<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2017.74018</article-id><article-id pub-id-type="publisher-id">AiM-75402</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  The &lt;i&gt;PafR&lt;/i&gt; Gene Is Required for Antifungal Activity of Strain MS82 against &lt;i&gt;Mycogone perniciosa&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lin</surname><given-names>Ma</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Xiaoqiang</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Peng</surname><given-names>Deng</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Sonya</surname><given-names>M. Baird</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Youzhou</surname><given-names>Liu</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Shaoxuan</surname><given-names>Qu</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Shi-En</surname><given-names>Lu</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Institute of Vegetable Crops, Jiangsu Academy of Agricultural Sciences, Nanjing, China</addr-line></aff><aff id="aff2"><addr-line>Department of Biochemistry, Molecular Biology, Entomology and Plant Pathology, Mississippi State University, Starkville, USA</addr-line></aff><aff id="aff3"><addr-line>Institute of Plant Protection, Jiangsu Academy of Agricultural Sciences, Nanjing, China</addr-line></aff><pub-date pub-type="epub"><day>14</day><month>04</month><year>2017</year></pub-date><volume>07</volume><issue>04</issue><fpage>217</fpage><lpage>230</lpage><history><date date-type="received"><day>March</day>	<month>2,</month>	<year>2017</year></date><date date-type="rev-recd"><day>Accepted:</day>	<month>April</month>	<year>11,</year>	</date><date date-type="accepted"><day>April</day>	<month>14,</month>	<year>2017</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Bacterial strain MS82, isolated from the rhizosphere of a soybean plant, belongs to the species 
  Pseudomonas fluorescens. The most important feature of strain MS82 is the production of antifungal activity against the mushroom pathogenic fungus 
  Mycogone perniciosa but not against the mushroom fungus 
  Agaricus bisporus. In this study, the mutant MS82MT19 generated with the EZ-Tn5 transposon system completely lost the antifungal activity against 
  M. perniciosa. An open-reading frame named as 
  PafR and predicted to code for a sensory box GGDEF/EAL domain protein, was disrupted in MS82MT19. To further confirm the function of this gene, site-directed mutagenesis with insertion of the terminatorless 
  nptII cassette into the 
  PafR gene was used to generate the mutant MS82SD19. As expected, there was no detectable antifungal activity of mutant MS82SD19 against 
  M. perniciosa. These results suggest that the 
  PafR gene plays an important role in the production of antifungal activity of 
  P. fluorescens strain MS82.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Pseudomonas fluorescens&lt;/i&gt;</kwd><kwd> Antifungal Activity</kwd><kwd> &lt;i&gt;Mycogone perniciosa&lt;/i&gt;</kwd><kwd> Mutagenesis</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Mushrooms contain compounds such as minerals, vitamins, proteins and polysaccharides, and are therefore considered as nutritious foods [<xref ref-type="bibr" rid="scirp.75402-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.75402-ref2">2</xref>] . Commercial mushroom production is around 16 million tons annually worldwide and more than 75% of these mushrooms are produced in China, where the total value of mushroom production is ranked the fifth in terms of crop value [<xref ref-type="bibr" rid="scirp.75402-ref3">3</xref>] . Agaricus bisporus (Lange) Imbach, the white button mushroom, is grown mainly in North America, Europe, the Far East and Australasia, and is the predominant mushroom produced commercially worldwide [<xref ref-type="bibr" rid="scirp.75402-ref4">4</xref>] .</p><p>The mushroom fungus A. bisporus is attacked by a number of fungal and bacterial pathogens that may cause significant production losses. The environmental conditions under which mushrooms are grown are conducive to the propagation of these pathogens and subsequent development of diseases in the mushroom crop. Mycogone perniciosa (Magnus) Delacroix is the fungal pathogen causing wet bubble disease on the mushroom A. bisporus in commercial production facilities worldwide [<xref ref-type="bibr" rid="scirp.75402-ref5">5</xref>] . In recent years, the morbidity due to this disease was 40% and production was reduced more than 30% [<xref ref-type="bibr" rid="scirp.75402-ref6">6</xref>] . Only a few fungicides, such as prochloraz-Mn and carbendazim, are registered for diseases control in commercial mushroom production [<xref ref-type="bibr" rid="scirp.75402-ref7">7</xref>] . However, because of food safety issues, some of these fungicides are being phased out for mushroom production. Recently, the European community banned all benzimidazole-based fungicides such as carbendazim for control of the mushroom pathogens like M. perniciosa [<xref ref-type="bibr" rid="scirp.75402-ref8">8</xref>] . Typically, biologically-based fungicides are ranked as no or low risk pesticides to animals and humans. Therefore, there is a demand for more biologically-based fungicides that may be used in mushroom disease management [<xref ref-type="bibr" rid="scirp.75402-ref9">9</xref>] .</p><p>The bacterial genus Pseudomonas contains more than 100 species, many of which have been used for biocontrol of plant diseases [<xref ref-type="bibr" rid="scirp.75402-ref10">10</xref>] . Strains of Pseudomonas spp. are frequently isolated from soils and many of them have been studied for their antimicrobial activities and ability to protect plants [<xref ref-type="bibr" rid="scirp.75402-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.75402-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.75402-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.75402-ref14">14</xref>] . P. fluorescens lives in the soil and protects plant health by induction of plant defenses, nutrient cycling and antagonism against pathogens [<xref ref-type="bibr" rid="scirp.75402-ref15">15</xref>] . It is important to understand the molecular mechanisms of biocontrol activity of bacterial strains used for the development of new antibiotics and biological fungicides.</p><p>Strain MS82 was preliminarily identified to P. fluorescens based on 16S rDNA analysis [<xref ref-type="bibr" rid="scirp.75402-ref16">16</xref>] . The most important feature of strain MS82 is its antifungal activity against the white button mushroom fungal pathogen M. perniciosa, but not the mushroom fungus A. bisporus. This character indicates that MS82 has potential for development as a biopesticide for mushroom production. This study is to report the association of the PafR gene encoding a sensory box GGDEF/EAL domain protein with antifungal activity against the pathogenic fungus M. perniciosa.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Plasmids, Bacterial Strains and Culture Conditions</title><p>The plasmids and bacterial strains used in this study are listed in <xref ref-type="table" rid="table1">Table 1</xref>. Strain MS82 was isolated from the rhizosphere of a soybean plant grown at the R. R.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Plasmids and bacterial strains</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Strain or plasmid</th><th align="center" valign="middle" >Relevant characteristics</th><th align="center" valign="middle" >Source</th></tr></thead><tr><td align="center" valign="middle" >Escherichia coli</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >TransforMax EC100D pir<sup>+</sup></td><td align="center" valign="middle" >F? mcrA ∆(mrr-hsdRMS-mcrBC) ϕ80dlacZ∆M15 ∆lacX74 recA1 endA1 araD139 ∆(ara, leu)7697 galU galK λ? rpsL nupG pir+(DHFR)</td><td align="center" valign="middle" >Epicentre</td></tr><tr><td align="center" valign="middle" >DH5α</td><td align="center" valign="middle" >supE44 ΔlacU169 (Φ80 lacZΔM15) hsdR17 recA1 endA1 gyrA96 thi-1 relA1</td><td align="center" valign="middle" >Tiangen</td></tr><tr><td align="center" valign="middle" >Pseudomonas fluorescens</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >MS82</td><td align="center" valign="middle" >Wild-type strain</td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >MS82MT19</td><td align="center" valign="middle" >GGDEF/EAL::Tn5 derivative of MS82; Km<sup>r</sup></td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >MS82SD19</td><td align="center" valign="middle" >GGDEF/EAL::nptII derivative of MS82; Km<sup>r</sup></td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >Pf0-1</td><td align="center" valign="middle" >Wild-type strain</td><td align="center" valign="middle" >Newell et al. [<xref ref-type="bibr" rid="scirp.75402-ref17">17</xref>]</td></tr><tr><td align="center" valign="middle" >Plasmid</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >pUCP26</td><td align="center" valign="middle" >Expression vector for Pseudomonas; Tc<sup>r</sup></td><td align="center" valign="middle" >West et al. [<xref ref-type="bibr" rid="scirp.75402-ref18">18</xref>]</td></tr><tr><td align="center" valign="middle" >pBR325</td><td align="center" valign="middle" >Cloning vector; Cm<sup>r</sup>, Tc<sup>r</sup>, Ap<sup>r</sup></td><td align="center" valign="middle" >Prentki et al. [<xref ref-type="bibr" rid="scirp.75402-ref19">19</xref>]</td></tr><tr><td align="center" valign="middle" >pBSL15</td><td align="center" valign="middle" >Kanamycin resistance gene cassette; Km<sup>r</sup></td><td align="center" valign="middle" >Alexeyev [<xref ref-type="bibr" rid="scirp.75402-ref20">20</xref>]</td></tr><tr><td align="center" valign="middle" >pGEM-T Easy</td><td align="center" valign="middle" >Cloning vector; Ap<sup>r</sup></td><td align="center" valign="middle" >Promega</td></tr><tr><td align="center" valign="middle" >pMT19E1</td><td align="center" valign="middle" >EZ-Tn5 carrying genomic DNA of MS82MT19 (digested by Pst I)); Km<sup>r</sup>; 15 kb</td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >pMT19E2</td><td align="center" valign="middle" >EZ-Tn5 carrying genomic DNA of MS82MT19 (digested by Xba I); Km<sup>r</sup>; 24 kb</td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >pUCP19</td><td align="center" valign="middle" >pUCP26 carrying the sensory box GGDEF/EAL domain gene, Tc<sup>r</sup></td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >pMS1</td><td align="center" valign="middle" >pGEM-T Easy carrying 1-kb PCR product containing the SmaI site of the sensory box GGDEF/EAL domain gene; Ap<sup>r</sup></td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >pMS2</td><td align="center" valign="middle" >pBR325 carrying 1-kb PCR product containing the SmaI site of the sensory box GGDEF/EAL domain gene; Tc<sup>r</sup></td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >pMS3</td><td align="center" valign="middle" >the nptII gene inserted into pMS2; Km<sup>r</sup>, Ap<sup>r</sup></td><td align="center" valign="middle" >This study</td></tr></tbody></table></table-wrap><p>Km<sup>r</sup>, kanamycin resistance; Tc<sup>r</sup>, tetracycline resistance; Ap<sup>r</sup>, ampicillin resistance; Cm<sup>r</sup>, chloramphenicol resistance.</p><p>Foil Plant Science Research Farm, Mississippi State University. Assessment of antifungal activity of P. fluorescens MS82 was conducted using plates of potato dextrose agar (PDA) (Difco, BD Biosciences, Detroit, MI). Strain MS82 was grown on Pseudomonas Agar F (MP Biomedicals, Aurora, OH) for detection of fluorescence. Strain MS82 grew at 28˚C on nutrient broth-yeast extract medium (NBY) [<xref ref-type="bibr" rid="scirp.75402-ref21">21</xref>] with kanamycin (50 μg・mL<sup>−1</sup>) and tetracycline (25 μg・mL<sup>−1</sup>).</p></sec><sec id="s2_2"><title>2.2. Multilocus Sequence Typing Analysis</title><p>Bacterial genomic DNA was extracted using the Wizard&#174; Genomic DNA Purification Kit (Promega Corporation. Madison, WI). Multilocus sequence typing (MLST) analysis was conducted as described by Jolley [<xref ref-type="bibr" rid="scirp.75402-ref22">22</xref>] . The seven housekeeping genes (glnS, gyrB, ileS, nuoD, recA, rpoB and rpoD) were amplified from the DNA of strain MS82 using the primers listed in the website http://pubmlst.org/pfluorescens (<xref ref-type="table" rid="table2">Table 2</xref>). The cycling program included a 2</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Primers used in MLST</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer</th><th align="center" valign="middle" >Sequence (5’to3’)</th><th align="center" valign="middle" >Gene Product</th><th align="center" valign="middle" >Product length (bp)</th></tr></thead><tr><td align="center" valign="middle" >glnS_F</td><td align="center" valign="middle" >ACCAACCCGGCCAAGAAGACCAGG</td><td align="center" valign="middle"  rowspan="2"  >glutaminyl-tRNA synthetase</td><td align="center" valign="middle"  rowspan="2"  >501</td></tr><tr><td align="center" valign="middle" >glnS_R</td><td align="center" valign="middle" >TGCTTGAGCTTGCGCTTG</td></tr><tr><td align="center" valign="middle" >gyrB_F</td><td align="center" valign="middle" >GGTGGTCGATAACTCCATCG</td><td align="center" valign="middle"  rowspan="2"  >DNA gyrase subunit B</td><td align="center" valign="middle"  rowspan="2"  >501</td></tr><tr><td align="center" valign="middle" >gyrB_R</td><td align="center" valign="middle" >CGCTGAGGAATGTTGTTGGT</td></tr><tr><td align="center" valign="middle" >ileS_F</td><td align="center" valign="middle" >TTCCCAATGAARGCCGGCCTGCC</td><td align="center" valign="middle"  rowspan="2"  >isoleucyl-tRNA synthetase</td><td align="center" valign="middle"  rowspan="2"  >501</td></tr><tr><td align="center" valign="middle" >ileS_R</td><td align="center" valign="middle" >GGGGTGGTGGTCCAGATCACG</td></tr><tr><td align="center" valign="middle" >nuoD_F</td><td align="center" valign="middle" >GAAGTCCTGACCTTCCTGC</td><td align="center" valign="middle"  rowspan="2"  >NADH dehydrogenase subunit D</td><td align="center" valign="middle"  rowspan="2"  >516</td></tr><tr><td align="center" valign="middle" >nuoD_R</td><td align="center" valign="middle" >GAAGAACTCGGCCATCATG</td></tr><tr><td align="center" valign="middle" >recA_F</td><td align="center" valign="middle" >TGGCTGCGGCCCTGGGTCAGATC</td><td align="center" valign="middle"  rowspan="2"  >recombinase A</td><td align="center" valign="middle"  rowspan="2"  >600</td></tr><tr><td align="center" valign="middle" >recA_R</td><td align="center" valign="middle" >ACCAGGCAGTTGGCGTTCTTGAT</td></tr><tr><td align="center" valign="middle" >rpoB_F</td><td align="center" valign="middle" >TGGCCGGTCGTCACGGTAACA</td><td align="center" valign="middle"  rowspan="2"  >DNA-directed RNA polymerase subunit beta</td><td align="center" valign="middle"  rowspan="2"  >477</td></tr><tr><td align="center" valign="middle" >rpoB_R</td><td align="center" valign="middle" >CCGAAACGCTGACCACCGAAC</td></tr><tr><td align="center" valign="middle" >rpoD_F</td><td align="center" valign="middle" >CTGATCCAGGAAGGCAACATCGG</td><td align="center" valign="middle"  rowspan="2"  >DNA-directed RNA polymerase subunit beta</td><td align="center" valign="middle"  rowspan="2"  >477</td></tr><tr><td align="center" valign="middle" >rpoD_R</td><td align="center" valign="middle" >ACTCGTCGAGGAAGGAGCG</td></tr></tbody></table></table-wrap><p>min initial denaturation step at 95˚C, followed by 30 cycles of 95˚C for 1 min, 56˚C for 30 s, 72˚C for 1 min, and final elongation at 72˚C for 10 min. Sequencing reads were assembled using the Lasergene version software package (DNAStar, Inc. Madison, WI). A phylogenetic tree based on the concatenated sequences (3,453 bp) of seven housekeeping gene fragments [glnS (501 bp), gyrB (492 bp), ileS (552 bp), nuoD (516 bp), recA (435 bp), rpoB (477 bp) and rpoD (480 bp)] of MS82 was produced using MEGA6 software.</p></sec><sec id="s2_3"><title>2.3. Bioassays for Antifungal Activity</title><p>The antifungal activities of Pseudomonas fluorescens MS82 and its mutants in this study were analyzed using PDA plate bioassays as described previously [<xref ref-type="bibr" rid="scirp.75402-ref23">23</xref>] . Briefly, strain MS82 was grown overnight in NBY liquid medium, after which bacterial cells were collected by centrifugation and washed once with sterile distilled water. The cells were suspended in sterile distilled water to an optical density of 0.3 at 420 nm wavelength (approximately 2 &#215; 10<sup>8</sup> CFU/mL), a drop of bacterial suspension (5 μL) was spotted on the center of each PDA plate, and plates were incubated 3 d at 28˚C. Each plate was then oversprayed with a standardized (OD<sub>420</sub> = 0.3) conidial suspension of one of the three fungal indicator species: M. perniciosa JS01 (collection of Jindi Song), Trichoderma viride TX12 (Collection of Shien Lu) and G. candidum F-260 (a gift of Dennis Gross). The oversprayed plates were further incubated in the dark at 28˚C for 2 d. To evaluate the antifungal activity of MS82 against the mushroom fungus A. bisporus (Strain MS46, isolated from fresh mushroom), two PDA discs (5 mm in diameter) containing the mycelium of A. bisporus were placed 4 cm apart onto each of 9-cm PDA plates. A 5-μL aliquot of bacterial cell suspension (OD<sub>420</sub> = 0.3) was immediately spotted onto the same plate equidistant from the edge of each fungal disc. The inoculated plates were incubated in the dark for three weeks at 25˚C. The inhibitory zones of MS82 and its mutants against the indicator fungi were recorded and compared with each other. Three replicates of the plate bioassays were performed independently.</p></sec><sec id="s2_4"><title>2.4. Random Mutagenesis Analysis</title><p>In order to find the genes associated with antifungal activity, EZ-Tn5 Tnp Transposome Kit (Epicentre Biotechnologies, Madison, WI) was used as described by the manufacturer to randomly mutate strain MS82. Strain MS82 was grown in LB broth with shaking (220 rpm) at 28˚C until early log phase (OD <sub>600</sub> = 0.8 - 1.0). The cells were harvested by centrifugation at 5000 rpm for 6 min at 4˚C, washed twice with the same volume and once with 0.5 volume of 300 mM sucrose, re-centrifuged, and finally re-suspended in 0.01 volumes of 300 mM sucrose [<xref ref-type="bibr" rid="scirp.75402-ref24">24</xref>] . Before electroporation, the bacterial suspension was chilled on ice for 30 min. Aliquots of 80-μL cell suspension were mixed with one μL of EZ-Tn5 &lt; R6Kγori/KAN-2 &gt; Tnp Transposome and transferred to chilled 0.1 cm gap cuvettes. Electroporation was conducted using a Gene Pulser II (Bio-Rad Laboratories, Hercules, CA) with the settings of 25 μFD, 200 Ω and 1.8 kV. Immediately after electroporation, the cells were transferred into 3 ml LB broth and shaken (220 rpm) at 28˚C for 2h. The colonies growing on NBY plates supplemented with 50 μg・mL <sup>−1</sup> kanamycin were picked up as potential mutants for antifungal plate bioassays. The mutant MS82MT19 that had no visible antifungal activity against M. perniciosa was cultured on NBY plates with 50 μg・mL <sup>−1</sup> kanamycin for further study. The Tn5 transposon fragment was amplified by PCR with the primers EzTn5F (5’-TTA CGA AAC ACG GAA ACC-3’) and EzTn5R (5’-TCT AAT ACC TGG AAT GCT GTT-3’), provided by the EZ-Tn5 Tnp Transposome Kit manufacturer, to confirm the presence of the transposon in the mutant.</p></sec><sec id="s2_5"><title>2.5. DNA Cloning and Sequence Analysis of the Targeted Genes</title><p>Bacterial genomic DNA of mutant MS82MT19 was extracted as described above. The bacterial genomic DNA was digested by restriction enzymes Pst I and Xba I, self-ligated, and then transformed into electrocompetent E. coli strain TransforMax EC100D pir<sup>+</sup> (Epicentre Biotechnologies, Madison, WI) as instructed by the kit to generate plasmids pMT19E1 and pMT19E2 (<xref ref-type="table" rid="table1">Table 1</xref>). Sequencing reactions were performed using the primers KAN-2FP-1 and KAN-2RP-1 supplied in the transposon kit to the flanking genomic DNA fragments of the Tn5 transposon in mutant MS82MT19.</p><p>The entire gene (i.e., the PafR gene) targeted by transposon in mutant MS82MT19 was sequenced by the Sanger primer walking method [<xref ref-type="bibr" rid="scirp.75402-ref25">25</xref>] . In brief, five pairs of primers were designed and used to sequence the DNA flanking the Tn5 transposon in the plasmid pMT19E2. A consensus sequence of the entire gene region was generated using the Lasergene package. The gene functions were predicted through BLAST analysis against the GenBank database. The web-based software BPROM in the Softberry package was used for promoter prediction [<xref ref-type="bibr" rid="scirp.75402-ref26">26</xref>] .</p></sec><sec id="s2_6"><title>2.6. Site-Directed Mutagenesis of the PafR Gene Targeted in Mutant MS82MT19 and Plasmid Construction for Complementation Assays</title><p>Efforts to complement the mutant MS82MT19 with a full-length targeted gene in trans were made through introduction of the plasmid pUCP26 harboring the full-length gene [<xref ref-type="bibr" rid="scirp.75402-ref18">18</xref>] . However, the antifungal activity of the mutant could not be restored to the wild type level at all. Therefore, we used insertion of the nptII gene into the PafR gene to generate a nonpolar site-directed mutation. A 1kb fragment containing the SmaI site of the PafR gene of the wild-type strain MS82, for which PCR primers containing restriction sites of AatII and PstI were designed (FP-AatII-1: 5’-GAC AGA CGT CTA CCG AGG TCA ACC AGG TTG-3’; RP-PstI-1: 5’-CGA ACT GCA GCG AGG TCG AGT GCT CGA AAA C-3’), was cloned into the pGEM-T Easy vector to produce the plasmid pMS1. The 1 kb fragment was digested by AatII and PstI and then subcloned into pBR325 [<xref ref-type="bibr" rid="scirp.75402-ref19">19</xref>] , generating plasmid pMS2 containing tetracycline resistance. A 1.1-kb SmaI fragment of plasmid pBSL15 [<xref ref-type="bibr" rid="scirp.75402-ref20">20</xref>] , which carries the nptII gene without a transcriptional terminator, was inserted into pMS2 at the SmaI site to generate plasmid pMS3 containing kanamycin and tetracycline resistance. Plasmid pMS3 was electroporated into strain MS82 for marker exchange mutagenesis as previously described [<xref ref-type="bibr" rid="scirp.75402-ref27">27</xref>] , resulting in the generation of the mutant MS82SD19 which has resistance to kanamycin but sensitive to tetracycline. PCR was used to verify the double-crossover marker exchange in the mutant MS82SD19. The antifungal activity of the mutant MS82SD19 against M. perniciosa was evaluated with plate bioassays as described above.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Multilocus Sequence Typing Analysis of the Strain MS82</title><p>Seven housekeeping gene fragments (glnS, gyrB, ileS, nuoD, recA, rpoB and rpoD) were obtained by PCR amplification. These DNA sequences were uploaded into GenBank with the accession numbers: KU510319 (glnS), KU382113 (gyrB), KU510314 (ileS), KU510315 (nuoD), KU510316 (recA), KU510317 (rpoB) and KU510318 (rpoD). The concatenated sequence (3453 bp) of the seven gene fragments [glnS (501 bp), gyrB (492 bp), ileS (552 bp), nuoD (516 bp), recA (435 bp), rpoB (477 bp) and rpoD (480 bp)] was generated in silico. A phylogenetic tree based on the concatenated sequences of MS82 was constructed using MEGA6 (<xref ref-type="fig" rid="fig1">Figure 1</xref>). Strain MS82 was tightly clustered with the P. fluorescens strain Pf0-1 with the bootstrap value of 100%. These data suggest that strain MS82 belongs to the bacterial species P. fluorescens.</p></sec><sec id="s3_2"><title>3.2. Antifungal Activity of Strain MS82</title><p>Strain MS82 suppressed the mycelial growth of the fungal pathogen M. perniciosa with an inhibition zone of 34.17 &#177; 0.44 mm in the plate bioassay (<xref ref-type="fig" rid="fig2">Figure 2</xref>(B)). Strain MS82 also inhibited the growth of T. viride, and G. candidum (<xref ref-type="fig" rid="fig3">Figure 3</xref>). Interestingly, strain MS82 did not affect the mycelial growth of the mushroom fungus A. bisporus (<xref ref-type="fig" rid="fig2">Figure 2</xref>(A)). The antifungal activities of strain Pf0-1, the closest strain to MS82 based on phylogenetic analyses, were tested using the same methods as MS82. The results showed that strain Pf0-1 did not inhibit the growth of M. perniciosa, T. viride, or G. candidum (<xref ref-type="fig" rid="fig3">Figure 3</xref>). These results suggest that strain MS82 has an antifungal spectrum different from P. fluorescens strain Pf-01 and that its ability to inhibit a variety of fungi may be exploited for biocontrol and development of antibiotics for use in mushroom production.</p></sec><sec id="s3_3"><title>3.3. Identification of the Mutant MS82MT19</title><p>Strain MS82MT19 was obtained from random mutagenesis that completely lost the antifungal activity and was chosen for further genetic analyses (<xref ref-type="fig" rid="fig2">Figure 2</xref>(C)). The 16S rRNA sequencing confirmed that t MS82MT19 was a mutant of strain MS82. Two plasmids, pMT19E1 and pMT19E2 (<xref ref-type="table" rid="table1">Table 1</xref>) carrying the re-</p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Phylogenetic tree of MS82 and related strains of Pseudomonas based on MLST analysis</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-2270922x2.png"/></fig><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Plate bioassays of antifungal activities of P. fluorescens MS82 and its mutants against the fungal indictors M. perniciosa and A. bisporus. (A) The wild type strain MS82 (5 μl containing 1 &#215; 10<sup>6</sup> cells) was inoculated onto the potato dextrose agar (PDA) plate simultaneously with A. bisporus (two 5 mm PDA discs with mycelia), then incubated in the dark for 3 weeks at 25˚C. (B)-(D) The wild type strain MS82 (B); MS82MT19 (C); and MS82SD19 (D) were each inoculated (5 μl l containing 1 &#215; 10<sup>6</sup> cells) onto PDA plates and incubated in the dark for 3 d at 28˚C and then M. perniciosa was oversprayed on the plates. The oversprayed plates were further incubated in the dark at 28˚C for 2 d</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-2270922x3.png"/></fig><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Plate bioassays for antifungal activities of P. fluorescens strains MS82 and Pf0-1. One droplet of bacterial suspension (5 &#181;l containing ~10<sup>6</sup> cells) was inoculated onto each potato dextrose agar plate. Plates (A) (B) and (C) were inoculated with MS82; plates (D) (E) and (F) were inoculated with Pf0-1. The plates were incubated in the dark for 2 d at 28˚C before being oversprayed with spore suspension of M. perniciosa (A) (D); T. viride (B) (E) or G. candidum (C) (F); then incubated another 3 d in the dark at 28˚C</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-2270922x4.png"/></fig><p>gions flanking the EZ-Tn5 transposon insertion, were produced from MS82MT19 genomic DNA using the plasmid rescue method. The plasmids were digested by Pst I and Xba I, demonstrating that they carried different lengths of genomic DNA insertions that include the Tn5 transposon. Preliminary BLAST analyses of the flanking regions of the transposon in the two plasmids revealed that the Tn5 transposon carried by the mutant MS82MT19 was inserted into a gene that has a high identity (~98%) at nucleotide level to the putative gene Pfl01_4876 that was predicted to code for a sensory box GGDEF/EAL domain protein of P. fluorescens Pf0-1 (GenBank Accession No. CP000094.2).</p></sec><sec id="s3_4"><title>3.4. Sequence Analysis of the Targeted Gene in Mutant MS82MT19</title><p>Sequence analysis showed that the putative proteins encoded by the gene disrupted by the transposon in MS82MT19 shares high identities (99-100%) with sensory box GGDEF/EAL domain proteins of Pseudomonas. A 4.5kb flanking DNA region of the transposon, which was inserted in the genome of the mutant MS82MT19, was sequenced from the plasmids pMTE1 and pMTE2 (<xref ref-type="table" rid="table1">Table 1</xref>) by using primer walking and Sanger DNA sequencing. Further analysis revealed that only one open-reading frame of 3849 nt encoding the sensory box GGDEF/ EAL domain protein is disrupted by the transposon in MS82MT19. This gene was named as the PafR gene (Pseudomonas antifungal regulatory gene) and its sequence was deposited into GenBank with the accession number KU510320. The promoter region (−35 box: ATGCTA and −10 box: GCTTATAGT) was identified 38 nucleotides upstream of the putative start codon of the predicted protein PafR. A typical sequence-dependent terminator was not found from the untranslational 3’ end of the gene. The BLAST results revealed that the putative protein of this gene shares 99% amino acid identity to the sensory box GGDEF/ EAL domain protein of P. fluorescens Pf0-1 (GenBank accession: ABA76613). In addition, the results showed that the transposon in the MS82MT19 genome was inserted between the nucleotides 1393 and 1394 of the sensory box GGDEF/ EAL domain gene.</p></sec><sec id="s3_5"><title>3.5. Characterization of the Role of the Sensory box GGDEF/EAL Domain Gene in Production of the Antifungal Product</title><p>The role of sensory box GGDEF/EAL domain PafR gene targeted in MS82MT19 in production of antifungal activity was further determined using the site-directed mutagenesis. After 16S RNA DNA sequencing confirmed the identity of the mutant MS82SD19, the insertion of the terminitorless nptII cassette in the PafR gene was determined by PCR analysis with the primers FP-AatII-1 and RP-PstI-1. As expected, the PCR products were 1.1 kb in size from genomic DNA of the wild type strain MS82 and 2.2 kb containing the nptII cassette from both MS82SD19 genomic DNA and plasmid pMS3 (<xref ref-type="fig" rid="fig4">Figure 4</xref>), respectively. The</p><fig id="fig4"  position="float"><label><xref ref-type="fig" rid="fig4">Figure 4</xref></label><caption><title> PCR confirmation of site-directed insertional mutation in the mutant MS82SD19. The primers FP-AatII-1 and RP-PstI-1 were used to amplify the fragment of the PafR gene. Lane 1: PCR product of the partial PafR gene amplified from MS82 (1.1 kb); Lane 2: PCR product of the partial PafR gene amplified from plasmid pMS3 (2.2 kb); Lane 3: PCR product of the partial PafR gene amplified from mutant MS82SD19 (2.2 kb); Lane M: 1kb ladder</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-2270922x5.png"/></fig><p>plate bioassay results revealed that the mutant MS82SD19 containing nptII gene did not produce the antifungal activity against M. perniciosa (<xref ref-type="fig" rid="fig2">Figure 2</xref>(D)), which is the same as the phenotype of the mutant MS82MT19. Collectively, the destruction of the PafR gene of MS82 strain either by random mutagenesis or by site-directed insertional mutagenesis resulted in the loss of antifungal activity against M. perniciosa. These results demonstrate that the PafR gene is the key gene in the antifungal activity of MS82 production.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Pseudomonas strains can be isolated from various environmental niches such as soil and plant rhizospheres. P. fluorescens is a soil bacterium and many strains possess plant growth promoting functions [<xref ref-type="bibr" rid="scirp.75402-ref15">15</xref>] . The genome sequences of Pseudomonas strains SBW25, Pf0-1 and Pf-5 revealed considerable diversity and their genomic heterogeneity is reminiscent of a species complex [<xref ref-type="bibr" rid="scirp.75402-ref28">28</xref>] . Consequently, a few strains including Pf-5 were grouped as the new species P. protegens [<xref ref-type="bibr" rid="scirp.75402-ref29">29</xref>] . The strain MS82, isolated from soybean rhizosphere, exhibits fluorescence on Pseudomonas agar F plates under ultraviolet illumination. Phylogenetic analysis of MLST shows that MS82 is most close to P. fluorescens Pf0-1. Collectively the results of this study further confirmed that MS82 belongs to P. fluorescens. P. fluorescens not only has potential applications in biocontrol and bioremediation but also as a model for studying bacterial survival and fitness in soil [<xref ref-type="bibr" rid="scirp.75402-ref30">30</xref>] . Notably, bioassays for antifungal activity reveled that MS82 has a unique antifungal spectrum that is different from P. fluorescens Pf0-1. This is not surprising due to the considerable diversity and genomic heterogeneity in the species [<xref ref-type="bibr" rid="scirp.75402-ref29">29</xref>] , but it suggests that further study of the antifungal compounds produced by MS82 is needed.</p><p>The sensory box GGDEF/EAL domain is present in many organisms, including Vibrio, Pseudomonas, Staphylococcus, and is involved in regulation of cellular functions [<xref ref-type="bibr" rid="scirp.75402-ref31">31</xref>] [<xref ref-type="bibr" rid="scirp.75402-ref32">32</xref>] [<xref ref-type="bibr" rid="scirp.75402-ref33">33</xref>] . The proteins with GGDEF and EAL domains are c-di-GMP cyclases or phosphdiesterase, respectively [<xref ref-type="bibr" rid="scirp.75402-ref34">34</xref>] . At least one N terminal sensor domain such as GAF or PAS, which regulates activity by an irritant such as oxygen [<xref ref-type="bibr" rid="scirp.75402-ref35">35</xref>] , is frequently contained in the GGDEF/EAL domain proteins [<xref ref-type="bibr" rid="scirp.75402-ref36">36</xref>] . The pioneering work by Ross [<xref ref-type="bibr" rid="scirp.75402-ref37">37</xref>] showed the molecule c-di-GMP is an allosteric activator of cellulose synthase in Gluconacetobacter xylinus. Another study showed that c-di-GMP was associated with production of cellulose in Agrobacterium tumefaciens [<xref ref-type="bibr" rid="scirp.75402-ref38">38</xref>] . In other species, c-di-GMP levels affect transitions from sessile to moving cells and thereby play a role in the change between multicellular biofilm and planktonic motile cell status [<xref ref-type="bibr" rid="scirp.75402-ref34">34</xref>] . The biofilm formation is also initiated by production of some compounds having antifungal activity, such as xantholysins, which are produced by the rhizosphere isolate P. putida BW11M1 [<xref ref-type="bibr" rid="scirp.75402-ref39">39</xref>] . To the best of our knowledge, this is the first report of the association of a bacterial gene encoding sensory box GGDEF/EAL domain protein with production of antifungal activities. However, it remains to be determined how the PafR gene is involved molecularly in production of antifungal activity of strain MS82.</p><p>In this study, it was determined that the PafR gene of strain MS82 contains a GGDEF, an EAL and three PAS domains. Genetic analyses both random mutagenesis and site-directed insertional mutagenesis revealed the crucial role of the sensory box GGDEF/EAL-coding gene of MS82 in antifungal activity of that strain. Unexpectedly, we failed to restore the antifungal activity of the mutant MS82MT19 (PafR::miniTn5) by introduction of the full-length PafR gene and carried into the mutant by the Pseudomonas expression vector pUCP26 [<xref ref-type="bibr" rid="scirp.75402-ref17">17</xref>] . However, nonpolar mutation using the terminatorless nptII cassette [<xref ref-type="bibr" rid="scirp.75402-ref40">40</xref>] [<xref ref-type="bibr" rid="scirp.75402-ref41">41</xref>] verified the role of the PafR gene in production of antifungal activity. This indicates that the function of the PafR gene may also be affected by the other factors, such as expression level of the gene [<xref ref-type="bibr" rid="scirp.75402-ref42">42</xref>] [<xref ref-type="bibr" rid="scirp.75402-ref43">43</xref>] . Nevertheless, the results of this research indicate the PafR gene encoding the sensory box GGDEF/EAL domain plays an important role in antifungal activity and provides a crucial clue to understand molecular mechanisms of antifungal activity of MS82. Further work is under way to identify the genes required for production of the antifungal agents of MS82. The studies will provide useful clues for development of MS82 as a biological control agent to manage fungal diseases of mushroom cultivation.</p></sec><sec id="s5"><title>Acknowledgements</title><p>This research was supported in part by Natural Science Foundation of Jiangsu Province for Youth (BK20150547), China Agriculture Research System (CARS24) and the US Department of Agriculture, National Institute of Food and Agriculture (MIS-401170).</p></sec><sec id="s6"><title>Cite this paper</title><p>Ma, L., Wang, X.Q., Deng, P., Baird, S.M., Liu, Y.Z., Qu, S.X. and Lu, S.-E. (2017) The PafR Gene Is Required for Antifungal Activity of Strain MS82 against Mycogone perniciosa. Advances in Microbiology, 7, 217-230. https://doi.org/10.4236/aim.2017.74018</p></sec></body><back><ref-list><title>References</title><ref id="scirp.75402-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Mattila, P., Suonpaa, K. and Piironen, V. (2000) Functional Properties of Edible Mushrooms. Nutrition, 16, 694-696. https://doi.org/10.1016/s0899-9007(00)00341-5</mixed-citation></ref><ref id="scirp.75402-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Kouser, S., Ahmed, M. and Shah, S. (2013) Disease Status and Yield Losses Due to Wet Bubble Disease (Mycogone perniciosa) Associated with the Cultivation of White Button Mushroom at Different Mushroom Units of Kashmir Valley. The Plant Pathology Journal, 12, 104-109. https://doi.org/10.3923/ppj.2013.104.109</mixed-citation></ref><ref id="scirp.75402-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Zhao, X., Shi, Y., Xie, X. and Li, B. (2013) Screening and Evaluation of Induced Resistance to Brown Blotch Disease in Pleurotus spp. by Low Virulence and Avirulent Strains of Pseudomonas tolaasii. Acta Edulis Fungi, 20, 96-100.</mixed-citation></ref><ref id="scirp.75402-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Chang, S. (1999) World Production of Cultivated Edible and Medicinal Mushrooms in 1997 with Emphasis on Lentinus edodes (Berk.) Sing, in China. International Journal of Medicinal Mushrooms, 1, 291-300. 
https://doi.org/10.1615/intjmedmushr.v1.i4.10</mixed-citation></ref><ref id="scirp.75402-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Fletcher, J.T., Jaffe, B., Muthumeenakshi, S., Brown, A.E. and Wright, D.M. (1995) Variations in Isolates of Mycogone perniciosa and in Disease Symptoms in Agaricus bisporus. Plant Pathology, 44, 130-140. 
https://doi.org/10.1111/j.1365-3059.1995.tb02725.x</mixed-citation></ref><ref id="scirp.75402-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Fan, J., Zhang, H., Zhang, Z., Gong, P., He, W. and Zhu, Y. (2012) Integrated Control Technology of Mycogone perniciosa Magn. of Agaricus bisporus. Northern Horticulture, 6, 168-170.</mixed-citation></ref><ref id="scirp.75402-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Gea, F.J., Tello, J.C. and Navarro, M.J. (2010) Efficacy and Effects on Yield of Different Fungicides for Control of Wet Bubble Disease of Mushroom Caused by the mycoparasite Mycogone perniciosa. Crop Protection, 29, 1021-1025. 
https://doi.org/10.1016/j.cropro.2010.06.006</mixed-citation></ref><ref id="scirp.75402-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Regnier, T. and Combrinck, S. (2010) In vitro and in vivo Screening of Essential Oils for the Control of Wet Bubble Disease of Agaricus bisporus. South African Journal of Botany, 76, 681-685. https://doi.org/10.1016/j.sajb.2010.07.018</mixed-citation></ref><ref id="scirp.75402-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Cai, S., Wen, Z., Zhang, T., Wen, J. and Xie, B. (2009) Identification of a Bacterium Inhibiting the Mycelial Growth of Mycogone perniciosa. Acta Edulis Fungi, 16, 92-94.</mixed-citation></ref><ref id="scirp.75402-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Yang, M.M., Mavrodi, D.V., Mavrodi, O.V., Bonsall, R.F., Parejko, J.A., Paulitz T. C., Thomashow, L.S., Yang, H.T., Weller, D.M. and Guo, J.H. (2011) Biological Control of Take-All by Fluorescent Pseudomonas spp. from Chinese Wheat Fields. Phytopathology, 101, 1481-1491. https://doi.org/10.1094/phyto-04-11-0096</mixed-citation></ref><ref id="scirp.75402-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Manuel, J., Selin, C., Fernando, W.G. and De, K.T. (2012) Stringent Response Mutants of Pseudomonas chlororaphis PA23 Exhibit Enhanced Antifungal Activity against Sclerotinia sclerotiorum in Vitro. Microbiology, 158, 207-216.  
https://doi.org/10.1099/mic.0.053082-0</mixed-citation></ref><ref id="scirp.75402-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Rella, A., Yang, M.W., Gruber, J. and Montagna, M.T. (2012) Pseudomonas aeruginosa Inhibits the Growth of Cryptococcus Species. Mycopathologia, 173, 451-461.  
https://doi.org/10.1007/s11046-011-9494-7</mixed-citation></ref><ref id="scirp.75402-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Xu, J., Deng, P., Showmaker, K.C., Wang, H., Baird, S. and Lu, S. (2014) The pqqC Gene Is Essential for Antifungal Activity of Pseudomonas kilonensis JX22 against Fusarium oxysporum f. sp. Lycopersici. FEMS Microbiology Letters, 353, 98-105.  
https://doi.org/10.1111/1574-6968.12411</mixed-citation></ref><ref id="scirp.75402-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Kilani-Feki, O., Khiari, O., Culioli, G., Ortalo-Magné, A., Zouari, N., Blache, Y. and Jaoua, S. (2010) Antifungal Activities of an Endophytic Pseudomonas fluorescens Strain Pf1TZ Harbouring Genes from Pyoluteorin and Phenazine Clusters. Biotechnology Letters, 32, 1279-1285. https://doi.org/10.1007/s10529-010-0286-9</mixed-citation></ref><ref id="scirp.75402-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Haas, D. and Keel, C. (2003) Regulation of Antibiotic Production in Root-Colonizing Pseudomonas spp. and Relevance for Biological Control of Plant Disease. Annual Review of Phytopathology, 41, 117-153.  
https://doi.org/10.1146/annurev.phyto.41.052002.095656</mixed-citation></ref><ref id="scirp.75402-ref16"><label>16</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Ma</surname><given-names> L.</given-names></name>,<name name-style="western"><surname> Qu</surname><given-names> S.</given-names></name>,<name name-style="western"><surname> Wang</surname><given-names> X.</given-names></name>,<name name-style="western"><surname> Deng P.</surname><given-names> Lin</given-names></name>,<name name-style="western"><surname> J.</surname><given-names> Li</given-names></name>,<name name-style="western"><surname> H.</surname><given-names> Hou</given-names></name>,<name name-style="western"><surname> L.</surname><given-names> Jiang</given-names></name>,<name name-style="western"><surname> N.</surname><given-names> Song</given-names></name>,<name name-style="western"><surname> J. and Lu</surname><given-names> S. </given-names></name>,<etal>et al</etal>. (<year>2016</year>)<article-title>Identification of an Antifungal Bacterium against Mushroom Pathogen Trichoderma viride and Characterization of Genes Associated with Antifungal Activity</article-title><source> Jiangsu Journal of Agricultural Sciences</source><volume> 32</volume>,<fpage> 528</fpage>-<lpage>533</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.75402-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Newell, P.D., Yoshioka, S., Hvorecny, K.L., Monds, R.D. and O’Toole, G.A. (2011) Systematic Analysis of Diguanylate Cyclases That Promote Biofilm Formation by Pseudomonas fluorescens Pf 0-1. Journal of Bacteriology, 193, 4685-4698.  
https://doi.org/10.1128/JB.05483-11</mixed-citation></ref><ref id="scirp.75402-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">West, S.E., Schweizer, H.P., Dall, C., Sample, A.K. and Runyenjanecky, L.J. (1994) Construction of Improved Escherichia-Pseudomonas Shuttle Vectors Derived from pUC18/19 and Sequence of the Region Required for Their Replication in Pseudomonas aeruginosa. Gene, 148, 81-86.</mixed-citation></ref><ref id="scirp.75402-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Prentki, P., Karch, F., Iida, S. and Meyer, J. (1981) The Plasmid Cloning Vector pBR325 Contains a 482 Base-Pair-Long Inverted Duplication. Gene, 14, 289-299.</mixed-citation></ref><ref id="scirp.75402-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Alexeyev, M.F. (1995) Three Kanamycin Resistance Gene Cassettes with Different Polylinkers. BioTechniques, 18, 52, 54, 56.</mixed-citation></ref><ref id="scirp.75402-ref21"><label>21</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Vidaver</surname><given-names> A.K. </given-names></name>,<etal>et al</etal>. (<year>1967</year>)<article-title>Synthetic and Complex Media for the Rapid Detection of Phytopathogenic Pseudomonads: Effect of the Carbon Source</article-title><source> Journal of Applied Microbiology</source><volume> 15</volume>,<fpage> 1523</fpage>-<lpage>1524</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.75402-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Jolley, K.A. and Maiden, M.C. (2010) BIGSdb: Scalable Analysis of Bacterial Genome Variation at the Population Level. BMC Bioinformatics, 11, 595.  
https://doi.org/10.1186/1471-2105-11-595</mixed-citation></ref><ref id="scirp.75402-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Gu, G., Smith, L., Liu, A. and Lu, S. (2011) Genetic and Biochemical Map for the Biosynthesis of Occidiofungin, an Antifungal Produced by Burkholderia contaminans Strain MS14. Applied and Environmental Microbiology, 77, 6189-6198.  
https://doi.org/10.1128/AEM.00377-11</mixed-citation></ref><ref id="scirp.75402-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Choi, K.H., Kumar, A. and Schweizer, H.P. (2006) A 10-min Method for Preparation of Highly Electrocompetent Pseudomonas aeruginosa Cells: Application for DNA Fragment Transfer between Chromosomes and Plasmid Transformation. Journal of Microbiological Methods, 64, 391-397.</mixed-citation></ref><ref id="scirp.75402-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Jacobs, M.A., Alwood, A., Thaipisuttikul, I., Spencer, D., Haugen, E., Ernst, S., Will, O., Kaul, R., Raymond, C., Levy, R., Liu, C.R., Guenthner, D., Bovee, D., Olson, M.V. and Manoil, C. (2003) Comprehensive Transposon Mutant Library of Pseudomonas aeruginosa. PNAS, 100, 14339-14344.  
https://doi.org/10.1073/pnas.2036282100</mixed-citation></ref><ref id="scirp.75402-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Solovyev, V., Kosarev, P., Seledsov, I. and Vorobyev, D. (2006) Automatic Annotation of Eukaryotic Genes, Pseudogenes and Promoters. Genome Biology, 7, S10, S11-S12.</mixed-citation></ref><ref id="scirp.75402-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Lu, S.E., Scholz-Schroeder, B.K. and Gross, D.C. (2002) Characterization of the sala, syrF and syrG Regulatory Genes Located at the Right Border of the Syringomycin Gene Cluster of Pseudomonas syringae pv. syringae. Molecular Plant-Microbe Interactions, 15, 43-52. https://doi.org/10.1094/MPMI.2002.15.1.43</mixed-citation></ref><ref id="scirp.75402-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Silby, M.W., Cerde&amp;ntilde;o-Tárraga, A.M., Vernikos, G.S., Giddens, S.R., Jackson, R.W., Preston, G.M., Zhang, X., Moon, C.D., Gehrig, S.M., Godfrey, S.A.C., Knight, C.G., Malone, J.G., Robinson, Z., Spiers, A.J., Harris, S., Challis, G.L., Yaxley, A.M., Harris, D., Seeger, K., Murphy, L., Rutter, S., Squares, R., Quail, M.A., Saunders, E., Mavromatis, K., Brettin, T.S., Bentley, S.D., Hothersall, J., Stephens, E., Thomas, C.M., Parkhill, J., Levy, S.B., Rainey, P.B. and Thomson, N.R. (2009) Genomic and Genetic Analyses of Diversity and Plant Interactions of Pseudomonas fluorescens. Genome Biology, 10, R51.51-R51.16. https://doi.org/10.1186/gb-2009-10-5-r51</mixed-citation></ref><ref id="scirp.75402-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Ramette, A., Frapolli, M., Saux, F.L., Gruffaz, C., Meyer, J.M., Defago, G., Sutra, L. and Moenne-Loccoz, Y. (2011) Pseudomonas protegens sp. nov., Widespread Plant-Protecting Bacteria Producing the Biocontrol Compounds 2, 4-Diacetylphloroglucinol and Pyoluteorin. Systematic and Applied Microbiology, 34, 180-188.</mixed-citation></ref><ref id="scirp.75402-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Varivarn, K., Champa, L.A., Silby, M.W. and Robleto, E.A. (2013) Colonization Strategies of Pseudomonas fluorescens Pf0-1: Activation of Soil-Specific Genes Important for Diverse and Specific Environments. BMC Microbiology, 13, 92.  
https://doi.org/10.1186/1471-2180-13-92</mixed-citation></ref><ref id="scirp.75402-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Holland, L.M., O’Donnell, S.T., Ryjenkov, D.A., Gomelsky, L., Slater, S.R., Fey, P.D., Gomelsky, M. and O’Gara, J.P. (2010) A Staphylococcal GGDEF Domain Protein Regulates Biofilm Formation Independently of Cyclic Dimeric GMP. Journal of Bacteriology, 190, 5178-5189. https://doi.org/10.1128/JB.00375-08</mixed-citation></ref><ref id="scirp.75402-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Newell, P.D., Monds, R.D. and O’Toole, G.A. (2009) LapD Is a bis-(3’,5’)-cyclic Dimeric GMP-Binding Protein That Regulates Surface Attachment by Pseudomonas fluorescens Pf0-1. PNAS, 106, 3461-3466.  
https://doi.org/10.1073/pnas.0808933106</mixed-citation></ref><ref id="scirp.75402-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Beyhan, S., Odell, L.S. and Yildiz, F.H. (2008) Identification and Characterization of Cyclic Diguanylate Signaling Systems Controlling Rugosity in Vibrio cholerae. Journal of Bacteriology, 190, 7392-7405. https://doi.org/10.1128/JB.00564-08</mixed-citation></ref><ref id="scirp.75402-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Simm, R., Morr, M., Kader, A., Nimtz, M. and Romling, U. (2004) GGDEF and EAL Domains Inversely Regulate Cyclic di-GMP Levels and Transition from Sessility to Motility. Molecular Microbiology, 53, 1123-1134.  
https://doi.org/10.1111/j.1365-2958.2004.04206.x</mixed-citation></ref><ref id="scirp.75402-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Chang, A.L., Tuckerman, J.R., Gonzalez, G., Mayer, R., Weinhouse, H., Volman, G., Amikam, D., Benziman, M. and Gilles-Gonzalez, M.A. (2001) Phosphodiesterase A1, a Regulator of Cellulose Synthesis in Acetobacter xylinum, Is a Heme-Based Sensor. Biochemistry 40, 3420-3426. https://doi.org/10.1021/bi0100236</mixed-citation></ref><ref id="scirp.75402-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Galperin, M.Y., Nikolskaya, A.N. and Koonin, E.V. (2001) Novel Domains of the Prokaryotic Two-Component Signal Transduction Systems. FEMS Microbiology Letters, 203, 11-21. https://doi.org/10.1111/j.1574-6968.2001.tb10814.x</mixed-citation></ref><ref id="scirp.75402-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Ross, P., Weinhouse, H., Aloni, Y., Michaeli, D., Weinberger-ohana, P., Mayer, R., Braun, S., De Vroom, E., Van Der Marel, G.A., Van Boom, J.H. and Benziman, M. (1987) Regulation of Cellulose Synthesis in Acetobacter xylinum by Cyclic Diguanylic Acid. Nature, 325, 279-281. https://doi.org/10.1038/325279a0</mixed-citation></ref><ref id="scirp.75402-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Amikam, D. and Benziman, M. (1989) Cyclic Diguanylic Acid and Cellulose Synthesis in Agrobacterium tumefaciens. Journal of Bacteriology, 171, 6649-6655.  
https://doi.org/10.1128/jb.171.12.6649-6655.1989</mixed-citation></ref><ref id="scirp.75402-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Li, W., Rokni-Zadeh, H., De Vleeschouwer, M., Ghequire, M.G., Sinneve, D., Xie, G., Rozenski, J., Madder, A., Martins, J.C. and De Mot, R. (2013) The Antimicrobial Compound Xantholysin Defines a New Group of Pseudomonas Cyclic Lipopeptides. PloS ONE, 8, e62946. https://doi.org/10.1371/journal.pone.0062946</mixed-citation></ref><ref id="scirp.75402-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Engl, C., Waite, C.J., McKenna, J.F., Bennett, M.H., Hamann, T. and Buck, M. (2014) Chp8, a Diguanylate Cyclase from Pseudomonas syringae pv. tomato DC3000, Suppresses the Pathogen-Associated Molecular Pattern Flagellin, Increases Extracellular Polysaccharides and Promotes Plant Immune Evasion. MBio, 5, e01168-14. https://doi.org/10.1128/mBio.01168-14</mixed-citation></ref><ref id="scirp.75402-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Chen, K.C., Ravichandran, A., Guerrero, A., Deng, P., Baird S., Smith, L. and Lu, S. (2013) The Burkholderia contaminans MS14 ocfC Gene Encodes a Xylosyltransferase for Production of the Antifungal Occidiofungin. Applied and Environmental Microbiology, 79, 2899-2905. https://doi.org/10.1128/AEM.00263-13</mixed-citation></ref><ref id="scirp.75402-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Luu, R.A., Schneider, B.J., Ho, C.C., Nesteryuk, V., Ngwesse, S.E., Liu, X., Parales, J.V., Ditty, J.L. and Parales, R.E. (2013) Taxis of Pseudomonas putida F1 toward Phenylacetic Acid Is Mediated by the Energy Taxis Receptor Aer2. Applied and Environmental Microbiology, 79, 2416-2423. https://doi.org/10.1128/AEM.03895-12</mixed-citation></ref><ref id="scirp.75402-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Horbal, L., Fedorenko, V., Bechthold, A. and Luzhetskyy, A. (2013) A Transposon-Based Strategy to Identify the Regulatory Gene Network Responsible for Landomycin E Biosynthesis. FEMS Microbiology Letters, 342, 138-146.  
https://doi.org/10.1111/1574-6968.12117</mixed-citation></ref></ref-list></back></article>