miRNAs play an important regulatory role in variety of cellular functions and several diseases, including cancer. MicroRNA-21 (miR-21) is overexpressed in almost all types of human cancers. Studies revealed that the knockdown of miR-21 results in reduced tumor cell growth, cell cycle arrest and cell apoptosis. In this study, we evaluated the effect of doxorubicin on miR-21 expression in mcf-7 breast cancer cells. miRNA was extracted from mcf-7 cells treated with doxorubicin and untreated cells using miRNeasy Kit (Qiagen) according to the manufacturer’s instructions. cDNA synthesis was performed using miScript II RT Kit (Qiagen) and Real Time-PCR was performed using Real Q Plus 2x Master Mix Green-(Ampliqon, Denmark). The relative expression of miR-16 and miR-21 was calculated using comparative Ct method. All tests were run in triplicate to minimize the experimental errors. Samples with a Ct > 37 were excluded from the analysis. Statistically, a significant decrease in cell proliferation of mcf-7 cells was found in doxorubicin group compared with control groups 24 hours after transfection, dose dependently (p value< 0.001). After 24 hours, Doxorubicin (100 μm) significantly decreased miR-21 expression in mcf-7 cells (p = 0.0001). Also, the expression of caspase 9 significantly increased after Doxorubicin (100 μm) treatment (p = 0.0003). Together, these findings indicate that miR-21 plays a key role in regulating cell apoptosis in mcf-7 cells and may serve as a target for effective therapies.
Cancers are a group of disease with abnormal cell growth and potential to spread to different tissues of body [1] - [6] Despite much progress in the management of cancer, cancer is still a major public health problem and one of the deadliest diseases worldwide, with approximately 14 million new cases and 8.2 million death each year [7] [8] . Breast cancer is a very common malignant tumor among female patients and it is estimated that 1 in 10 women worldwide is affected by breast cancer during their lifetime [9] . Many studies were interested to identify specific molecules involved in breast cancer and understand their characteristics [10] . The rapidly increasing technology development leads to the identification of many biomarkers which are easily detectable, measurable, dependable, and inexpensive with a high sensitivity and specificity which play a critical role in breast cancer [11] [12] [13] . MicroRNAs (miRNAs) are a class of small, noncoding, single-stranded RNAs with a 19 - 25 nucleotide length which are found in both animals and plants [14] . MiRNAs are a novel group of gene regulators, binding to complementary sequences in the 3’ untranslated region (UTR) of their target mRNAs [15] . MiRNAs are negative regulators of gene expression which induce mRNA degradation or translational repression [16] . Over the past years, it was shown that many miRNAs are influential in the development of many human cancers [17] . miRNA dysregulation is shown to contribute to cancer development through a range of mechanisms [18] . Identified in many types of tumors, miRNAs can act as oncogenic or tumor suppressors [19] Dysregulation of miRNA expression has been implicated in estrogen-related diseases including breast cancer and endometrial cancer [20] . MiR-21 is one of the most extensively investigated miRNAs which is tightly regulated by a variety of extracellular and intracellular signaling molecules. The important target genes of miR-21 are involved in cell proliferation, activation, and apoptosis [21] . MicroRNA-21 (miR-21) is overexpressed in almost all types of human cancers [22] [23] . Several studies using cell lines revealed that miR-21 knockdown results in reduced tumor cell growth, cell cycle arrest and cell apoptosis [24] [25] . In this study, we evaluated the effect of doxorubicin on miR-21expression in mcf-7 breast cancer cells.
2. Methods & Materials
Doxorubicin was purchased from Sigma. All primers were produced by Pishgam company (Iran). The media, FBS, trypsin and antibiotics were purchased from Gibco.
2.1. Cell Culture
Mcf-7 cells were purchased from the Pasteur institute of Iran and were cultured in Dulbecco’s modified Eagle’s medium containing 10% fetal bovine serum (FBS), penicillin (100 units/ml), and streptomycin (100 μg/ml), incubated at 37˚C in a humidified atmosphere of 5% CO2 95% air. All experiments were performed in a similar medium contain.
2.2. MTT Assay
Cell survival was assessed using the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl- tetrazolium bromide (MTT) assay, as previously described [20] . Cells were cultivated at sub confluence before being washed twice with phosphate-buffered saline (PBS). Cells were then resuspended in culture medium with FBS, counted, and plated in 100 μL media at 15 × 103 cells/well in 96-well microliter plates. After 24 hours, the cells were washed and treated with doxorubicin. The best concentrations of doxorubicin were calculated. MTT absorbance was measured at 492 nm.
2.3. miRNA and Total RNA Extraction and First Strand cDNA Synthesis
miRNA was extracted from treated and control cells using the miRNeasy Kit (Qiagen) according to the manufacturer’s instructions. First strand cDNA was synthesized from miRNA using high Specificity miRNA 1st-Strand cDNA Synthesis Kit (Agilent Technologies, USA). cDNA synthesis was performed in 2 steps. First, a polyadenylation reaction was performed at 37˚C for 30 minutes and then the reverse transcription step was conducted.
2.4. Quantitative RT-PCR for miRNA Expression
Quantitative Real-Time PCR reactions were performed in Rotogene Q (Qiagen, Hilden, Germany) in 20 μl of PCR master mix containing 10 μl of SYBR-Green QPCR Master Mix, 1 μl of primer of miR-21, 1 μl universal primer, 1 μl cDNA products and 8 μl of RNase free water. Quantitative Real Time-PCR was performed using SYBR® Premix EX Taq II (Takara, biotechnology, LTD, Dalian, Japan). miR-16 and miR-21 forward primers were CTCGCTTCGGCAGCACA and TAGCTTATCAGACTGATGTTGA, respectively. Forward and reverse primers of caspase-9 were CTCAGACCAGAGATTCGCAAAC and GCATTTCC- CCTCAAACTCTCAA respectively and forward and reverse primers of b-actin were CATGTACGTTGCTATCCAGGC and CTCCTTAATGTCACGCACGAT respectively. The relative expression of caspase-9, miR-16 and miR-21 was calculated using comparative Ct method. All tests were run in triplicate to minimize the experimental error. All assays were inspected for distinct melting curves and the Tm was checked to be within known specifications for each particular assay. Furthermore, the samples must be detected with a Ct < 37 to be included in the analysis.
3. Statistical Analyses
All statistical analyses were carried out using the statistical program SPSS (version 22, SPSS, Chicago, IL, USA); p-values are two-sided throughout, and p < 0.05 was considered significant. Baseline quantitative results are expressed as mean ± SD; Comparison between groups was performed using unpaired student’s t test.
4. Discussion and Conclusions
Doxorubicin induced cell proliferation in mcf-7 cells. After 24 h of incubation with different doxorubicin concentrations (50 nm to 500 µM), a decline of about 30% in cell numbers was observed (Figure 1). Among different concentrations, 100 µM concentration was chosen for next experiments. A significant decline was observed in miRNA-21 expression in MCF cells which were treated with 100 µM doxorubicin (Figure 2). Considering the role of mir-21 in breast cancer, the results show that doxorubicin can be effective in breast cancer. Next, we investigated the effect of doxorubicin in caspase-9 expression, because caspase-9 is an important upstream factor leading to apoptosis. Consistent with the result, we found that 100 µM doxorubicin caused a significant increase in caspase-9 expression in mcf-7 cells (Figure 3).
In this study, we demonstrate that doxorubicin decreases mir-21 expression and increases caspase-9 expression in mcf-7 cells. Breast cancer is one of the most commonly diagnosed types of cancer among women [26] [27] [28] . Chemotherapy is an important component in the treatment of breast cancers [29] [30] . Recent studies have focused on new approaches to treat breast cancer [31] . Thus, understanding the molecular mechanisms involved in the progression of
MTT assay for mcf-7 cells treated with different concentration of doxorubicin
The expression of miR-21 in mcf-7 cells treated with doxorubicin 100 µm and control cells. miR-21 expression was significantly reduced in mcf-7 cells treated with doxorubicin 100 µm. *** p value < 0.001
The expression of caspase9 in mcf-7 cells treated with doxorubicin 100 µm and control cells. Caspase 9 expression was significantly increased in mcf-7 cells treated with doxorubicin 100 µm. **** p value < 0.001
breast cancer is crucial. In the recent years, micro-RNAs have attracted the attention of many researchers [32] . As a result, it has become clear that the dysregulation in the expression of microRNA (miRNA) genes contributes to the pathogenesis of most human cancers and these dysregulations can be caused by different mechanisms [33] . According to the relationship between dysregulated expression of miRNA genes and the development of cancers, these miRNAs provide important opportunities for the development of future miRNA-based therapies [34] [35] . miR-21 has been found to be overexpressed in many cancers, including breast cancer [36] [37] [38] . In a study conducted by Yan L. X et al. in 2008, it was shown that miR-21 is highly up-regulated in breast cancer cell lines, which suggests that miR-21 overexpression is correlated with specific breast cancer bio pathologic features, such as advanced tumor stage, lymph node metastasis, and poor survival of the patients, indicating that miR-21 may serve as an oncogene [39] . Another study also confirmed that the down-regulation of miR- 21 can lead to apoptosis caused by increased amounts of caspases-9 [40] . To our knowledge, this is the first report that doxorubicin down-regulates miR-21 and thus, it upregulates the protein expression of miR-21 target gene caspase-9 in MCF-7 human breast cancer cells. The results of our study demonstrated that suppressing miR-21 by doxorubicin increases caspas-9 expression and increases apoptosis. Li Xu Yan et al. showed that the knockdown of miR-21 in MCF-7 cells inhibits in vitro and in vivo growth as well as in vitro migration. Also, they suggest that inhibitory strategies against miR-21 using antimiR-21 may provide potential therapeutic applications in breast cancer treatment [40] . Taken together, miR-21 is shown to affect several targets which are very effective in apoptosis process including caspase-9. The results of this study suggest that miR-21 is an oncogenic miRNA and plays a role in apoptotic pathways.
Cite this paper
Tofigh, R., Akhavan, S., Tarban, N., Sadrabadi, A.E., Jalili, A., Moridi, K. and Tutunchi, S. (2017) Doxorubicin Induces Apoptosis through down Regulation of miR-21 Expression and Increases miR-21 Target Gene Expression in MCF-7 Breast Cancer Cells. International Journal of Clinical Medicine, 8, 386-394. https://doi.org/10.4236/ijcm.2017.86036
ReferencesSara, T., Mojtaba, S., Mahta, M., Parisa, N., Bahareh, N., Reza, S. and Nasrin, G. (2016) How Does the Cortactin Gene Expression Affect Breast Cancer among Iranian Females? Advances in Breast Cancer Research, 5, 142-149.https://doi.org/10.4236/abcr.2016.54017Jalili, A., Roshandel, E., Shenasifam, S.H.F.N., Ebrahimi, A. and Sadrabadi, M.A.R.P. (2016) Appraising the Increased Expression of p21and p53 Genes in Paraffin-Embedded Biopsy Tissues of Patients with Bladder Cancer Exposed to Mitomycin C. Advances in Bioresearch, 7, 74-79.Jalili, A., Sadrabadi, A.E. and Yekta, S.S. (2015) Assessing the Expression of BRAF Gene in Paraffin-Embedded Blocks of Patients with Colorectal Cancer. International Journal of Biology, Pharmacy and Allied Sciences, 4, 5653-5662.Mohammadi, S., Mahboubi, A., Mohammadi, M., Hedayati, M. and Jalili, A. (2017) Assessing the Anticancer Effect of the Euphorbia Condylocarpa Plant on AGS Gastric Cancer Cell Line. Gene, Cell and Tissue, 4, e41223.https://doi.org/10.17795/gct-41223Sadrabadi, A.E., Yekta, S.S., Fattahi, S.H., Molaei, S., Gavgani, S.P., Roshandel, E. and Jalili, A. (2015) Assessing the Decreased Expression of TP53 and P21 in Colorectal Cancer. Indian Journal of Fundamental and Applied Life Sciences, 5, 107-112.Ferreira, C.A., Fuscaldi, L.L., Townsend, D.M., Rubello, D., Barros, A.L. (2017) Radiolabeled Bombesin Derivatives for Preclinical Oncological Imaging. Biomedicine & Pharmacotherapy, 87, 58-72. https://doi.org/10.1016/j.biopha.2016.12.083Huang, X., Xiao, R., Pan, S., Yang, X., Yuan, W., Tu, Z., et al. (2017) Uncovering the Roles of Long Non-Coding RNAs in Cancer Stem Cells. Journal of hematology & oncology, 10, 62. https://doi.org/10.1186/s13045-017-0428-9Elfandi, L., Said, G., Saleh, S.S., Marwan, M. and Enattah, N. (2016) Analysis of 6174delT Mutation in BRCA2 Gene by Mutagenically Separated PCR among Libyan Patients with Breast Cancer. Archives of Breast Cancer, 3, 8-13.Lee, E. and Moon, A. (2016) Identification of Biomarkers for Breast Cancer Using Databases. Journal of Cancer Prevention, 21, 235-242. https://doi.org/10.15430/JCP.2016.21.4.235Chatterjee, S.K. and Zetter, B.R. (2005) Cancer Biomarkers: Knowing the Present and Predicting the Future. Future Oncology, 1, 37-50.https://doi.org/10.1517/14796694.1.1.37Tanic, M. and Beck, S. (2017) Epigenome-Wide Association Studies for Cancer Biomarker Discovery in Circulating Cell-Free DNA: Technical Advances and Challenges. Current Opinion in Genetics & Development, 42, 48-55.https://doi.org/10.1016/j.gde.2017.01.017Wang, H., Shi, T., Qian, W.-J., Liu, T., Kagan, J., Srivastava, S., et al. (2016) The Clinical Impact of Recent Advances in LC-MS for Cancer Biomarker Discovery and Verification. Expert Review of Proteomics, 13, 99-114.https://doi.org/10.1586/14789450.2016.1122529Li, Y., Deng, X., Zeng, X. and Peng, X. (2016) The Role of Mir-148a in Cancer. Journal of Cancer, 7, 1233-1241. https://doi.org/10.7150/jca.14616Denzler, R., McGeary, S.E., Title, A.C., Agarwal, V., Bartel, D.P. and Stoffel, M. (2016) Impact of MicroRNA Levels, Target-Site Complementarity, and Cooperativity on Competing Endogenous RNA-Regulated Gene Expression. Molecular Cell, 64, 565-579. https://doi.org/10.1016/j.molcel.2016.09.027Dykxhoorn, D.M. (2010) MicroRNAs and Metastasis: Little RNAs Go a Long Way. Cancer Research, 70, 6401-6406. https://doi.org/10.1158/0008-5472.CAN-10-1346Jafri, M.A., Al-Qahtani, M.H. and Shay, J.W., Eds. (2017) Role of miRNAs in Human Cancer Metastasis: Implications for Therapeutic Intervention. Seminars in Cancer Biology, in press.Livingstone, M.C., Johnson, N.M., Roebuck, B.D., Kensler, T.W. and Groopman, J.D. (2017) Profound Changes in miRNA Expression during Cancer Initiation by Aflatoxin B1 and Their Abrogation by the Chemopreventive Triterpenoid CDDO-Im. Molecular Carcinogenesis, in press. https://doi.org/10.1002/mc.22635Singh, S., Sharma, P.K., Kumar, N. and Dudhe, R. (2011) A Review on a Versatile Molecule: Chalcone. Asian J Pharm Biol Res, 412-418.Klinge, C.M. (2015) miRNAs Regulated by Estrogens, Tamoxifen, and Endocrine Disruptors and Their Downstream Gene Targets. Molecular and Cellular Endocrinology, 418, 273-297. https://doi.org/10.1016/j.mce.2015.01.035Wang, S., Wan, X. and Ruan, Q. (2016) The MicroRNA-21 in Autoimmune Diseases. International Journal of Molecular Sciences, 17, 864. https://doi.org/10.3390/ijms17060864Volinia, S., Galasso, M., Costinean, S., Tagliavini, L., Gamberoni, G., Drusco, A., et al. (2010) Reprogramming of miRNA Networks in Cancer and Leukemia. Genome Research, 20, 589-599. https://doi.org/10.1101/gr.098046.109Croce, C.M. (2011) miRNAs in the Spotlight: Understanding Cancer Gene Dependency. Nature Medicine, 17, 935-936. https://doi.org/10.1038/nm0811-935Papagiannakopoulos, T., Shapiro, A. and Kosik, K.S. (2008) MicroRNA-21 Targets a Network of Key Tumor-Suppressive Pathways in Glioblastoma Cells. Cancer Research, 68, 8164-8172. https://doi.org/10.1158/0008-5472.CAN-08-1305Park, J.-K., Lee, E.J., Esau, C. and Schmittgen, T.D. (2009) Antisense Inhibition of microRNA-21 or-221 Arrests Cell Cycle, Induces Apoptosis, and Sensitizes the Effects of Gemcitabine in Pancreatic Adenocarcinoma. Pancreas, 38, e190-e199.https://doi.org/10.1097/MPA.0b013e3181ba82e1Tomuleasa, C.I., Foris, V., Soritau, O., Pall, E., Fischer-Fodor, E., Lung-Illes, V., et al. (2009) Effects of 60Co Gamma-Rays on Human Osteoprogenitor Cells. Romanian Journal of Morphology and Embryology, 50, 349-355.Cramer, H., Lauche, R., Klose, P., Lange, S., Langhorst, J. and Dobos, G.J. (2017) Yoga for Improving Health-Related Quality of Life, Mental Health and Cancer-Related Symptoms in Women Diagnosed with Breast Cancer. The Cochrane Database of Systematic Reviews, No. 1, CD010802. https://doi.org/10.1002/14651858.cd010802.pub2Lobo, M.D., Moreno, F.B., Souza, G.H., Verde, S.M., Moreira, R.A. and Monteiro-Moreira, A.C. (2017) Label-Free Proteome Analysis of Plasma from Patients with Breast Cancer: Stage-Specific Protein Expression. Frontiers in Oncology, 7, 14.https://doi.org/10.3389/fonc.2017.00014Owen L.N. ,et al. (1979)A Comparative Study of Canine and Human Breast Cancer Investigative & Cell Pathology 2, 257-275.Arslan, C., Dizdar, O. and Altundag, K. (2014) Chemotherapy and Biological Treatment Options in Breast Cancer Patients with Brain Metastasis: An Update. Expert Opinion on Pharmacotherapy, 15, 1643-1658.https://doi.org/10.1517/14656566.2014.929664Jolly, T.A., Williams, G.R., Bushan, S., Pergolotti, M., Nyrop, K.A., Jones, E.L., et al. (2016) Adjuvant Treatment for Older Women with Invasive Breast Cancer. Women’s Health (London, England), 12, 129-145; quiz 45-46.Pal, A. and Donato, N.J. (2014) Ubiquitin-Specific Proteases as Therapeutic Targets for the Treatment of Breast Cancer. Breast Cancer Research, 16, 461.https://doi.org/10.1186/s13058-014-0461-3Casalini, P. and Iorio, M.V. (2009) MicroRNAs and Future Therapeutic Applications in Cancer. Journal of BUON, 14, S17-S22.Johnson, S.M., Grosshans, H., Shingara, J., Byrom, M., Jarvis, R., Cheng, A., et al. (2005) RAS Is Regulated by the let-7 microRNA Family. Cell, 120, 635-647.https://doi.org/10.1016/j.cell.2005.01.014Croce, C.M. (2009) Causes and Consequences of microRNA Dysregulation in Cancer. Nature Reviews Genetics, 10, 704-714. https://doi.org/10.1038/nrg2634Volinia, S., Calin, G.A., Liu, C.G., Ambs, S., Cimmino, A., Petrocca, F., et al. (2006) A microRNA Expression Signature of Human Solid Tumors Defines Cancer Gene Targets. Proceedings of the National Academy of Sciences of the United States of America, 103, 2257-2261. https://doi.org/10.1073/pnas.0510565103Si, M.L., Zhu, S., Wu, H., Lu, Z., Wu, F. and Mo, Y.Y. (2007) miR-21-Mediated Tumor Growth. Oncogene, 26, 2799-2803. https://doi.org/10.1038/sj.onc.1210083Hwang, J.H., Voortman, J., Giovannetti, E., Steinberg, S.M., Leon, L.G., Kim, Y.T., et al. (2010) Identification of microRNA-21 as a Biomarker for Chemoresistance and Clinical Outcome Following Adjuvant Therapy in Resectable Pancreatic Cancer. PLoS ONE, 5, e10630. https://doi.org/10.1371/journal.pone.0010630Yan, L.-X., Huang, X.-F., Shao, Q., Huang, M.A.Y., Deng, L., Wu, Q.-L., et al. (2008) MicroRNA miR-21 Overex-pression in Human Breast Cancer Is Associated with Advanced Clinical Stage, Lymph Node Metastasis and Patient Poor Prognosis. RNA, 14, 2348-2360. https://doi.org/10.1261/rna.1034808Buscaglia, L.E.B. and Li, Y. (2011) Apoptosis and the Target Genes of microRNA-21. Chinese Journal of Cancer, 30, 371-380. https://doi.org/10.5732/cjc.30.0371Yan, L.X., Wu, Q.N., Zhang, Y., Li, Y.Y., Liao, D.Z., Hou, J.H., et al. (2011) Knockdown of miR-21 in Human Breast Cancer Cell Lines Inhibits Proliferation, in Vitro Migration and in Vivo Tumor Growth. Breast Cancer Research, 13, R2.