<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2017.74026</article-id><article-id pub-id-type="publisher-id">AiM-75962</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Activation without Proteolysis of Anti-&lt;i&gt;σ&lt;/i&gt; Factor RsiV of the Extracytoplasmic Function &lt;i&gt;σ&lt;/i&gt; Factor &lt;i&gt;σ&lt;/i&gt;&lt;sup&gt;V&lt;/sup&gt; in a Glucolipid-Deficient Mutant of &lt;i&gt;Bacillus subtilis&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Takahiro</surname><given-names>Seki</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Kouji</surname><given-names>Matsumoto</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Satoshi</surname><given-names>Matsuoka</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hiroshi</surname><given-names>Hara</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Biochemistry and Molecular Biology, Graduate School of Science and Engineering, Saitama University, Saitama, Japan</addr-line></aff><pub-date pub-type="epub"><day>14</day><month>04</month><year>2017</year></pub-date><volume>07</volume><issue>04</issue><fpage>315</fpage><lpage>327</lpage><history><date date-type="received"><day>March</day>	<month>22,</month>	<year>2017</year></date><date date-type="rev-recd"><day>Accepted:</day>	<month>April</month>	<year>25,</year>	</date><date date-type="accepted"><day>April</day>	<month>30,</month>	<year>2017</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Extracytoplasmic function (ECF) 
  
  σ factors are a crucial link in the process of bacterial response to environmental stresses, in which bacteria transmit information across the cytoplasmic membrane. Among the seven ECF 
  
  σ factors of 
  
  Bacillus subtilis σ<sup></sup>
  <sup>V</sup>
  <sup></sup>, which is sequestered by transmembrane anti-
  
  σ factor RsiV under normal growth conditions, responds to lysozyme. When 
  
  B. subtilis cells are challenged by lysozyme, the lysozyme-bound RsiV undergoes two successive proteolysis steps, by a signal peptidase and RasP protease, and releases 
  
  σ<sup></sup>
  <sup>V</sup>
  <sup></sup>. An unchallenged 
  
  B. subtilis ugtP mutant lacking glucolipids exhibited higher 
  
  σ<sup></sup>
  <sup>V</sup>
  <sup></sup> activity than wild type. However, the activation occurred in the absence of RasP, and no proteolysis of RsiV was observed. It is likely that a conformational change, not proteolysis, of RsiV leads to this activation of 
  
  σ<sup></sup>
  <sup>V</sup>
  <sup></sup> in the absence of glucolipids. Replacement of the C-terminal region of RsiV with that of RsiW, the cognate 
  
  σ factor of which, 
  
  σ<sup></sup>
  <sup>W</sup>
  <sup></sup>, is not activated in the 
  
  ugtP mutant, indicated that the C-terminal extracytoplasmic region of RsiV was necessary for the response to glucolipid deficiency.
 
</p></abstract><kwd-group><kwd>Anti-&lt;i&gt;σ&lt;/i&gt; Factor</kwd><kwd> &lt;i&gt;Bacillus subtilis&lt;/i&gt;</kwd><kwd> ECF &lt;i&gt;σ&lt;/i&gt; Factor</kwd><kwd> Glucolipid</kwd><kwd> RsiV</kwd><kwd> &lt;i&gt;σ&lt;/i&gt;&lt;sup&gt;V&lt;/sup&gt;</kwd><kwd> UgtP</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Extracytoplasmic function (ECF) σ factors are a group of bacterial σ factors that direct transcription of genes involved in tasks such as maintenance of cell surface integrity in response to environmental stresses. Bacillus subtilis has seven ECF σ factors: σ<sup>M</sup>, σ<sup>V</sup>, σ<sup>W</sup>, σ<sup>X</sup>, σ<sup>Y</sup>, σ<sup>Z</sup> and σ<sup>YlaC</sup>. Except for σ<sup>Z</sup>, these are regulated directly by their respective cognate transmembrane anti-σ factors, which sequester the σ factors and keep them inactive. Under stress conditions, the σ factors are released from the anti-σ factors and bind RNA polymerase core enzyme to form holoenzymes, which transcribe the respective regulon genes. The genes for the σ factors and the anti-σ factors form operons whose transcription is directed by the cognate σ factors; the activities of the promoters for ECF σ factor genes are thus indicative of the activities of the respective ECF σ factors [<xref ref-type="bibr" rid="scirp.75962-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref3">3</xref>] .</p><p>Among these ECF σ factors, σ<sup>V</sup> primarily responds to lysozyme [<xref ref-type="bibr" rid="scirp.75962-ref4">4</xref>] . It is activated by stepwise proteolytic destruction of the anti-σ factor RsiV via regulated intramembrane proteolysis (RIP) [<xref ref-type="bibr" rid="scirp.75962-ref5">5</xref>] . Lysozyme directly binds to RsiV and induces the cleavage of its C-terminal extracytoplasmic portion by signal peptidase (site-1 cleavage). Subsequently the N-terminal portion is processed by the intramembrane protease RasP (site-2 cleavage), and σ<sup>V</sup> is released [<xref ref-type="bibr" rid="scirp.75962-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref7">7</xref>] .</p><p>The B. subtilis membrane contains the glucolipids (monoglucosyldiacylglycerol, diglucosyldiacylglycerol and triglucosyldiacylglycerol) in addition to phospholi- pids (phosphatidylethanolamine, phosphatidylglycerol, cardiolipin and lysylphosphatidylglycerol) [<xref ref-type="bibr" rid="scirp.75962-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref9">9</xref>] . Glucolipids are synthesized by the gene product of ugtP, which processively transfers glucose from UDP-glucose to diacylglycerol [<xref ref-type="bibr" rid="scirp.75962-ref10">10</xref>] . UgtP protein is implicated in nutrient-dependent cell size control [<xref ref-type="bibr" rid="scirp.75962-ref11">11</xref>] . ugtP null mutants which completely lack glucolipids have been found to show abnormal cell morphology [<xref ref-type="bibr" rid="scirp.75962-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref13">13</xref>] and constitutive activation of three ECF σ factors σ<sup>M</sup>, σ<sup>V</sup> and σ<sup>X</sup> [<xref ref-type="bibr" rid="scirp.75962-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref14">14</xref>] .</p><p>When the ugtP gene with a hexahistidine tag-coding sequence was placed under the control of the isopropyl-β-d-thiogalactoside (IPTG)-inducible P<sub>spac</sub> pro- moter and integrated into the chromosomal aprE locus in the ∆ugtP mutant, the activities of σ<sup>M</sup>, σ<sup>V</sup> and σ<sup>X</sup> monitored by the expression of lacZ placed under the control of the respective σ factor gene promoter and integrated into the chromosomal amyE locus decreased with increasing IPTG concentration [<xref ref-type="bibr" rid="scirp.75962-ref15">15</xref>] . A ugtP mutant gene whose 18th codon was changed from His to Ala produced a normal level of the protein but showed no glucolipid synthetic activity. When P<sub>spac</sub>-ugtP<sub>H18A</sub>-His<sub>6</sub> was integrated into the aprE locus instead of P<sub>spac</sub>-ugtP-His<sub>6</sub>, the activities of σ<sup>M</sup>, σ<sup>V</sup> and σ<sup>X</sup> did not change with increasing IPTG concentration. Thus, the lack of glucolipids, not the absence of UgtP protein, activates these ECF σ factors [<xref ref-type="bibr" rid="scirp.75962-ref16">16</xref>] .</p><p>Escherichia coli has a much simpler membrane lipid composition than B. subtilis. The membrane contains three kinds of phospholipids (phosphatidylethanolamine, phosphatidylglycerol and cardiolipin), except for the outer leaflet of the outer membrane, which is composed of lipopolysaccharide [<xref ref-type="bibr" rid="scirp.75962-ref17">17</xref>] . It does not contain glucolipid. When the genes for B. subtilis σ<sup>M</sup>, σ<sup>V</sup> and σ<sup>X</sup> and their anti-σ factors were introduced into E. coli cells, lacZ fused to the ECF σ factor-regulated promoters was expressed. Additional introduction and expression of B. subtilis ugtP gene in the E. coli cells led to the synthesis of small amounts of glucolipids, and the activities of B. subtilis σ<sup>M</sup> and σ<sup>V</sup> were partially repressed, but the activity of σ<sup>X</sup> was unaffected [<xref ref-type="bibr" rid="scirp.75962-ref15">15</xref>] . This result indicates that in heterologous E. coli cells the lack of glucolipids activates B. subtilis σ<sup>M</sup> and σ<sup>V</sup>.</p><p>We wondered if B. subtilis σ<sup>V</sup> is activated by an RIP mechanism in E. coli cells. Although E. coli has a signal peptidase and a site-2 protease RseP, which functions in RIP of the anti-σ factor to ECF σ factor σ<sup>E</sup> [<xref ref-type="bibr" rid="scirp.75962-ref18">18</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref20">20</xref>] , we thought it possible that the activation of σ<sup>V</sup> might not involve RIP. In the same vein, we suspected that the activation of σ<sup>V</sup> in a B. subtilis ∆ugtP mutant lacking glucolipid [<xref ref-type="bibr" rid="scirp.75962-ref15">15</xref>] might not involve RIP either. It seemed possible that a conformational change of anti-σ<sup>V</sup> activates σ<sup>V</sup> weakly; σ<sup>V</sup> activation by the lack of glucolipids is only two- to three-fold, whereas treatment with a high concentration (100 &#181;g/ mL) of lysozyme causes ~65-fold activation [<xref ref-type="bibr" rid="scirp.75962-ref5">5</xref>] . In this study we explored the question of how σ<sup>V</sup> is activated in the B. subtilis ∆ugtP mutant.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Bacterial Strains, Plasmids and Culture Media</title><p>The strains and the plasmids used for this study and DNA primers used for strain construction are listed in Tables 1-3, respectively. The marker-free deletion of rsiV (SBS352) was obtained as previously described [<xref ref-type="bibr" rid="scirp.75962-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref21">21</xref>] and confirmed by polymerase chain reaction (PCR). Luria-Bertani (LB) medium was used. For plates, media were solidified with 1.5% agar. Tryptose blood agar (Difco) was used for preparation of B. subtilis strains for transformation. Synthetic media CI and CII were used for competence development for transformation [<xref ref-type="bibr" rid="scirp.75962-ref22">22</xref>] . When appropriate, antibiotics were included at the following concentrations (in &#181;g/mL): ampicillin (100), chloramphenicol (5), erythromycin (0.5), neomycin (10), spectinomycin (100) and tetracycline (10). Lysozyme used was Wako Pure Chemical’s lysozyme hydrochloride from egg white. Cell growth was monitored with a mini photo 518R photometer (TAITEC) equipped with a 530- nm interference filter.</p></sec><sec id="s2_2"><title>2.2. Construction of Chimeric Anti-σ Factors</title><p>RsiV and RsiW were divided into N-terminal regions (RsiV<sub>1-36</sub> and RsiW<sub>1-82</sub>), transmembrane regions (RsiV<sub>37-59</sub> and RsiW<sub>83-105</sub>) and C-terminal regions (RsiV<sub>60-285</sub> and RsiW<sub>106-208</sub>), respectively, based on the prediction of the transmembrane regions by TMHMM (URL:</p><p>http://www.cbs.dtu.dk/services/TMHMM/). Chimeric anti-σ factors, a chimera of the N-terminal region of RsiV and the transmembrane and C-terminal regions of RsiW (RsiV<sub>N</sub>-RsiW<sub>TMC</sub>) and a chimera of the N-terminal and transmembrane regions of RsiV and the C-terminal region of RsiW (RsiV<sub>NTM</sub>-RsiW<sub>C</sub>), were designed. These chimeras were constructed by PCR and Gibson Assembly Cloning Kit (New England Biolabs) on a vector pSG1729 [<xref ref-type="bibr" rid="scirp.75962-ref23">23</xref>] digested with KpnI and BamHI. The chimeric genes were transferred together with ribosome-binding site (RBS) on the vector pSG1729 by PCR and Gibson Assembly Cloning Kit to a vector pAPNC213 [<xref ref-type="bibr" rid="scirp.75962-ref24">24</xref>] digested with SalI. The resultant chimeric genes under</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Bacterial strains used for this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Strain</th><th align="center" valign="middle" >Relevant genotype</th><th align="center" valign="middle" >Construction, source or reference</th></tr></thead><tr><td align="center" valign="middle" >E. coli</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >DH5</td><td align="center" valign="middle" >recA1 endA1 hsdR17</td><td align="center" valign="middle" >Laboratory collection</td></tr><tr><td align="center" valign="middle" >B. subtilis</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >168</td><td align="center" valign="middle" >trpC2</td><td align="center" valign="middle" >Laboratory collection</td></tr><tr><td align="center" valign="middle" >YTB019</td><td align="center" valign="middle" >168 ∆ugtP::kan</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.75962-ref34">34</xref>]</td></tr><tr><td align="center" valign="middle" >YTB040</td><td align="center" valign="middle" >YTB019 amyE::(P<sub>sigV</sub>-lacZ cat)</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.75962-ref14">14</xref>]</td></tr><tr><td align="center" valign="middle" >YTB041</td><td align="center" valign="middle" >168 amyE::(P<sub>sigV</sub>-lacZ cat)</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.75962-ref14">14</xref>]</td></tr><tr><td align="center" valign="middle" >1012 rasP</td><td align="center" valign="middle" >leuA8 metB5 trpC2 hsrM1 rasP::tet</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.75962-ref30">30</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref35">35</xref>]</td></tr><tr><td align="center" valign="middle" >SBS100</td><td align="center" valign="middle" >168 rasP::tet</td><td align="center" valign="middle" >1012 rasP &#174;<sup>a</sup> 168</td></tr><tr><td align="center" valign="middle" >SBS101</td><td align="center" valign="middle" >YTB041 rasP::tet</td><td align="center" valign="middle" >SBS100 &#174; YTB041</td></tr><tr><td align="center" valign="middle" >SBS102</td><td align="center" valign="middle" >YTB040 rasP::tet</td><td align="center" valign="middle" >SBS100 &#174; YTB040</td></tr><tr><td align="center" valign="middle" >SBS200</td><td align="center" valign="middle" >168 rsiV::(pMUTIN-P<sub>spac</sub>-flag-rsiV erm)</td><td align="center" valign="middle" >K. Asai</td></tr><tr><td align="center" valign="middle" >SBS201</td><td align="center" valign="middle" >SBS200 ∆ugtP::kan</td><td align="center" valign="middle" >YTB019 &#174; SBS200</td></tr><tr><td align="center" valign="middle" >SBS204</td><td align="center" valign="middle" >SBS200 amyE::(P<sub>sigV</sub>-lacZ cat)</td><td align="center" valign="middle" >YTB041 &#174; SBS200</td></tr><tr><td align="center" valign="middle" >SBS205</td><td align="center" valign="middle" >SBS204 ∆ugtP::kan</td><td align="center" valign="middle" >YTB019 &#174; SBS204</td></tr><tr><td align="center" valign="middle" >TMO310</td><td align="center" valign="middle" >168 aprE::(lacI P<sub>spac</sub>-mazF spc)</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.75962-ref21">21</xref>]</td></tr><tr><td align="center" valign="middle" >SBS303</td><td align="center" valign="middle" >168 sigV::(lacI P<sub>spac</sub>-mazF spc)</td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >SBS304</td><td align="center" valign="middle" >168 ∆sigV</td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >SBS313</td><td align="center" valign="middle" >SBS304 amyE::(P<sub>sigV</sub>-lacZ cat)</td><td align="center" valign="middle" >YTB041 &#174; SBS304</td></tr><tr><td align="center" valign="middle" >SBS314</td><td align="center" valign="middle" >SBS313 ∆ugtP::kan</td><td align="center" valign="middle" >YTB019 &#174; SBS313</td></tr><tr><td align="center" valign="middle" >SBS351</td><td align="center" valign="middle" >168 rsiV::(lacI P<sub>spac</sub>-mazF spc)</td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >SBS352</td><td align="center" valign="middle" >168 ∆rsiV</td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >SBS361</td><td align="center" valign="middle" >SBS352 amyE::(P<sub>sigV</sub>-lacZ cat)</td><td align="center" valign="middle" >YTB041 &#174; SBS352</td></tr><tr><td align="center" valign="middle" >SBS362</td><td align="center" valign="middle" >SBS361 ∆ugtP::kan</td><td align="center" valign="middle" >YTB019 &#174; SBS361</td></tr><tr><td align="center" valign="middle" >SBS500</td><td align="center" valign="middle" >SBS361 aprE::(lacI P<sub>spac</sub>-RBS-rsiV<sub>N</sub>-rsiW<sub>TMC</sub> spc)</td><td align="center" valign="middle" >pAP-RsiV<sub>N</sub>-RsiW<sub>TMC</sub> &#174; SBS361</td></tr><tr><td align="center" valign="middle" >SBS501</td><td align="center" valign="middle" >SBS500 ∆ugtP::kan</td><td align="center" valign="middle" >YTB019 &#174; SBS500</td></tr><tr><td align="center" valign="middle" >SBS502</td><td align="center" valign="middle" >SBS361 aprE::(lacI P<sub>spac</sub>-RBS-rsiV<sub>NTM</sub>-rsiW<sub>C</sub> spc)</td><td align="center" valign="middle" >pAP-RsiV<sub>NTM</sub>-RsiW<sub>C</sub> &#174; SBS361</td></tr><tr><td align="center" valign="middle" >SBS503</td><td align="center" valign="middle" >SBS502 ∆ugtP::kan</td><td align="center" valign="middle" >YTB019 &#174; SBS502</td></tr></tbody></table></table-wrap><p>a &#174;, transformation with chromosomal or plasmid DNA.</p><p>P<sub>spac</sub> and RBS were integrated into the chromosomal aprE locus. Constructs were verified by sequencing.</p></sec><sec id="s2_3"><title>2.3. Genetic and Recombinant DNA Procedures</title><p>These were based on standard methods [<xref ref-type="bibr" rid="scirp.75962-ref25">25</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref26">26</xref>] . The cycle number and the annealing temperatures for PCR were 40 cycles and 40˚C - 65˚C according to the T<sub>m</sub> values of primers, respectively.</p></sec><sec id="s2_4"><title>2.4. Biochemical Procedures</title><p>The β-galactosidase assay method using o-nitrophenyl-β-d-galactoside as sub-</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Plasmids used for this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >plasmid</th><th align="center" valign="middle" >Description</th><th align="center" valign="middle" >Construction or reference</th></tr></thead><tr><td align="center" valign="middle" >pSG1729</td><td align="center" valign="middle" >amyE' spc P<sub>xyl</sub> gfpmut1 'amyE bla</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.75962-ref23">23</xref>]</td></tr><tr><td align="center" valign="middle" >pAPNC213</td><td align="center" valign="middle" >aprE' spc lacI P<sub>spac</sub> 'aprE bla</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.75962-ref24">24</xref>]</td></tr><tr><td align="center" valign="middle" >pSG-RsiV<sub>N</sub>-RsiW<sub>TMC</sub></td><td align="center" valign="middle" >pSG1729 P<sub>xyl</sub>-rsiV<sub>N</sub>-rsiW<sub>TMC</sub></td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >pSG-RsiV<sub>NTM</sub>-RsiW<sub>C</sub></td><td align="center" valign="middle" >pSG1729 P<sub>xyl</sub>-rsiV<sub>NTM</sub>-rsiW<sub>C</sub></td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >pAP-RsiV<sub>N</sub>-RsiW<sub>TMC</sub></td><td align="center" valign="middle" >pAPNC213 P<sub>spac</sub>-RBS-rsiV<sub>N</sub>-rsiW<sub>TMC</sub></td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >pAP-RsiV<sub>NTM</sub>-RsiW<sub>C</sub></td><td align="center" valign="middle" >pAPNC213 P<sub>spac</sub>-RBS-rsiV<sub>NTM</sub>-rsiW<sub>C</sub></td><td align="center" valign="middle" >This study</td></tr></tbody></table></table-wrap><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> PCR primers used for strain construction</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer</th><th align="center" valign="middle" >Sequence (5&#162;&#174;3&#162;)</th><th align="center" valign="middle" >T<sub>m</sub> (˚C)</th><th align="center" valign="middle" >Purpose</th><th align="center" valign="middle" ></th></tr></thead><tr><td align="center" valign="middle" >sigVA-F</td><td align="center" valign="middle" >CATTATTGCGTACGGAGAC</td><td align="center" valign="middle" >58.1</td><td align="center" valign="middle"  colspan="2"  >For marker-free deletion of sigV</td></tr><tr><td align="center" valign="middle" >sigVA-R</td><td align="center" valign="middle" >TGCAATAAAGGGCTCCT</td><td align="center" valign="middle" >58.3</td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >sigVB-F2</td><td align="center" valign="middle" >CAAAAAGGAGCCCTTTATTGCAATGGATAAGAGATTACAGC</td><td align="center" valign="middle" >76.8</td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >sigVB-R</td><td align="center" valign="middle" >GCTTGAGTCAATTCCGCTGTCGGCTTTGTGTGTAGGAAG</td><td align="center" valign="middle" >82.5</td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >sigVC-F</td><td align="center" valign="middle" >CAAAATTAACGTACTGATTGGGTAGGATCCGCGCAGGTTGGCTTTCAGTTATG</td><td align="center" valign="middle" >84.8</td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >sigVC-R</td><td align="center" valign="middle" >CGTGTTTTCTCCTGTAATTTCC</td><td align="center" valign="middle" >61.2</td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >rsiVA-F</td><td align="center" valign="middle" >CTAGGTAACAGCCTACG</td><td align="center" valign="middle" >50.2</td><td align="center" valign="middle"  colspan="2"  >For marker-free deletion of rsiV</td></tr><tr><td align="center" valign="middle" >rsiVA-R</td><td align="center" valign="middle" >TAAGAAAGATCCTCCTTCG</td><td align="center" valign="middle" >56.0</td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >rsiVB-F</td><td align="center" valign="middle" >GTTGACGAAGGAGGATCTTTCTTAATCCATCTAAGATTATGGATG</td><td align="center" valign="middle" >76.4</td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >rsiVBmazF-R</td><td align="center" valign="middle" >GCTTGAGTCAATTCCGCTGTCGGTTCTTCAATCGCCAGCGAC</td><td align="center" valign="middle" >87.6</td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >mazFrsiVC-F</td><td align="center" valign="middle" >CAAAATTAACGTACTGATTGGGTAGGATC</td><td align="center" valign="middle" >87.6</td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >rsiVC-R</td><td align="center" valign="middle" >GATAGAGAGTAAATCTGGCGTGTC</td><td align="center" valign="middle" >61.9</td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >pAPNC-F</td><td align="center" valign="middle" >CGACAGCGGAATTGACTCAAGC</td><td align="center" valign="middle" >70.0</td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >chpA-R</td><td align="center" valign="middle" >CGCGGATCCTACCCAATCAGTACGTTAATTTTG</td><td align="center" valign="middle" >75.7</td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >sigVcheck-F</td><td align="center" valign="middle" >CACCTTTAACAGGCTATGCC</td><td align="center" valign="middle" >61.0</td><td align="center" valign="middle"  colspan="2"  >For confirmation of marker-free deletion of sigV</td></tr><tr><td align="center" valign="middle" >rsiVcheck-F</td><td align="center" valign="middle" >CCTTCATGATATGAGCAG</td><td align="center" valign="middle" >53.7</td><td align="center" valign="middle"  colspan="2"  >For confirmation of marker-free deletion of rsiV</td></tr><tr><td align="center" valign="middle" >rsiVcheck-R</td><td align="center" valign="middle" >CACAAGCAATGATATCAC</td><td align="center" valign="middle" >51.6</td><td align="center" valign="middle"  colspan="2"  >For confirmation of marker-free deletion of sigV and rsiV</td></tr><tr><td align="center" valign="middle" >RsiVNup</td><td align="center" valign="middle" >GGAGATTCCTAGGATGGACTACAAAGACGACGACGACAAAATGGATAAGAGATTACAGCAATTAAGAG</td><td align="center" valign="middle" >78.1</td><td align="center" valign="middle"  colspan="2"  >For construction of chimeric anti-σ factors RsiV<sub>N</sub>-RsiW<sub>TMC</sub> and RsiV<sub>NTM</sub>-RsiW<sub>C</sub></td></tr><tr><td align="center" valign="middle" >RsiVNdown</td><td align="center" valign="middle" >GGATGGGTTCTGAACCATTTCTTTTTTGGTTCTTGCTG</td><td align="center" valign="middle" >79.2</td><td align="center" valign="middle"  colspan="2"  >For construction of chimeric anti-σ factor RsiV<sub>N</sub>-RsiW<sub>TMC</sub></td></tr><tr><td align="center" valign="middle" >RsiVNTMdown</td><td align="center" valign="middle" >GTCATTATGCCAGCTGTTGATATTAACAAGCGCAGTG</td><td align="center" valign="middle" >77.4</td><td align="center" valign="middle"  colspan="2"  >For construction of chimeric anti-σ factor RsiV<sub>NTM</sub>-RsiW<sub>C</sub></td></tr><tr><td align="center" valign="middle" >RsiWTMCup</td><td align="center" valign="middle" >TGGTTCAGAACCCATCCCGTTATCG</td><td align="center" valign="middle" >73.7</td><td align="center" valign="middle"  colspan="2"  >For construction of chimeric anti-σ factor RsiV<sub>N</sub>-RsiW<sub>TMC</sub></td></tr><tr><td align="center" valign="middle" >RsiWTMCdown</td><td align="center" valign="middle" >TCGAGGGGGGGCCCGTGTTACTCTTCTCCGTTCGGAT</td><td align="center" valign="middle" >87.2</td><td align="center" valign="middle"  colspan="2"  >For construction of chimeric anti-σ factors RsiV<sub>N</sub>-RsiW<sub>TMC</sub> and RsiV<sub>NTM</sub>-RsiW<sub>C</sub></td></tr><tr><td align="center" valign="middle" >RsiWCup</td><td align="center" valign="middle" >AACAGCTGGCATAATGA</td><td align="center" valign="middle" >60.1</td><td align="center" valign="middle"  colspan="2"  >For construction of chimeric anti-σ factor RsiV<sub>NTM</sub>-RsiW<sub>C</sub></td></tr><tr><td align="center" valign="middle" >pAPNC-SalI-up</td><td align="center" valign="middle" >CTGCAGGCATGCCTGCAGGGAGATTCCTAGGATGGACTAC</td><td align="center" valign="middle" >84.4</td><td align="center" valign="middle"  colspan="2"  >For construction of chimeric anti-σ factors</td></tr><tr><td align="center" valign="middle" >pAPNC-SalI-down</td><td align="center" valign="middle" >CCGGGGATCCTCTAGAGTCGAGGGGGGGCCCGTG</td><td align="center" valign="middle" >88.6</td><td align="center" valign="middle"  colspan="2"  ></td></tr><tr><td align="center" valign="middle" >pAPNCcheckF</td><td align="center" valign="middle" >ACAAGGTGTGGCATAATGTG</td><td align="center" valign="middle" >60.9</td><td align="center" valign="middle"  colspan="2"  >For sequence confirmation of chimeric anti-σ factors</td></tr><tr><td align="center" valign="middle" >pAPNCcheckR</td><td align="center" valign="middle" >GCTATATTGGCCGCTTCCTG</td><td align="center" valign="middle" >65.5</td><td align="center" valign="middle"  colspan="2"  ></td></tr></tbody></table></table-wrap><p>strate and the unit definition were as described by Wang and Doi [<xref ref-type="bibr" rid="scirp.75962-ref27">27</xref>] . Proteins were separated by SDS gel electrophoresis with 15% polyacrylamide gel. Luminata Forte Western HRP Substrate (Millipore) was used for immunodetection according to the manufacturer’s instructions. For immunoblotting, anti-DYKDDDK tag (FLAG tag) monoclonal antibody (Wako Pure Chemicals) and anti-σ<sup>A</sup> antiserum (a gift from K. Asai) were used. The secondary antibodies were peroxidase-conjugated anti-mouse IgG (H+L) and anti-rabbit IgG (H+L) (Jackson ImmunoResearch Laboratories). Immuno-stained bands were detected by C-Digit scanner (LI-COR), and the band intensities were measured by Image Studio software (LI-COR).</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Lack of Glucolipids Affects σ<sup>V</sup> Activity through the Anti-σ Factor RsiV</title><p>The activity of σ<sup>V</sup> was monitored by β-galactosidase activity expressed from P<sub>sigV</sub>-lacZ integrated into the chromosomal amyE locus. A ugtP deletion mutant showed an approximately two-fold activation of σ<sup>V</sup> compared to wild type (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)). In ∆sigV and ∆sigV ∆ugtP mutants the activity was almost abolished, indicating that P<sub>sigV</sub>-lacZ expression was dependent on σ<sup>V</sup> activation. Deletion of the rsiV gene encoding anti-σ<sup>V</sup> factor led to high σ<sup>V</sup> activity, but additional introduction of a ugtP deletion mutation did not lead to additional activation of σ<sup>V</sup> (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)). The rsiV deletion mutant was insensitive to the lack of glucolipids, which is consistent with the idea that the lack of glucolipids affects σ<sup>V</sup> activity through RsiV.</p></sec><sec id="s3_2"><title>3.2. 1,10-Phenanthroline Inhibited Activation of σ<sup>V</sup> Caused by Addition of Lysozyme But Not the Activation by Lack of Glucolipids</title><p>The zinc chelator 1,10-phenanthroline (PT) inhibits the site-2 protease RasP [<xref ref-type="bibr" rid="scirp.75962-ref5">5</xref>] , as it does many other site-2 metalloproteases [<xref ref-type="bibr" rid="scirp.75962-ref28">28</xref>] . When ugtP<sup>+</sup> cells were challenged by hen egg white lysozyme (HEWL) at low concentration (100 ng/mL), σ<sup>V</sup> was activated several-fold. Addition of 10 mM PT returned the σ<sup>V</sup> activity to the basal level (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)), most probably via inhibition of RasP. Approximately two-fold activation of σ<sup>V</sup> in the ∆ugtP mutant compared to wild type was not changed by addition of 10 mM PT (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)), suggesting that the inhibition of RasP by PT did not affect activation. It seems that the activation of σ<sup>V</sup> by the lack of glucolipids does not depend on the function of the site-2 protease RasP. Addition of HEWL to the PT-treated ∆ugtP cells did not increase the σ<sup>V</sup> activity (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). The σ<sup>V</sup> activation by HEWL seems to depend on RasP in the ∆ugtP cells as well as in the ugtP<sup>+</sup> cells.</p></sec><sec id="s3_3"><title>3.3. A rasP Mutation Abolished the σ<sup>V</sup> Activation Caused by the Addition of Lysozyme But Not the Activation by the Lack of Glucolipids</title><p>When wild-type cells were treated with increasing concentrations (25, 50 and</p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Activation levels of σ<sup>V</sup> monitored via P<sub>sigV</sub>-lacZ transcriptional fusion. Cells were grown in LB medium to mid-exponential phase (mini photo 518R reading of 0.35 - 0.45) unless otherwise noted, and b-galactosidase activity was measured. The means and standard deviations of at least three measurements are shown. Asterisks indicate significant differences as determined by Student’s t-test: *P &lt; 0.05, **P &lt; 0.01. (a) Effect of ∆sigV and ∆rsiV on the s<sup>V</sup> activity. Strains YTB041, YTB040, SBS313, SBS314, SBS361 and SBS362 were analyzed; (b) Effect of PT on the s<sup>V</sup> activity. Strains YTB041 and YTB040 were analyzed. For HEWL treatment of YTB041 the cells were grown to early-exponential phase (mini photo reading of 0.20), and HEWL was added to 100 ng/mL, followed by 30 min shaking, after which the culture reached mid-exponential phase. For PT treatment of YTB040 the cells were grown to mid-exponential phase (mini photo reading of 0.45), and PT was added to 10 mM, followed by 20 min shaking. For HEWL and PT treatment the cells were grown to mid-exponential phase (mini photo reading of 0.45), and PT was added to 10 mM, which stopped the turbidity increase; after 20 min shaking HEWL was added to 100 ng/mL, followed by 30 min shaking; (c) Effect of a rasP mutation on the σ<sup>V</sup> activity. Strains YTB041, SBS101, YTB040 and SBS102 were analyzed. The cells were treated with HEWL at the concentrations (in ng/mL) indicated in the square brackets as described for YTB041 in (b); (d) FLAG-RsiV is functional. Strains SBS204 and SBS205 were analyzed. The cells were grown in the presence or absence of 1 mM IPTG; (e) Anti-σ activities of RsiV<sub>N</sub>-RsiW<sub>TMC</sub> and RsiV<sub>NTM</sub>-RsiW<sub>C</sub>. Strains SBS500, SBS501, SBS502 and SBS503 were analyzed. One millimolar IPTG was added or withheld from the beginning of the culture. SBS500 and SBS502 cells were subjected to 100 ng/mL HEWL as described for YTB041 in (b). For alkali treatment of SBS500 and SBS502 the cells were grown to early-exponential phase (mini photo reading of 0.20) and 5.5 &#181;l of 5 N NaOH was added to the 5-mL cultures, which brought the medium pH to ca. 8.9; this was followed by 30 min shaking</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/9-2270931x2.png"/></fig><p>100 ng/mL) of HEWL, the activity of σ<sup>V</sup> increased accordingly (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)). A rasP::tet mutant showed a basal level σ<sup>V</sup> activity in the absence of HEWL (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)). Whereas the addition of 100 ng/mL HEWL activated σ<sup>V</sup> several-fold in rasP<sup>+</sup> cells, the σ<sup>V</sup> activity level in the rasP::tet mutant did not change in the presence of 100 ng/mL HEWL (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)), indicating that the activation of σ<sup>V</sup> by HEWL requires RasP [<xref ref-type="bibr" rid="scirp.75962-ref5">5</xref>] . On the other hand, the approximately two-fold activation of σ<sup>V</sup> in the ∆ugtP mutant did not change when, in addition, rasP was disrupted (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)), indicating that RasP has nothing to do with the σ<sup>V</sup> activation by the lack of glucolipids. Addition of 100 ng/mL HEWL to the ∆ugtP mutant resulted in a remarkably high activation of σ<sup>V</sup> (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)). The ∆ugtP mutant seems to become sensitized to the stress from HEWL addition. Addition of HEWL to ∆ugtP rasP::tet mutant cells did not change the σ<sup>V</sup> activity (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)). The σ<sup>V</sup> activation by HEWL required RasP in the ∆ugtP cells as well as in the ugtP<sup>+</sup> cells.</p></sec><sec id="s3_4"><title>3.4. RsiV Was Not Degraded in the ∆ugtP Cells</title><p>RsiV is degraded by RIP in response to lysozyme. N-terminally FLAG tag-fused RsiV was expressed and analyzed by immunoblotting (<xref ref-type="fig" rid="fig2">Figure 2</xref>). When ugtP<sup>+</sup> cells were treated with 25, 50 and 100 ng/mL HEWL, the amount of intact FLAG-RsiV protein was reduced to about 90%, about 70% and about 40%, respectively, compared with cells that were not treated with HEWL. This is consistent with the increasing activity of σ<sup>V</sup> with increasing concentrations of HEWL (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)). In contrast, ∆ugtP cells showed no decrease in the amount of intact FLAG-tagged RsiV compared with the wild type not treated with HEWL. This result indicates that site-1 cleavage did not occur in ∆ugtP cells. Site-1 cleavage is a prerequisite for site-2 cleavage, and RasP cleavage is constitutive once site-1 cleavage has occurred [<xref ref-type="bibr" rid="scirp.75962-ref5">5</xref>] . The idea that RasP has nothing to do with the σ<sup>V</sup> activation by lack of glucolipids fits into this scenario. When 100 ng/mL HEWL was added to ∆ugtP cells, the amount of intact FLAG-RsiV protein was reduced to about 7% (<xref ref-type="fig" rid="fig2">Figure 2</xref>). This corresponds well with the remarkably high activation of σ<sup>V</sup> in the ∆ugtP mutant when 100 ng/mL HEWL was added (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)). The FLAG-tagged RsiV was functional: when the expression of P<sub>spac</sub>-flag-rsiV was induced with IPTG, σ<sup>V</sup> activity was repressed in both ugtP<sup>+</sup> and ∆ugtP cells (<xref ref-type="fig" rid="fig1">Figure 1</xref>(d)).</p><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Degradation of RsiV. Strains SBS200 and SBS201 were analyzed. The cells were grown in LB medium containing 1 mM IPTG to mid-exponential phase (mini photo reading of 0.40 - 0.45), and 250 &#181;g/mL chloramphenicol and HEWL of the indicated concentrations were added, followed by 10 min shaking. Harvested samples were sonicated and subjected to SDS-PAGE. The sample amount per lane was normalized by the culture turbidity. FLAG-RsiV and σ<sup>A</sup> (an internal control) were detected by immunoblotting. The relative ratio of the amount of Flag-RsiV to that of σ<sup>A</sup> is shown under each lane. The ratio in SBS200 (WT) in the absence of HEWL was set to 1.0</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/9-2270931x3.png"/></fig></sec><sec id="s3_5"><title>3.5. The Behavior of RsiV-RsiW Chimeric Anti-σ Factors Indicated That the C-Terminal Extracytoplasmic Region of RsiV Was Necessary for the Response to Lack of Glucolipids</title><p>Chimeric anti-σ factors, RsiV<sub>N</sub>-RsiW<sub>TMC</sub> and RsiV<sub>NTM</sub>-RsiW<sub>C</sub>, were constructed (see Materials and Methods). RsiW is an anti-σ factor for σ<sup>W</sup> [<xref ref-type="bibr" rid="scirp.75962-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref2">2</xref>] . Whereas σ<sup>W</sup> is activated by RIP of RsiW [<xref ref-type="bibr" rid="scirp.75962-ref29">29</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref30">30</xref>] in response to a variety of signals, including an alkaline shock [<xref ref-type="bibr" rid="scirp.75962-ref31">31</xref>] , it is not activated by lack of glucolipids [<xref ref-type="bibr" rid="scirp.75962-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref14">14</xref>] .</p><p>Both chimeric anti-σ factors are functional as anti-σ<sup>V</sup>: when their expression was induced with IPTG in a ∆rsiV background, σ<sup>V</sup> activity was repressed (<xref ref-type="fig" rid="fig1">Figure 1</xref>(e)). The N-terminal region of RsiV seems to be sufficient to sequester σ<sup>V</sup>.</p><p>In cells expressing either chimeric anti-σ factor, σ<sup>V</sup> was not activated by the addition of 100 ng/mL HEWL (<xref ref-type="fig" rid="fig1">Figure 1</xref>(e)). This is consistent with reports that the C-terminal region of RsiV binds HEWL [<xref ref-type="bibr" rid="scirp.75962-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref7">7</xref>] .</p><p>We found that σ<sup>V</sup> was activated when the cells expressing RsiV<sub>N</sub>-RsiW<sub>TMC</sub> suffered alkaline stress (pH 8.9) (<xref ref-type="fig" rid="fig1">Figure 1</xref>(e)). Most probably the transmembrane and C-terminal extracytoplasmic regions of σ<sup>W</sup> underwent RIP in response to the alkaline stress, which led to degradation of the chimeric anti-σ factor and to release of σ<sup>V</sup>. In contrast, in the cells expressing RsiV<sub>NTM</sub>-RsiW<sub>C</sub> σ<sup>V</sup> was not activated in response to alkaline stress (<xref ref-type="fig" rid="fig1">Figure 1</xref>(e)). The C-terminal extracytoplasmic region of RsiW may undergo site-1 cleavage, but it does not seem to lead to the site-2 cleavage of the fused transmembrane region of RsiV.</p><p>The expression of the chimeric anti-σ factors in ∆ugtP cells resulted in σ<sup>V</sup> activity at the basal level of the ugtP<sup>+</sup> cells (<xref ref-type="fig" rid="fig1">Figure 1</xref>(e)). This indicates that the C-terminal extracytoplasmic region is necessary for σ<sup>V</sup> to respond to the lack of glucolipids.</p><p>We also constructed chimeric anti-σ factors, RsiW<sub>N</sub>-RsiV<sub>TMC</sub> and RsiW<sub>NTM</sub>- RsiV<sub>C</sub>, but they were not functional as anti-σ<sup>W</sup>: IPTG induction of their expression in a ∆rsiW background even from multicopy plasmids did not lead to repression of σ<sup>W</sup> activity (data not shown); the reason is unknown.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>B. subtilis σ<sup>V</sup> is activated primarily in response to lysozyme [<xref ref-type="bibr" rid="scirp.75962-ref4">4</xref>] . The activation depends on the RIP of the anti-σ factor RsiV [<xref ref-type="bibr" rid="scirp.75962-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.75962-ref7">7</xref>] . By contrast, in a ∆ugtP mutant that lacks glucolipids, σ<sup>V</sup> is activated without RIP of RsiV. The activation was not inhibited by the zinc chelator PT, an inhibitor of the site-2 protease RasP, nor was it abolished in a rasP mutant. No proteolysis of RsiV was observed in the ∆ugtP mutant, indicating that site-1 cleavage did not occur. Most probably a conformational change of RsiV without proteolysis is responsible for the release of σ<sup>V</sup> from RsiV in the ∆ugtP mutant.</p><p>Some relevant information concerning the activation of B. subtilis ECF σ factors is available. It is known that σ<sup>W</sup> is activated by RIP. Under alkaline stress, the anti-σ factor RsiW is first degraded by the site-1 protease PrsW, trimmed by several peptidases, and then degraded by the site-2 protease RasP [<xref ref-type="bibr" rid="scirp.75962-ref29">29</xref>] . There are two anti-σ factors, YhdL and YhdK, involved in the regulation of σ<sup>M</sup>, where YhdL has the major function of binding σ<sup>M</sup> directly. Under salt stress, σ<sup>M</sup> is activated but no proteolysis of N-terminally hexahistidine-tagged YhdL is observed [<xref ref-type="bibr" rid="scirp.75962-ref32">32</xref>] . This suggests that σ<sup>M</sup> is probably released by a conformational change of YhdL.</p><p>The activation of σ<sup>V</sup> in the ∆ugtP mutant cells upon addition of 100 ng/mL HEWL was higher than in ugtP<sup>+</sup> cells, and degradation of RsiV was correspondingly enhanced in the ∆ugtP mutant cells. This may be due to the proposed conformational change of RsiV in the ∆ugtP mutant cells.</p><p>Addition of Mg<sup>2+</sup> suppressed the σ<sup>V</sup> activation in the absence of glucolipids [<xref ref-type="bibr" rid="scirp.75962-ref16">16</xref>] . Thus, it seems unlikely that direct interaction of glucolipids with RsiV is required for its sequestering of σ<sup>V</sup>. The lack of glucolipids probably affects the membrane properties, which may then lead to a conformational change of RsiV and to release of σ<sup>V</sup>. One line of reasoning might be as follows: glucolipids have no charge in their polar head groups. It is possible that the change in the charge distribution on the membrane surface brought about by their absence affects the conformation of RsiV. We note that synthesis of Acholeplasma laidlawii monoglucosyldiacylglycerol suppressed, albeit only partially, the σ<sup>V</sup> activation in the ∆ugtP mutant [<xref ref-type="bibr" rid="scirp.75962-ref16">16</xref>] . This too, may be caused by a change in the charge characteristics of the membrane surface. In this regard, it is also noteworthy that the membrane surface charge characteristics are an important topological determinant of E. coli LacY protein [<xref ref-type="bibr" rid="scirp.75962-ref33">33</xref>] .</p><p>Experiments with chimeric anti-σ factors indicated that the C-terminal region of RsiV is necessary for the response to glucolipid deficiency. It seems that the C-terminal extracytoplasmic region of RsiV is important for it to be sensitive to the alteration in charge characteristics of the membrane surface.</p><p>We conclude that, in glucolipid-lacking mutants of B. subtilis, σ<sup>V</sup> can be activated without proteolysis of anti-σ factor RsiV and that this is most likely brought about by a conformational change of RsiV due to the alteration of the membrane surface charge characteristics.</p></sec><sec id="s5"><title>Acknowledgements</title><p>We are grateful to Thomas Wiegert for providing the chromosomal DNA of the strain 1012 rasP and to Kei Asai for providing the strain SBS200 and anti-σ<sup>A</sup> antiserum. T. S. is a research fellow of Japan Society for the Promotion of Science (JSPS). This work was supported in part by JSPS KAKENHI (Grant-in-Aid for JSPS Research Fellow) Grant Number JP16J10629 to T. S.</p></sec><sec id="s6"><title>Cite this paper</title><p>Seki, T., Matsumoto, K., Matsuoka, S. and Hara, H. (2017) Activation without Proteolysis of Anti-σ Factor RsiV of the Extracytoplasmic Function σ Factor σ<sup>V</sup> in a Glucolipid-Deficient Mutant of Bacillus subtilis. Advances in Microbiology, 7, 315-327. https://doi.org/10.4236/aim.2017.74026</p></sec></body><back><ref-list><title>References</title><ref id="scirp.75962-ref1"><label>1</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Helmann</surname><given-names> J.D. </given-names></name>,<etal>et al</etal>. (<year>2002</year>)<article-title>The Extracytoplasmic Function (ECF) Sigma Factors</article-title><source> Advances in Microbial Physiology</source><volume> 46</volume>,<fpage> 47</fpage>-<lpage>110</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.75962-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Yoshimura, M., Asai, K., Sadaie, Y. and Yoshikawa, H. (2004) Interaction of Bacillus subtilis Extracytoplasmic Function (ECF) Sigma Factors with the N-Terminal Regions of Their Potential Anti-Sigma Factors. Microbiology, 150, 591-599. https://doi.org/10.1099/mic.0.26712-0</mixed-citation></ref><ref id="scirp.75962-ref3"><label>3</label><mixed-citation publication-type="book" xlink:type="simple">Asai, K., Matsumoto, T. and Sadaie, Y. (2005) ECF (Extracytoplasmic Function) Sigma Factors of Bacillus subtilis. In: Yamada, M., Ed., Survival and Death in Bacteria, Research Signpost, Kerala, 143-153.</mixed-citation></ref><ref id="scirp.75962-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Ho, T.D., Hastie, J.L., Intile, P.J. and Ellermeier, C.D. (2011) The Bacillus subtilis Extracytoplasmic Function Sigma Factor σ&lt;sup&gt;V&lt;/sup&gt; Is Induced by Lysozyme and Provides Resistance to Lysozyme. Journal of Bacteriology, 193, 6215-6222. https://doi.org/10.1128/JB.05467-11</mixed-citation></ref><ref id="scirp.75962-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Hastie, J.L., Williams, K.B. and Ellermeier, C.D. (2013) The Activity of σ&lt;sup&gt;V&lt;/sup&gt;, an Extracytoplasmic Function σ Factor of Bacillus subtilis, Is Controlled by Regulated Proteolysis of the Anti-σ Factor RsiV. Journal of Bacteriology, 195, 3135-3144. https://doi.org/10.1128/JB.00292-13</mixed-citation></ref><ref id="scirp.75962-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Hastie, J.L., Williams, K.B., Sepulveda, C., Houtman, J.C., Forest, K.T. and Ellermeier, C.D. (2014) Evidence of a Bacterial Receptor for Lysozyme: Binding of Lysozyme to the Anti-σ Factor RsiV Controls Activation of the ECF σ Factor σ&lt;sup&gt;V&lt;/sup&gt;. PLoS Genetics, 10, e1004643. https://doi.org/10.1371/journal.pgen.1004643</mixed-citation></ref><ref id="scirp.75962-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Hastie, J.L., Williams, K.B., Bohr, L.L., Houtman, J.C., Gakhar, L. and Ellermeier, C.D. (2016) The Anti-Sigma Factor RsiV Is a Bacterial Receptor for Lysozyme: Co-Crystal Structure Determination and Demonstration That Binding of Lysozyme to RsiV Is Required for σ&lt;sup&gt;V&lt;/sup&gt; Activation. PLoS Genetics, 12, e1006287. https://doi.org/10.1371/journal.pgen.1006287</mixed-citation></ref><ref id="scirp.75962-ref8"><label>8</label><mixed-citation publication-type="book" xlink:type="simple">Matsumoto, K., Matsuoka, S. and Hara, H. (2012) Membranes and Lipids. In: Sadaie, Y. and Matsumoto, K., Eds., Escherichia coli and Bacillus subtilis: The Frontier of Molecular Microbiology Revisited, Research Signpost, Kerala, 61-91.</mixed-citation></ref><ref id="scirp.75962-ref9"><label>9</label><mixed-citation publication-type="book" xlink:type="simple">De Mendoza, D., Schujman, G.E. and Aguilar, P.S. (2002) Biosynthesis and Function of Membrane Lipids. In: Sonenshein, A.L., Hoch, J.A., and Losick, R., Eds., Bacillus Subtilis and Its Closest Relatives, ASM Press, Washington DC, 43-55. https://doi.org/10.1128/9781555817992.ch5</mixed-citation></ref><ref id="scirp.75962-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Jorasch, P., Wolter, F.P., Zahringer, U. and Heinz, E. (1998) A UDP Glucosyltransferase from Bacillus subtilis Successively Transfers up to Four Glucose Residues to 1,2-Diacylglycerol: Expression of YpfP in Escherichia coli and Structural Analysis of Its Reaction Products. Molecular Microbiology, 29, 419-430. https://doi.org/10.1046/j.1365-2958.1998.00930.x</mixed-citation></ref><ref id="scirp.75962-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Weart, R.B., Lee, A.H., Chien, A.C., Haeusser, D.P., Hill, N.S. and Levin, P.A. (2007) A Metabolic Sensor Governing Cell Size in Bacteria. Cell, 130, 335-347.</mixed-citation></ref><ref id="scirp.75962-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Price, K.D., Roels, S. and Losick, R. (1997) A Bacillus subtilis Gene Encoding a Protein Similar to Nucleotide Sugar Transferases Influences Cell Shape and Viability. Journal of Bacteriology, 179, 4959-4961. https://doi.org/10.1128/jb.179.15.4959-4961.1997</mixed-citation></ref><ref id="scirp.75962-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Matsuoka, S., Chiba, M., Tanimura, Y., Hashimoto, M., Hara, H. and Matsumoto, K. (2011) Abnormal Morphology of Bacillus subtilis UgtP Mutant Cells Lacking Glucolipids. Genes &amp; Genetic Systems, 86, 295-304. https://doi.org/10.1266/ggs.86.295</mixed-citation></ref><ref id="scirp.75962-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Hashimoto, M., Seki, T., Matsuoka, S., Hara, H., Asai, K., Sadaie, Y. and Matsumoto, K. (2013) Induction of Extracytoplasmic Function Sigma Factors in Bacillus subtilis Cells with Defects in Lipoteichoic Acid Synthesis. Microbiology, 159, 23-35. https://doi.org/10.1099/mic.0.063420-0</mixed-citation></ref><ref id="scirp.75962-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Seki, T., Mineshima, R., Hashimoto, M., Matsumoto, K., Hara, H. and Matsuoka, S. (2015) Repression of the Activities of Two Extracytoplasmic Function Sigma Factors, σ&lt;sup&gt;M&lt;/sup&gt; and σ&lt;sup&gt;V&lt;/sup&gt;, of Bacillus subtilis by Glucolipids in Escherichia coli Cells. Genes &amp; Genetic Systems, 90, 109-114. https://doi.org/10.1266/ggs.90.109</mixed-citation></ref><ref id="scirp.75962-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Matsuoka, S., Seki, T., Matsumoto, K. and Hara, H. (2016) Suppression of Abnormal Morphology and Extracytoplasmic Function Sigma Activity in Bacillus subtilis UgtP Mutant Cells by Expression of Heterologous Glucolipid Synthases from Acholeplasma laidlawii. Bioscience, Biotechnology, and Biochemistry, 80, 2325-2333. https://doi.org/10.1080/09168451.2016.1217147</mixed-citation></ref><ref id="scirp.75962-ref17"><label>17</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Shibuya</surname><given-names> I. </given-names></name>,<etal>et al</etal>. (<year>1992</year>)<article-title>Metabolic Regulations and Biological Functions of Phospholipids in Escherichia coli</article-title><source> Progress in Lipid Research</source><volume> 31</volume>,<fpage> 245</fpage>-<lpage>299</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.75962-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Alba, B.M. and Gross, C.A. (2004) Regulation of the Escherichia coli σ&lt;sup&gt;E&lt;/sup&gt;-Dependent Envelope Stress Response. Molecular Microbiology, 52, 613-619. https://doi.org/10.1111/j.1365-2958.2003.03982.x</mixed-citation></ref><ref id="scirp.75962-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Kanehara, K., Ito, K. and Akiyama, Y. (2002) YaeL (EcfE) Activates the σ&lt;sup&gt;E&lt;/sup&gt; Pathway of Stress Response through a Site-2 Cleavage of Anti-σ&lt;sup&gt;E&lt;/sup&gt;, RseA. Genes &amp; Development, 16, 2147-2155. https://doi.org/10.1101/gad.1002302</mixed-citation></ref><ref id="scirp.75962-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Kanehara, K., Ito, K. and Akiyama, Y. (2003) YaeL Proteolysis of RseA Is Controlled by the Pdz Domain of YaeL and a Gln-Rich Region of RseA. EMBO Journal, 22, 6389-6398. https://doi.org/10.1093/emboj/cdg602</mixed-citation></ref><ref id="scirp.75962-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Morimoto, T., Ara, K., Ozaki, K. and Ogasawara, N. (2009) A New Simple Method to Introduce Marker-Free Deletions in the Bacillus subtilis Genome. Genes &amp; Genetic Systems, 84, 315-318. https://doi.org/10.1266/ggs.84.315</mixed-citation></ref><ref id="scirp.75962-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Anagnostopoulos, C. and Crawford, I.P. (1961) Transformation Studies on the Linkage of Markers in the Tryptophan Pathway in Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America, 47, 378-390. https://doi.org/10.1073/pnas.47.3.378</mixed-citation></ref><ref id="scirp.75962-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Lewis, P.J. and Marston, A.L. (1999) GFP Vectors for Controlled Expression and Dual Labelling of Protein Fusions in Bacillus subtilis. Gene, 227, 101-110.</mixed-citation></ref><ref id="scirp.75962-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Morimoto, T., Loh, P.C., Hirai, T., Asai, K., Kobayashi, K., Moriya, S. and Ogasawara, N. (2002) Six GTP-Binding Proteins of the Era/Obg Family Are Essential for Cell Growth in Bacillus subtilis. Microbiology, 148, 3539-3552. https://doi.org/10.1099/00221287-148-11-3539</mixed-citation></ref><ref id="scirp.75962-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Miller, J.H. (1992) A Short Course in Bacterial Genetics: A Laboratory Manual and Handbook for Escherichia coli and Related Bacteria. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.</mixed-citation></ref><ref id="scirp.75962-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Sambrook, J. and Russell, D.W. (2001) Molecular Cloning: A Laboratory Manual. 3rd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor.</mixed-citation></ref><ref id="scirp.75962-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Wang, P.Z. and Doi, R.H. (1984) Overlapping Promoters Transcribed by Bacillus subtilis σ&lt;sup&gt;55&lt;/sup&gt; and σ&lt;sup&gt;37&lt;/sup&gt; RNA Polymerase Holoenzymes during Growth and Stationary Phases. Journal of Biological Chemistry, 259, 8619-8625.</mixed-citation></ref><ref id="scirp.75962-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Feng, L., Yan, H., Wu, Z., Yan, N., Wang, Z., Jeffrey, P.D. and Shi, Y. (2007) Structure of a Site-2 Protease Family Intramembrane Metalloprotease. Science, 318, 1608-1612. https://doi.org/10.1126/science.1150755</mixed-citation></ref><ref id="scirp.75962-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Heinrich, J., Hein, K. and Wiegert, T. (2009) Two Proteolytic Modules Are Involved in Regulated Intramembrane Proteolysis of Bacillus subtilis RsiW. Molecular Microbiology, 74, 1412-1426. https://doi.org/10.1111/j.1365-2958.2009.06940.x</mixed-citation></ref><ref id="scirp.75962-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Sch&amp;#246bel, S., Zellmeier, S., Schumann, W. and Wiegert, T. (2004) The Bacillus subtilis σ&lt;sup&gt;W&lt;/sup&gt; Anti-Sigma Factor RsiW Is Degraded by Intramembrane Proteolysis through YluC. Molecular Microbiology, 52, 1091-1105. https://doi.org/10.1111/j.1365-2958.2004.04031.x</mixed-citation></ref><ref id="scirp.75962-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Wiegert, T., Homuth, G., Versteeg, S. and Schumann, W. (2001) Alkaline Shock Induces the Bacillus subtilis σ&lt;sup&gt;W&lt;/sup&gt; Regulon. Molecular Microbiology, 41, 59-71. https://doi.org/10.1046/j.1365-2958.2001.02489.x</mixed-citation></ref><ref id="scirp.75962-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Inoue, H. (2013) Analysis of Extracytoplasmic Stress Response Mechanisms Contributing to Cell Surface Integrity in Bacillus subtilis. PhD Thesis, Saitama University, Saitama. (In Japanese)</mixed-citation></ref><ref id="scirp.75962-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Dowhan, W. and Bogdanov, M. (2009) Lipid-Dependent Membrane Protein Topogenesis. Annual Review of Biochemistry, 78, 515-540. https://doi.org/10.1146/annurev.biochem.77.060806.091251</mixed-citation></ref><ref id="scirp.75962-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Matsuoka, S., Hashimoto, M., Kamiya, Y., Miyazawa, T., Ishikawa, K., Hara, H. and Matsumoto, K. (2011) The Bacillus subtilis Essential Gene DgkB Is Dispensable in Mutants with Defective Lipoteichoic Acid Synthesis. Genes &amp; Genetic Systems, 86, 365-376. https://doi.org/10.1266/ggs.86.365</mixed-citation></ref><ref id="scirp.75962-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Zellmeier, S., Schumann, W. and Wiegert, T. (2006) Involvement of Clp Protease Activity in Modulating the Bacillus subtilis σ&lt;sup&gt;W&lt;/sup&gt; Stress Response. Molecular Microbiology, 61, 1569-1582. https://doi.org/10.1111/j.1365-2958.2006.05323.x</mixed-citation></ref></ref-list></back></article>