAGCACAGTACGAGCAA</td><td align="center" valign="middle" >124</td><td align="center" valign="middle" >DQ178129</td><td align="center" valign="middle" >Martino et al. 2011 [<xref ref-type="bibr" rid="scirp.79068-ref25">25</xref>]</td></tr><tr><td align="center" valign="middle" >RPL4</td><td align="center" valign="middle" >Ribosomal protein L4</td><td align="center" valign="middle" >F: AGGAGGCTGTTCTGCTTCTG R: TCCAGGGATGTTTCTGAAGG</td><td align="center" valign="middle" >185</td><td align="center" valign="middle" >DQ845176</td><td align="center" valign="middle" >Cinar et al. 2012 [<xref ref-type="bibr" rid="scirp.79068-ref24">24</xref>]</td></tr><tr><td align="center" valign="middle" >PPIA</td><td align="center" valign="middle" >Peptidylprolyl isomerase A (cyclophilin A)</td><td align="center" valign="middle" >F: CACAAACGGTTCCCAGTTTT R: TGTCCACAGTCAGCAATGGT</td><td align="center" valign="middle" >171</td><td align="center" valign="middle" >NM_214353</td><td align="center" valign="middle" >Cinar et al. 2012 [<xref ref-type="bibr" rid="scirp.79068-ref24">24</xref>]</td></tr><tr><td align="center" valign="middle" >TOP2B</td><td align="center" valign="middle" >Topoisomerase II beta</td><td align="center" valign="middle" >F: AACTGGATGATGCTAATGATGCT R: TGGAAAAACTCCGTATCTGTCTC</td><td align="center" valign="middle" >137</td><td align="center" valign="middle" >AF222921</td><td align="center" valign="middle" >Martino et al. (2011) [<xref ref-type="bibr" rid="scirp.79068-ref25">25</xref>]</td></tr><tr><td align="center" valign="middle" >HMPS</td><td align="center" valign="middle" >Hydroxymethylbilane synthase</td><td align="center" valign="middle" >F:CTGTTTACCAAGGAGCTGGAAC R: TGAAGCCAGGAGGAAGCA</td><td align="center" valign="middle" >100</td><td align="center" valign="middle" >DQ178125</td><td align="center" valign="middle" >Tim et al. 2006 [<xref ref-type="bibr" rid="scirp.79068-ref27">27</xref>]</td></tr><tr><td align="center" valign="middle" >HPRT1</td><td align="center" valign="middle" >Hypoxanthine phosphoribosyltransferase 1</td><td align="center" valign="middle" >F: CCGAGGATTTGGAAAAGGT R: CTATTTCTGTTCAGTGCTTTGATGT</td><td align="center" valign="middle" >181</td><td align="center" valign="middle" >DQ178126</td><td align="center" valign="middle" >Martino et al. (2011) [<xref ref-type="bibr" rid="scirp.79068-ref25">25</xref>]</td></tr><tr><td align="center" valign="middle" >40SDHA</td><td align="center" valign="middle" >Succinate dehydrogenase</td><td align="center" valign="middle" >F: CTACAAGGGGCAGGTTCTGA R:AAGACAACGAGGTCCCAGGAG</td><td align="center" valign="middle" >141</td><td align="center" valign="middle" >DQ845177</td><td align="center" valign="middle" >Nygard et al. 2007 [<xref ref-type="bibr" rid="scirp.79068-ref26">26</xref>]</td></tr><tr><td align="center" valign="middle" >YWHAZ</td><td align="center" valign="middle" >Tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide</td><td align="center" valign="middle" >F: ATGCAACCAACACATCCTATC R: GCATTATTAGCGTGCTGTCTT</td><td align="center" valign="middle" >178</td><td align="center" valign="middle" >DQ178130</td><td align="center" valign="middle" >Martino et al. (2011) [<xref ref-type="bibr" rid="scirp.79068-ref25">25</xref>]</td></tr></tbody></table></table-wrap><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Target genes</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene</th><th align="center" valign="middle" >Full name</th><th align="center" valign="middle" >Primer (5’-3’)</th><th align="center" valign="middle" >Length (bp)</th><th align="center" valign="middle" >GenBank Accession number</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >ADSL</td><td align="center" valign="middle"  rowspan="2"  >Adenylosuccinate lyase</td><td align="center" valign="middle" >F: TATTGAGGTGCTCTCTGTGCTG</td><td align="center" valign="middle"  rowspan="2"  >156</td><td align="center" valign="middle"  rowspan="2"  >NM_001130733</td></tr><tr><td align="center" valign="middle" >R: CTCTATCTCCTTGAGGTTTGCC</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >ATIC</td><td align="center" valign="middle"  rowspan="2"  >5-Aminoimidazole-4-carboxamide ribonucleotide formyltransferase/IMP cyclohydrolase</td><td align="center" valign="middle" >F: CAGGGGACAAGGCAAACTAT</td><td align="center" valign="middle"  rowspan="2"  >182</td><td align="center" valign="middle"  rowspan="2"  >NM_001130736.1</td></tr><tr><td align="center" valign="middle" >R: TAACTCAGGGACCTCCTCAAAT</td></tr><tr><td align="center" valign="middle" >AMPD1</td><td align="center" valign="middle" >Adenosine monophosphate deaminase 1</td><td align="center" valign="middle" >F: GGTCTTTATCGGGCATTGTGT R: AATACTTGGAAGCGGTTTTTGG</td><td align="center" valign="middle" >82</td><td align="center" valign="middle" >NM_001123076.1</td></tr></tbody></table></table-wrap><p>minimal Ct value. For stability analysis, data were analyzed using geNorm V3.5 software.</p><p>The relative expression of the target genes in DPL, LDPL, and DLDPL hybridized pigs was expressed as 2<sup>−ΔCt</sup>, where ΔCt = Ct value of the target gene ? Ct value of internal gene. ΔCt &gt; 0 is indicative that the level of the target gene is higher than that of the internal gene, while ΔCt &lt; 0 is indicative that the level of the target gene is lower than that of the internal gene. Statistical analyses were performed with SPSS19.0 statistical software package for Windows (SPSS Inc., Chicago, IL, USA). Results were expressed as mean &#177; SD. One-way analysis of variance (ANOVA) was used for the comparison of muscle IMP content and expression of AMPD1, ADSL, ATIC between Dapulian and hybridized pig species.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Determination of RNA and qPCR Results</title><p>We obtained three RNA bands (28S, 18S, and 5S) via agarose gel electrophoresis. The A<sub>260</sub>/A<sub>280</sub> ratio and content of total RNA in muscle was 1.97 &#177; 0.02 and 268.9 &#177; 72.6 ng/μL, respectively. For the target and internal genes, the amplification curve had a typical S-shape, the melting curve had a standard peak at 85˚C - 90˚C, and the amplification efficiency of the standard curve ranged from 0.95 to 1.1, which met the requirements of relative quantitative analysis.</p></sec><sec id="s3_2"><title>3.2. Stability Analysis of Internal Genes</title><p>The Ct values of the 11 internal genes in swine muscle (n = 24) were measured using qPCR and analyzed using geNorm software. The stabilities of the internal genes were sorted according to the M values obtained from geNorm software (the smaller the M value, the higher the stability). The average stability degree of the two most stable internal genes was determined after successively removing the most unstable internal gene and analyzing the average of the stability degree of the remaining internal genes (M value). In decreasing order of M value (<xref ref-type="fig" rid="fig1">Figure 1</xref>), the internal genes were SDHA (0.770) &gt; B 2M (0.676) &gt; PPIA (0.582) &gt; TBP (0.556) &gt; GAPDH (0.489) &gt; ACTB (0.479) &gt; HPRT1 (0.462) &gt; TOP2B (0.440) &gt; HMBS (0.438) &gt; YWHAZ (0.402) &gt; RPL4 (0.390). Therefore, RPL4 had the highest stability, while SDHA had the lowest stability. Furthermore, the average M value of the 11 internal genes was 0.517. After removing the M value of the internal gene with the lowest stability, the average M value of the remaining 10 internal genes was 0.460. Successively, the average M value of the two most stable internal genes (YWHAZ and RPL4) was 0.193.</p><p>GeNorm software allows the determination of the number of internal genes by analyzing the matching variation, V value, and the selection of the optimal combination of internal genes other than a single internal gene. The Vn/Vn + 1 ratio was compared with the default V value (0.15). At Vn/Vn + 1 ratio &gt; 0.15, it is important to consider the n + 1 gene, whereas the new internal gene might not be considered. It would be optimal for the correction of system deviation to obtain more reliable results and analyze the subtle changes in gene expression. As shown in <xref ref-type="fig" rid="fig2">Figure 2</xref>, V<sub>2</sub>/V<sub>3</sub> = 0.094 &lt; 0.15, which revealed that the third internal gene might not be considered, and the average Ct value of YWHAZ and RPL4 may accurately correct and normalize the expression of the target gene.</p></sec><sec id="s3_3"><title>3.3. IMP Content and Expression of Genes Involved in IMP Metabolism</title><p>YWHAZ and RPL4 were selected as internal genes. The expression levels of ADSL, AMPD1, and ATIC were calculated by 2-ΔCt, where ΔCt = Ct value of the target gene − Ct value of internal gene (Vandesompele, et al., 2002). As shown in <xref ref-type="table" rid="table3">Table 3</xref>, DPL had the highest IMP content in muscle, followed by LDPL and DLDPL. DPL had 25.00% (P &lt; 0.05) and 15.56% more IMP than DLDPL and LDPL, respectively, and LDLP had 8.17% more IMP than DLDPL (P &gt; 0.05).</p><p>The muscle mRNA levels of ADSL and ATIC were higher in DPL and LDPL than in DLDPL, with no significant differences between DPL and LDPL. The mRNA levels of ADSL were higher (P &lt; 0.05) in DPL and LDPL than in DLDPL (24.14% and 12.07%, respectively). The mRNA levels of ATIC were higher (P &lt; 0.05) in DPL and LDPL than in DLDPL (66.67% and 33.33%, respectively). The mRNA levels of AMPD1 were higher in DPL than in LDPL and DLDPL (14.49% and 33.26%, respectively), while the difference between LDPL and DLDPL was not significant. Therefore, muscle IMP content in DPL, LDPL, and DLDPL had a similar trend to the mRNA levels of ADSL, AMPD1, and ATIC.</p></sec><sec id="s3_4"><title>3.4. Correlation between IMP Content and mRNA Levels of Genes Involved in IMP Metabolism</title><p><xref ref-type="table" rid="table4">Table 4</xref> shows that muscle IMP content was positively correlated with the mRNA levels of ADSL, AMPD1, and ATIC with correlation coefficients of 0.327, 0.335, and 0.342, respectively (P &lt; 0.05). The mRNA levels of ADSL were positively correlated with the mRNA levels of AMPD1 and ATIC with correlation coefficients of 0.501 and 0.391, respectively (P &lt; 0.01). The mRNA levels of AMPD1 were not significantly correlated with the mRNA levels of ATIC.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Data correction with the appropriate internal gene is critical to obtain reliable</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> IMP content and expression of ADSL, AMPD1, and ATIC</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Index</th><th align="center" valign="middle"  colspan="2"  >DPL</th><th align="center" valign="middle"  colspan="2"  >LDPL</th><th align="center" valign="middle"  colspan="2"  >DLDPL</th></tr></thead><tr><td align="center" valign="middle" >Mean &#177; SD</td><td align="center" valign="middle" >CV</td><td align="center" valign="middle" >Mean &#177; SD</td><td align="center" valign="middle" >CV</td><td align="center" valign="middle" >Mean &#177; SD</td><td align="center" valign="middle" >CV</td></tr><tr><td align="center" valign="middle" >IMP (mg/g)</td><td align="center" valign="middle" >2.60&#177; 0.32 <sup>a</sup></td><td align="center" valign="middle" >8.26</td><td align="center" valign="middle" >2.25&#177;0.22<sup>ab</sup></td><td align="center" valign="middle" >9.94</td><td align="center" valign="middle" >2.08&#177; 0.14 <sup>a</sup></td><td align="center" valign="middle" >6.62</td></tr><tr><td align="center" valign="middle" >ADSL</td><td align="center" valign="middle" >0.72&#177; 0.04 <sup>a</sup></td><td align="center" valign="middle" >6.02</td><td align="center" valign="middle" >0.65&#177; 0.05 <sup>a</sup></td><td align="center" valign="middle" >6.35</td><td align="center" valign="middle" >0.58&#177;0.06<sup>b</sup></td><td align="center" valign="middle" >9.66</td></tr><tr><td align="center" valign="middle" >AMPD1</td><td align="center" valign="middle" >5.69&#177; 0.67 <sup>a</sup></td><td align="center" valign="middle" >11.75</td><td align="center" valign="middle" >4.97&#177;0.49<sup>b</sup></td><td align="center" valign="middle" >9.87</td><td align="center" valign="middle" >4.27&#177;0.68<sup>b</sup></td><td align="center" valign="middle" >13.92</td></tr><tr><td align="center" valign="middle" >ATIC</td><td align="center" valign="middle" >0.05&#177; 0.01 <sup>a</sup></td><td align="center" valign="middle" >13.45</td><td align="center" valign="middle" >0.04&#177; 0.00 <sup>a</sup></td><td align="center" valign="middle" >9.15</td><td align="center" valign="middle" >0.03&#177;0.00<sup>b</sup></td><td align="center" valign="middle" >8.84</td></tr></tbody></table></table-wrap><p>Different lowercase superscripts represent significant differences within the same row (P &lt; 0.05). DPL, Dapulian pig; LDPL, Landrace &#215; Dapulian hybridized pigs; DLDPL, Duroc &#215; Landrace &#215; Dapulian hybridized pigs.</p><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> Correlation between IMP content and expression of ADSL, AMPD1, and ATIC</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Correlation coefficient</th><th align="center" valign="middle" >ADSL</th><th align="center" valign="middle" >AMPD1</th><th align="center" valign="middle" >ATIC</th></tr></thead><tr><td align="center" valign="middle" >IMP</td><td align="center" valign="middle" >0.327*</td><td align="center" valign="middle" >0.335*</td><td align="center" valign="middle" >0.342*</td></tr><tr><td align="center" valign="middle" >ADSL</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0.501**</td><td align="center" valign="middle" >0.391**</td></tr><tr><td align="center" valign="middle" >AMPD1</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0.186</td></tr></tbody></table></table-wrap><p>*P &lt; 0.05. **P &lt; 0.01.</p><p>data in mRNA expression analysis [<xref ref-type="bibr" rid="scirp.79068-ref28">28</xref>] . The expression of any internal gene cannot be consistent under different experimental conditions [<xref ref-type="bibr" rid="scirp.79068-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref28">28</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref29">29</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref30">30</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref31">31</xref>] . In this study, YWHAZ and RPL4 were selected as internal genes to correct the targets gene.</p><p>IMP, an indicator of meat quality, differs among porcine species. The IMP content of native pigs, including Laiwu and Yanan pigs, is significantly higher than that of lean species or native &#215; hybridized pigs [<xref ref-type="bibr" rid="scirp.79068-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref32">32</xref>] . In this study, muscle IMP content was the highest in DPL, followed by LDPL and DLDPL, which revealed that muscle IMP content decreased in the DPL bloodline. However, Zhang et al. [<xref ref-type="bibr" rid="scirp.79068-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref20">20</xref>] reported that muscle IMP content was higher in Danish landrace than in thin Wei pig or Anqing six-white pig, which was not in agreement with other studies [<xref ref-type="bibr" rid="scirp.79068-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref32">32</xref>] . This result might be attributed to slaughter age, dietary components, and feeding methods, which need further validation by increasing the sample size.</p><p>ADSL, AMPD1, and ATIC code for enzymes involved in IMP metabolism [<xref ref-type="bibr" rid="scirp.79068-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref17">17</xref>] . Studies have reported that there are significant differences in muscle IMP content within the same chicken species due to point mutations in ADSL, AMPD1, or ATIC [<xref ref-type="bibr" rid="scirp.79068-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref15">15</xref>] . The association between muscle IMP content and point mutations in ATIC or AMPD1 in swine [<xref ref-type="bibr" rid="scirp.79068-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref19">19</xref>] and the association between muscle IMP content and point mutations in ADSL in duck have been investigated, which can be used as a molecular marker for breeding strategies [<xref ref-type="bibr" rid="scirp.79068-ref33">33</xref>] . However, limited studies have focused on the relationship between IMP content and IMP-metabolic genes in chicken, duck, and swine or on the relationship between IMP content and AMPD1 in chicken, ADSL in duck, or ADSL in swine [<xref ref-type="bibr" rid="scirp.79068-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref33">33</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref34">34</xref>] . No study has focused on the relationship between IMP content and ADSL, AMPD1, or ATIC in swine. In this study, the muscle mRNA levels of ADSL and ATIC were higher in DPL and LDPL than in DLDPL, while the mRNA levels of AMPD1 were significantly higher in DPL than in LDPL or DLDPL. Muscle IMP content had a similar trend to that of mRNA levels of ADSL, AMPD1, and ATIC. Muscle IMP content is affected by the expression of ATIC or AMPD1 in swine [<xref ref-type="bibr" rid="scirp.79068-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref19">19</xref>] and by the expression of ADSL, AMPD1, and ATIC in chicken [<xref ref-type="bibr" rid="scirp.79068-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref15">15</xref>] , consistent with our study findings. However, Zhang et al. [<xref ref-type="bibr" rid="scirp.79068-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref34">34</xref>] reported that the expression of ADSL in Danish landrace was lower than that in Wei pig and higher than that in Anqing six-white pig without significant differences. Additionally, the expression of ADSL in Wei pig was higher than that in Anqing six-white pig, which was not consistent with our results. In this study, the muscle mRNA levels of ADSL were the highest in DPL, followed by LDPL and DLDPL. The different feeding methods between DPL and Wei and Anqing six-white pigs might affect the muscle IMP content and mRNA levels of ADSL resulting from. The muscle mRNA levels of AMPD1 in chickens and of ADSL in ducks are positively correlated with IMP content [<xref ref-type="bibr" rid="scirp.79068-ref33">33</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref34">34</xref>] , while the muscle mRNA levels of ADSL in swine are not highly correlated with IMP content [<xref ref-type="bibr" rid="scirp.79068-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.79068-ref34">34</xref>] . Our results showed that muscle IMP content was positively correlated with the mRNA levels of ADSL, AMPD1, and ATIC. The mRNA levels of ADSL were positively correlated with the mRNA levels of AMPD1 and ATIC, while the mRNA levels of AMPD1 were not significantly correlated with the mRNA levels of ATIC. The de novo synthesis of IMP consists of 10 reactions catalyzed by 10 enzymes. Muscle IMP can also be formed from the progressive hydrolysis of ATP post-slaughter, which involves several enzymes, such as ATPase, creatine kinase, adenosine deaminase, and phosphatase. Future studies should analyze the factors that affect muscle IMP content.</p><p>The relative expression of ADSL in DPL, LDPL, and DLDPL was positively correlated with IMP content. IMP has medium heritability [<xref ref-type="bibr" rid="scirp.79068-ref35">35</xref>] , which is important for the breeding of high-quality pigs. In this study, the mRNA levels of ADSL, AMPD1, and ATIC were different in the DPL hybridized pigs, which revealed that some key factors may regulate these genes. MicroRNA (miRNA) and siRNA are key molecules that regulate gene expression. MiRNAs are endogenous non-coding RNA molecules (22 nucleotides in length) with regulatory function in eukaryotes. MiRNAs recognize mRNA by base pairing and degrade the target mRNA or inhibit the translation of the target mRNA [<xref ref-type="bibr" rid="scirp.79068-ref36">36</xref>] . Specific miRNAs are involved in the regulation of ADSL, AMPD1, and ATIC. If the correlation between the relative expression of other enzymes involved in IMP synthesis and the IMP content in the corresponding tissues is identified, the genes that code for those enzymes may represent suitable molecular markers that assist in the selection of animal species with high IMP content.</p></sec><sec id="s5"><title>5. Conclusion</title><p>Muscle mRNA levels of ADSL, AMPD1, and ATIC and muscle IMP content were the highest in DPL followed by LDPL and DLDPL. Muscle IMP content was positively correlated with the mRNA levels of ADSL, AMPD1, and ATIC.</p></sec><sec id="s6"><title>Acknowledgements</title><p>This work was supported by the Youth Foundation of Shandong Academy of Agricultural Sciences [grant number 2014QNM41], the Key Research and Development Plan of Shandong Province, China [grant number 2015GNC111011], the National Natural Science Foundation of China [grant number 31501928, 31501927], and the Natural Science Foundation of Shandong Province, China [grant number ZR2015CM007].</p></sec><sec id="s7"><title>Cite this paper</title><p>Zhu, R.S., Wang, Y.P., Wang, H.Z., Lin, S., Sun, S.L., Huang, B.H. and Hu, H.M. (2017) ADSL, AMPD1, and ATIC Expression Levels in Muscle and Their Correlations with Muscle Inosine Monophosphate Content in Dapulian and Hybridized Pig Species. Open Journal of Animal Sciences, 7, 393-404. https://doi.org/10.4236/ojas.2017.74030</p></sec></body><back><ref-list><title>References</title><ref id="scirp.79068-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, G.Q., Ma, Q.G. and Ji, C. ( 2008) Effects of Dietary Inosinic Acid on Carcass Characteristics, Meat Quality, and Deposition of Inosinic Acid in Broilers. Poultry Science, 87, 1364-1369. https://doi.org/10.3382/ps.2007-00193</mixed-citation></ref><ref id="scirp.79068-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Wifall, T.C., Faes, T.M., Taylor-Burds, C.C., et al. (2007) An Analysis of 5’-Inosine and 5’-Guanosine Monophosphate Taste in Rats. Chemical Senses, 32, 161-172. https://doi.org/10.1093/chemse/bjl043</mixed-citation></ref><ref id="scirp.79068-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Boutchueng-Djidjou, M., Collard-Simard, G., Fortier, S., et al. (2015) The Last Enzyme of the de novo Purine Synthesis Pathway 5-Aminoimidazole-4-carboxamide Ribonucleotide Formyltransferase/IMP Cyclohydrolase (ATIC) Plays a Central Role in Insulin Signaling and the Golgi/Endosomes Protein Network. Mol Cell Proteomics, 14, 1079-1092. https://doi.org/10.1074/mcp.M114.047159</mixed-citation></ref><ref id="scirp.79068-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Li, J.L., Li, H.T., Gao, L.F., et al. (2011) SNPs Site Analysis and Expression Characterization of ATIC Gene in Swine. Journal of Northeast Agricultural University, 42, 22-25.</mixed-citation></ref><ref id="scirp.79068-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Ye, M.H., Chen, J.L., Zhao, G.P., et al. (2010) Correlation between Polymorphisms in ADSL and GARS-AIRS-GART Genes with Inosine 5’-Monophosphate (IMP) Contents in Beijing-You Chickens. British Poultry Science, 51, 609-613. https://doi.org/10.1080/00071668.2010.508486</mixed-citation></ref><ref id="scirp.79068-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Zikanova, M., Skopova, V., Hnizda, A., Krijt, J., et al. (2010) Biochemical and Structural Analysis of 14 Mutant ADSL Enzyme Complexes and Correlation to Phenotypic Heterogeneity of Adenylosuccinate Lyase Deficiency. Human Mutation, 31, 445-455. https://doi.org/10.1002/humu.21212</mixed-citation></ref><ref id="scirp.79068-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Chai, L.J., Chu, M.X., Wen, J., et al. (2005) Study on Polymorphisms of AMPD1 Gene and Its Association with IMP Content in Chickens. Acta Veterinaria et Zootechnica Sinica, 36, 1112-1120.</mixed-citation></ref><ref id="scirp.79068-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Han, W., Zhang, X.Y., Li, H.F., et al. (2009) Effects of Single and Pyramiding Genotypes of ADSL and GARS-AIRS—GART Genes on Baier Chicken Muscle Inosine Monophosphate (IMP) Contents. Journal of Agricultural Biotechnology, 17, 577-581.</mixed-citation></ref><ref id="scirp.79068-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Gong, L.L. (2011) Genetic Variation and Expression of ADSL and GARS-AIRS-GART Genes and Their Associations with Meat Quality in Chicken. Yangzhou University, Yangzhou.</mixed-citation></ref><ref id="scirp.79068-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Hu, J., Yu, P., Ding, X., et al. (2015) Genetic Polymorphisms of the AMPD1 Gene and Their Correlations with IMP Contents in Fast Partridge and Lingshan Chickens. Gene, 574, 204-209. https://doi.org/10.1016/j.gene.2015.08.008</mixed-citation></ref><ref id="scirp.79068-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Shu, J.T., Bao, W.B., Zhang, H.X., et al. (2007) Correlation between Adenylosuccinate Lyase (ADSL) Gene Polymorphism and Inosine Monophosphate Acid (IMP) Content in Domestic Fowl and Genetic Relationship between Red Jungle Fowl and Domestic Fowl. Hereditas, 29, 343-348. https://doi.org/10.1360/yc-007-0343</mixed-citation></ref><ref id="scirp.79068-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Shu, J.T., Ji, W.L., Bao, W.B., et al. (2007) The Effect of ADSL and GARS-AIRS-GART Genes on Inosine Monophate Content in Chicken Meat. Acta Veterinaria et Zootechnica Sinica, 38, 786-791.</mixed-citation></ref><ref id="scirp.79068-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Shu, J.T., Bao, W.B., Zhang, X.Y., et al. (2008) Association and Haplotype Analysis of purH Gene with Inosine Monophosphate Content in Chickens. Animal Biotechnology, 19, 310-314. https://doi.org/10.1080/10495390802391785</mixed-citation></ref><ref id="scirp.79068-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Shu, J.T., Bao, W.B., Zhang, X.Y., et al. (2009) Combined Effect of Mutations in ADSL and GARS-AIRS-GART Genes on IMP Content in Chickens. British Poultry Science, 50, 680-686. https://doi.org/10.1080/00071660903391709</mixed-citation></ref><ref id="scirp.79068-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Shu, J.T., Bao, W.B., Wu, X.S., et al. (2009) Analysis of the Polymorphisms of AIRC Gene and Its Genetic Effect on IM P Content in Chicken. Acta Veterinaria et Zootechnica Sinica, 40, 155-160.</mixed-citation></ref><ref id="scirp.79068-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, H.F., Gao, G.L., Wang, H.W., et al. (2014) Effects of Different Breeds and Raising Modes on Meat Flavors and Candidate Genes Expression Levels. Journal of Agricultural Biotechnology, 22, 1018-1026.</mixed-citation></ref><ref id="scirp.79068-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Morisaki, H. and Morisaki, T. (2008) AMPD Genes and Urate Metabolism. Nihon Rinsho, 66, 771-777.</mixed-citation></ref><ref id="scirp.79068-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Liu, H., Xu, Y., Zhao, L.L., et al. (2008) Molecular Cloning and Mutation Site Analysis of AMPD1 Gene in Swine. Yi Chuan, 30, 175-178. https://doi.org/10.3724/SP.J.1005.2008.00175</mixed-citation></ref><ref id="scirp.79068-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Liu, H. (2008) Molecular Cloning, Expression and Genetic Variation of AMPD1 Gene in Wild Boar and Swine. Northeast Agricultural University, Haerbin.</mixed-citation></ref><ref id="scirp.79068-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, X.D., Zhang, S.J., Ding, Y.Y., et al. (2015) Association between ADSL, GARS-AIRS-GART, DGAT1, and DECR1 Expression Levels and Pork Meat Quality Traits. Genetics and Molecular Research, 14, 14823-14830. https://doi.org/10.4238/2015.November.18.47</mixed-citation></ref><ref id="scirp.79068-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Hu, H.M., Guo, J.F., Zhu, R.S., et al. (2011) Comparison of Inosinic Acid and Intramuscular Fat Content in Longissimus Muscles of Different Breed Pigs. Journal of Yangzhou University (Agricultural and Life Science Edition), 32, 34-36.</mixed-citation></ref><ref id="scirp.79068-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Yao, Z.L., Liu, G.Q., Yan, W.M., et al. (2012) Changes and the Relationship of Inosine-5’-Monophosphate and Biogenic Amine of Chilled Pork during Storage. Science and Technology of Food Industry, 33, 184-191.</mixed-citation></ref><ref id="scirp.79068-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Zhu, R.S., Hu, H.M., Han, H., et al. (2008) Research on Inosinic Acid and Intramuscular Fat Content in Musle of Laiwu Pigs. Acta Ecologiac Animalis Domastici, 29, 63-65.</mixed-citation></ref><ref id="scirp.79068-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Cinar, M.U., Islam, M.A., Uddin, M.J., et al. (2012) Evaluation of Suitable Reference Genes for Gene Expression Studies in Porcine Alveolar Macrophages in Response to LPS and LTA. BMC Research Notes, 5, 107. https://doi.org/10.1186/1756-0500-5-107</mixed-citation></ref><ref id="scirp.79068-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Martino, A., Cabiati, M., Campan, M., et al. (2011) Selection of Reference Genes for Normalization of Real-Time PCR Data in Minipig Heart Failure Model and Evaluation of TNF-α mRNA Expression. Journal of Biotechnology, 153, 92-99.</mixed-citation></ref><ref id="scirp.79068-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Nygard, A.B., J&amp;#216;rgensen, C.B., Cirera, S., et al. (2007) Selection of Reference Genes for Gene Expression Studies in Pig Tissues using SYBR Green qPCR. BMC Molecular Biology, 8, 67. https://doi.org/10.1186/1471-2199-8-67</mixed-citation></ref><ref id="scirp.79068-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Time, E., Mario, V.P., Jo, V., et al. (2006) Development of a New Set of Reference Genes for Normalization of Real-Time RT-PCR Data of Porcine Backfat and Longissimus Dorsi Muscle, and Evaluation with PPARGC1A. BMC Biotechnolgy, 6, 41-48. https://doi.org/10.1186/1472-6750-6-41</mixed-citation></ref><ref id="scirp.79068-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Huggett, J., Dheda, K., Bustin, S., et al. (2005) Real-Time RT-PCR Normalisation: Strategies and Considerations. Genes and Immunity, 6, 279-284. https://doi.org/10.1038/sj.gene.6364190</mixed-citation></ref><ref id="scirp.79068-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Chapman, J.R. and Waldenstr&amp;#240;m, J. (2015) With Reference to Reference Genes: A Systematic Review of Endogenous Controls in Gene Expression Studies. PLoS ONE, 10, e0141853. https://doi.org/10.1371/journal.pone.0141853</mixed-citation></ref><ref id="scirp.79068-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Dundas, J. and Ling, M. (2012) Reference Genes for Measuring mRNA Expression. Theory in Biosciences, 131, 215-223. https://doi.org/10.1007/s12064-012-0152-5</mixed-citation></ref><ref id="scirp.79068-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Facci, M.R., Auray, G., Meurens, F., et al. (2011) Stability of Expression of Reference Genes in Porcine Peripheral Blood Mononuclear and Dendritic Cells. Veterinary Immunology and Immunopathology, 141, 11-15.</mixed-citation></ref><ref id="scirp.79068-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Chen, Q.M., Zeng, Y.Q., Wei, S.D., et al. (2010) Study on Flavor Precursors, Nutritional and Eating Quality of Meat for Different Pig Breeds. Journal of Agriculture &amp; Life Sciences, 36, 299-305.</mixed-citation></ref><ref id="scirp.79068-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Xu, S.J., Yu, D.B., Wang, F., et al. (2012) Analysis of Sequence Characters of ADSL Gene and Correlation between Gene Expression and IMP Content in Duck. Scientia Agricultura Sinica, 45, 774-785.</mixed-citation></ref><ref id="scirp.79068-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, S.J., Liu, L.Y., Yin, Z.J., et al. (2014) Comparison on IMP Content in Longissimus Dorsi Muscle in Pigs and Related Genes Expression. Food and Fermentation Industries, 40, 187-192.</mixed-citation></ref><ref id="scirp.79068-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Chen, J.L., Zhao, G.P., Zheng, M.Q., et al. (2008) Estimation of Genetic Parameters for Contents of Intramuscular Fat and Inosine-5’-Monophosphate and Carcass Traits in Chinese Beijing-You Chickens. Poultry Science, 87, 1098-1104.</mixed-citation></ref><ref id="scirp.79068-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Zheng, G.X.Y., Ravi, A., Calabrese, J.M., et al. (2011) A Latent Pro-Survival Function for the Mir-290-295 Cluster in Mouse Embryonic Stem Cells. PLOS Genetics, 7, e1002054. https://doi.org/10.1371/journal.pgen.1002054</mixed-citation></ref></ref-list></back></article>