<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2017.72011</article-id><article-id pub-id-type="publisher-id">AiM-74197</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Inhibitory Activity of &lt;i&gt;Burkholderia&lt;/i&gt; sp. Isolated from Soil in Gotsu City, Shimane, against &lt;i&gt;Magnaporthe oryzae&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Daniel</surname><given-names>Lemtukei</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Tomoko</surname><given-names>Tamura</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Quyet</surname><given-names>Thi Nguyen</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Makoto</surname><given-names>Ueno</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Laboratory of Plant Pathology, Faculty of Life and Environmental Science, Shimane University, Matsue, Japan</addr-line></aff><pub-date pub-type="epub"><day>04</day><month>02</month><year>2017</year></pub-date><volume>07</volume><issue>02</issue><fpage>137</fpage><lpage>148</lpage><history><date date-type="received"><day>January</day>	<month>10,</month>	<year>2017</year></date><date date-type="rev-recd"><day>Accepted:</day>	<month>February</month>	<year>14,</year>	</date><date date-type="accepted"><day>February</day>	<month>17,</month>	<year>2017</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  An isolate GT4028 was obtained from soil samples collected from a field in Gotsu city (Kawahira), Shimane. The use of a culture suspension and culture filtrate of this isolate significantly suppressed the spore germination in 
  Magnaporthe oryzae. The inhibitory activity of the culture filtrate was heat-stable. The formation of rice blast lesions by 
  M. oryzae was significantly suppressed in the presence of the culture suspension of isolate GT4028. Furthermore, mycelial growth of some plant pathogenic fungi was inhibited by the isolate in a dual culture assay. Sequence analysis of 16S rDNA region of the isolate indicated that it shared similarities with species of the genus 
  Burkholderia. Also, isolate GT4028 could be grown even in the presence of fungicides (Blastin, Kasugamycin, and Amistar) that act against 
  M. oryzae. These results suggest that isolate GT4028 might be a potential control agent for plant protection against diseases, such as rice blast disease.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Magnaporthe oryzae&lt;/i&gt;</kwd><kwd> Rice Blast</kwd><kwd> &lt;i&gt;Burkholderia&lt;/i&gt; sp.</kwd><kwd> Culture Filtrate</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The ascomycete fungus, Magnaporthe oryzae, the causative agent of rice blast disease, is one of the most important plant pathogenic fungi and is considered a threat to food security globally. This disease is responsible for annual losses of 10% to 30% of the harvest and rice is vulnerable to it, wherever it is grown [<xref ref-type="bibr" rid="scirp.74197-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.74197-ref2">2</xref>] . Control strategies applied against rice blast disease mainly involve the use of chemical fungicides. However, the development of resistance to these chemicals has been reported in instances of extensive use. In fact, resistance against kasugamycin and organophosphorus thiolate fungicides were observed in the field where they were intensively used [<xref ref-type="bibr" rid="scirp.74197-ref3">3</xref>] . However, development of resistance to microbial fungicides has not been reported. The inhibitory activity of microorganisms is exerted either directly through antagonism to pathogen development, or indirectly by eliciting a plant-mediated resistance response. Mechanisms responsible for inhibitory activity include inhibition of pathogen growth, competition for colonization sites, nutrients, and minerals, parasitism, and mycophagy [<xref ref-type="bibr" rid="scirp.74197-ref4">4</xref>] . It is well known that microorganisms have different physiological characteristics and produce different compounds even among members in the same species. Therefore, it is necessary to examine a collection with wide biological diversity to find new inhibitory compounds and microorganisms for plant diseases control. Shimane prefecture is geographically elongated from east to west and it has various characteristic diversities of climate in each region. Consequently, soil of Shimane prefecture is expected to have diverse microbial resources. However, little has been reported on the microbial communities found in Shimane, or on their utility in pathogen control for rice blast disease. In a previous study, we indicated that microorganisms isolated from the soil of Gotsu city (Shimane prefecture) inhibited the mycelial growth of M. oryzae [<xref ref-type="bibr" rid="scirp.74197-ref5">5</xref>] . In this paper, we report that culture suspension and culture filtrate of the isolate GT4028 from soil of Gotsu city can protect rice from rice blast fungus, M. oryzae.</p></sec><sec id="s2"><title>2. Material and Methods</title><sec id="s2_1"><title>2.1. Bacteria, Fungus and Plant</title><p>The isolate GT4028 was obtained from soil samples collected from a field in Gotsu city (Kawahira), Shimane by the method described previously [<xref ref-type="bibr" rid="scirp.74197-ref5">5</xref>] . It was suspended in 15% - 20% glycerol solution and stored at −80˚C until use. A single colony of the isolate was grown on Luria-Bertani (LB) medium (10 g bactotryptone, 10 g NaCl, and 5 g yeast extract dissolved in a final volume of 1 L distilled water) and was used to individually inoculate test tubes containing 20 mL LB medium. The liquid cultures were incubated at 25˚C - 27˚C for 7 days with constant shaking on a rotary shaker (130 rpm).</p><p>M. oryzae (strain Naga 69 - 150, race 007) was grown on rice bran agar medium (50 g rice bran, 20 g sucrose, and 20 g agar dissolved in a final volume of 1 L distilled water) at 25˚C - 27˚C for 10 days, washed with running water to remove aerial hyphae, and kept at 25˚C under near-ultraviolet radiation (FL20s BL-B; Panasonic, Osaka, Japan) for 4 days to induce sporulation. BL-B lamps, which emit wavelengths of 320 - 420 nm (mainly 360 nm), were used as the source of near-ultraviolet radiation to induce sporulation.</p><p>Seedlings of Oryza sativa L. ‘Koshihikari’ were used in this study. Seeds were soaked in water for 4 days, and the germinating seeds were sown in plastic pots. Seedlings were grown to the three-leaf stage under glasshouse conditions.</p></sec><sec id="s2_2"><title>2.2. Inhibitory Activity of Culture and Culture Filtrate</title><p>M. oryzae spores (1 &#215; 10<sup>5</sup> spores/mL) suspended in the culture suspension or culture filtrate of GT4028 were dropped on glass slides and kept in a moist chamber at 25˚C - 27˚C. After 24-h incubation, the percentage of spore germination was determined by light microscopy. LB liquid medium was used as a control. Culture suspension of the isolate GT4028 was filtered through a 0.22-μm filter to obtain the culture filtrate.</p></sec><sec id="s2_3"><title>2.3. Heat Stability Test</title><p>To evaluate heat stability, the culture filtrate of GT4028 was heated at 121˚C for 20 min. The treated and untreated culture filtrates were inoculated with a spore suspension (1&#215; 10<sup>5</sup> spores/mL) of M. oryzae on glass slides and kept in a moist chamber at 25˚C - 27˚C. After 24-h incubation, the percentage of germinating spores was determined by light microscopy.</p></sec><sec id="s2_4"><title>2.4. Effect of Treatment with Culture Suspension on Development of Blast Lesion in Rice Leaves</title><p>The rice plant at three-leaf stage was sprayed with the culture suspension of isolate GT4028 (5 mL/pot). LB was sprayed as a control. The sprayed rice plants were maintained under natural conditions until the leaf dried, which were then inoculated with a spore suspension of M. oryzae (1 &#215; 10<sup>5</sup> spores/mL, 2 mL/pot). The inoculated rice plants were kept in a moist chamber covered with a black polythene bag for 24-h and then maintained under natural light conditions. The experiments were performed in duplicates and repeated three times. The blast lesions formed were counted 7 days after the inoculation.</p></sec><sec id="s2_5"><title>2.5. Fungicide Sensitivity Test</title><p>We determined the fungicide sensitivity of the isolate GT4028. Blastin (triazolobenzo-thiazole, Hokko Chemical Industry Co., LTD), Kasugamycin (hexopyranosyl antibiotic, Hokko Chemical Industry Co., LTD), and Amistar (azoxystrobin, Syngenta Japan K.K.) were used in this experiment. Each fungicide was diluted (1000-fold) in molten LB media and mixed thoroughly before dispensing to the respective, labeled 9-cm petri plates. The culture suspension of isolate GT4028 (50 μL) was spread on LB media in the presence of fungicides and then incubated at 25˚C - 27˚C. After 3 days, the growth of isolate GT4028 was observed. LB medium without fungicide addition was used as a control.</p></sec><sec id="s2_6"><title>2.6. DNA Extraction, PCR Amplification, Sequencing, and Generation of Phylogenetic Tree</title><p>To identify the isolate GT4028, the sequence of the 16S rDNA was determined by PCR using the primers mentioned in <xref ref-type="table" rid="table1">Table 1</xref> [<xref ref-type="bibr" rid="scirp.74197-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.74197-ref7">7</xref>] . The bacterial genomic DNA was extracted from the bacteria colony by the method described previously [<xref ref-type="bibr" rid="scirp.74197-ref8">8</xref>] , and was used as the PCR template. PCR amplification of the 16S rDNA region consisted of the following steps: an initial step of 30 s at 95˚C, followed by 30 cycles of denaturation at 95˚C for 30 s, annealing at 62˚C for 30 s, and elongation at 72˚C for 1.45 min, and a final extension step for 10 min at 72˚C. The</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> The sequence of primers used for the isolates’ sequence determination</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primers</th><th align="center" valign="middle" >Sequence (5’ → 3’)</th></tr></thead><tr><td align="center" valign="middle" >fD1 rP2 EUB906F EUB532R 1115R 802R 926F 785F 536R</td><td align="center" valign="middle" >AGAGTTTGATCCTGGCTCAG ACGGCTACCTTGTTACGACTT AAACTCAAAGGAATTGRCGG TTACCGCGGCKGCTGGCAC GTTGCTCGCGTTGGGA TACCAGGGTATCTAATCC AAACTCAAAGGAATTGACGG GGATTAGATACCCTGGTAGTC GTATTACCGCGGCTGCTG</td></tr></tbody></table></table-wrap><p>PCR-amplified fragments were purified by using HiYield Gel/PCR DNA fragment extraction kit (RBC Bioscience, Taipei, Taiwan). DNA sequencing was performed with a Big Dye Terminator Cycle Sequencing Kit (Applied Biosystems, Carlsbad, CA, USA). The DNA sequence analysis was performed on an ABI PRIZM 3130xl Genetic Analyzer (Applied Biosystems, Carlsbad, CA, USA). The sequence homology was determined by using the BLAST suite of programs (DNA Data Bank, Japan). The phylogenetic tree was constructed using the neighbor-joining method [<xref ref-type="bibr" rid="scirp.74197-ref9">9</xref>] .</p></sec><sec id="s2_7"><title>2.7. Thin Layer Chromatography (TLC)-Profile of the Culture Filtrate of GT4028</title><p>Fifty microliter of the culture filtrate (5-fold) of the isolate GT4028 was spotted onto silica gel TLC plates (Silica gel 60, Merck KGaA, Darmstadt, Germany) and then developed using ethyl acetate and toluene (1:1, v/v) solvent system. After the development, inhibitory compounds were detected on the TLC plates by a growth inhibition assay for M. oryzae spores. Briefly, the TLC plates were sprayed with a concentrated spore suspension of M. oryzae in the presence of potato sucrose agar (PSA). The inoculated plates were kept in a moist chamber at 25˚C - 27˚C for 7 days.</p></sec><sec id="s2_8"><title>2.8. Dual Culture Assay</title><p>The antagonistic potential of the isolate GT4028 against plant pathogenic fungus (Alternaria alternata Japanese pear pathotype, Corynespora cassiicola, Colletotrichum orbiculare, Fusarium oxysporum f. sp. spinaciae, and Cochliobolus miyabeanus) was investigated by a dual culture method using PSA. The plant pathogenic fungus was prepared as described by Nguyen et al. (2012) [<xref ref-type="bibr" rid="scirp.74197-ref10">10</xref>] . Mycelial plugs (6 mm) of plant pathogenic fungus and paper discs (8 mm) for antibiotic tests were placed on PSA plates, 4.5 cm a part. Subsequently, the paper disc was inoculated with culture (20 μL) from the isolate. LB liquid medium was used for control treatments. The experiment was replicated three times. All the petri dishes were incubated at 25˚C - 27˚C for 14 days and the mycelial area (mm<sup>2</sup>) of the plant pathogenic fungus was determined using LIA 32 software (http://www.agr.nagoya-u.ac.jp/~shinkan/LIA32/index-e.html).</p></sec><sec id="s2_9"><title>2.9. Data Analysis</title><p>Data have been shown in terms of the mean &#177; standard deviation values. Statistically significant differences were determined by t-test (P &lt; 0.05) using Statistical Package for the Social Sciences (IBM SPSS version 22.0).</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Effect of Culture Suspension and Culture Filtrate of GT4028 on M. oryzae Spore Germination</title><p>To assess the inhibitory activity of the isolate GT4028, we investigated the effects of the culture suspension and culture filtrates of the isolate on the germination of M. oryzae spores. The percentage germination of M. oryzae spores in culture suspension and culture filtrate of the isolate was 4.7% &#177; 3.3% and 2.0% &#177; 2.9%, respectively (<xref ref-type="fig" rid="fig1">Figure 1</xref>). In contrast, in the control, the percentage of spore germination was 100% (<xref ref-type="fig" rid="fig1">Figure 1</xref>). In addition, we investigated the effect that heat treatment had on the ability of the culture filtrate of GT4028 to suppress spore germination. In the heat-treated LB medium (Control) and heat-treated culture filtrate (GT4028), the percentages of spore germination were 100% and 33.5% &#177; 12.5%, respectively (<xref ref-type="fig" rid="fig2">Figure 2</xref>).</p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Effect of culture suspension and culture filtrates of isolate GT4028 on the germination of Magnaporthe oryzae spores. The spores of M. oryzae were suspended in the culture suspension and culture filtrates of isolate GT4028 and dropped on glass slides. After 24-h incubation in a moist chamber, the spore germination was observed by light microscopy. The rates of spore germination were calculated. The experiments were repeated thrice. Data are representative of the mean values of the results from three separate experiments. The bar at the top of each column represents the standard deviation of the mean. The asterisk indicates a significant difference compared to the result obtained in the control (t-test, P &lt; 0.05)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-2270901x2.png"/></fig><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Suppression by heat-treated culture filtrates of isolate GT4028 on the germination of Magnaporthe oryzae spores. The spores of M. oryzae were suspended in the culture filtrates of isolate GT4028 and dropped on glass slides. After 24-h incubation in a moist chamber, the germination of spores was observed by light microscopy. The rates of spore germination were calculated. The experiments were repeated thrice. Data are representative of the mean values of the results from three separate experiments. The bar at the top of each column represents the standard deviation of the mean. The asterisk indicates a significant difference compared to the result obtained in the control (t-test, P &lt; 0.05)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-2270901x3.png"/></fig></sec><sec id="s3_2"><title>3.2. Suppression of Blast Lesion Formation by M. oryzae in Culture Suspension of GT4028 on Rice</title><p>To determine the inhibitory activity against M. oryzae in rice, the culture suspension-pretreated rice leaves (cultivar “Koshihikari”) were inoculated with spores of M. oryzae. As a result, the blast lesion formation was significantly suppressed by culture suspension of the isolate, relative to that by the control (<xref ref-type="fig" rid="fig3">Figure 3</xref>(a)). In the controls, rice leaves sprayed with LB liquid medium showed the number of blast lesions to be 18.7 &#177; 4.7 (<xref ref-type="fig" rid="fig3">Figure 3</xref>(b)). The number of blast lesions in the treatment with culture suspension of isolate GT4028 was 9.2 &#177; 3.4.</p></sec><sec id="s3_3"><title>3.3. Identification and Characterization of GT4028</title><p>To identify the isolate GT4028, we used specific primers to PCR amplify the 16S rDNA by using its genomic DNA. The phylogenetic analyses showed that the microorganism was most closely related to the type strain of genus Burkholderia (<xref ref-type="fig" rid="fig4">Figure 4</xref>) and therefore, isolate GT4028 was identified as a member of the genus Burkholderia. Morphological observation by the SEM revealed that GT4028 was rod-shaped (data not shown). In the present study, the growth of GT4028 was observed at 20˚C, 28˚C, and 38˚C, but not at 4˚C (<xref ref-type="table" rid="table2">Table 2</xref>). Furthermore, the growth of GT4028 was observed in the presence of fungicides against rice blast fungus, such as Blastin, Kasgamycin, and Amistar (<xref ref-type="table" rid="table2">Table 2</xref>). The inhibitory activity of isolate GT4028 against other plant pathogenic fungi was tested by dual culture method. Isolate GT4028 inhibited the mycelial growth of Alternaria alternata Japanese pear pathotype, Corynespora cassiicola, Colletotrichum orbiculare, Fusarium oxysporum f. sp. spinaciae, and Cochliobolus miyabeanus by 40% to 60%, compared to the control (<xref ref-type="table" rid="table3">Table 3</xref>).</p></sec><sec id="s3_4"><title>3.4. Detection of an Inhibitory Compound on the Thin Layer Chromatography Plate</title><p>The inhibitory compounds were detected on the TLC plates by a growth inhibition assay of M. oryzae spores. The growth inhibition zone was observed at origin (Rf 0.0) in the presence of culture filtrate of isolate GT4028 (<xref ref-type="fig" rid="fig5">Figure 5</xref>).</p><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Suppressive effect of isolate GT4028 on the formation of blast lesions by Magnaporthe oryzae in rice plants. The rice plants were inoculated with M. oryzae in the presence of GT4028 culture suspension and were kept in a moist chamber for 24-h. After 7 days, blast lesion development (a) and number of blast lesions (b) was determined. Data are representative of the mean values of the results from three separate experiments. The bar at the top of each column represents the standard deviation of the mean. The asterisk indicates a significant difference compared to the result obtained in the control (t-test, P &lt; 0.05)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-2270901x4.png"/></fig><fig id="fig4"  position="float"><label><xref ref-type="fig" rid="fig4">Figure 4</xref></label><caption><title> Phylogenetic tree constructed on the basis of 16S rDNA sequences of isolate GT4028. A bootstrap consensus neighbor-joining tree for the isolate was created based on the Kimura 2-Parameter distance matrix (1000 replicates). Ralstonia pickettii (NBRC102503) was used as an out-group. The scale bar represents 1% sequence dissimilarity</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-2270901x5.png"/></fig><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Effect of fungicides and temperature on growth of isolate GT4028 on fungicides- amended LB media and under different incubation temperatures</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Isolate</th><th align="center" valign="middle"  colspan="4"  >Temperature (˚C)</th><th align="center" valign="middle"  colspan="4"  >Fungicides</th></tr></thead><tr><td align="center" valign="middle" >4</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >37</td><td align="center" valign="middle" >Control</td><td align="center" valign="middle" >Blastin</td><td align="center" valign="middle" >Kasgamycin</td><td align="center" valign="middle" >Amister</td></tr><tr><td align="center" valign="middle" >GT4028</td><td align="center" valign="middle" >-</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >++</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >++</td><td align="center" valign="middle" >++</td><td align="center" valign="middle" >++</td><td align="center" valign="middle" >++</td></tr></tbody></table></table-wrap><p>- : no growth, +: scanty growth, ++: maximum growth</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Effect of isolate GT4028 to the growth of plant pathogens observed by dual culture method</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Plant pathogens</th><th align="center" valign="middle"  colspan="2"  >Mycelia area (mm<sup>2</sup>)</th></tr></thead><tr><td align="center" valign="middle" >Control</td><td align="center" valign="middle" >Isolate GT4028</td></tr><tr><td align="center" valign="middle" >Alternaria alternata Japanese pear pathotype Corynespora cassiicola Colletotrichum orbiculare Fusarium oxysporum f. sp. spinaciae Cochliobolus miyabeanus</td><td align="center" valign="middle" >276.8 &#177; 3.0 286.6 &#177; 14.0 278.5 &#177; 5.8 274.0 &#177; 7.6 271.9 &#177; 8.7</td><td align="center" valign="middle" >144.7 &#177; 26.4* 125.5 &#177; 26.3* 109.5 &#177; 49.9* 168.9 &#177; 13.2* 124.9 &#177; 16.8*</td></tr></tbody></table></table-wrap><p>Asterisk indicate the significant difference compared with the result of the control (t-test, P &lt; 0.05).</p><fig id="fig5"  position="float"><label><xref ref-type="fig" rid="fig5">Figure 5</xref></label><caption><title> Thin-layer chromatography (TLC)-profiles of the culture filtrate of isolate GT4028. The culture filtrate of isolate GT4028 was spotted onto a TLC plate. After development, the TLC plate was sprayed with a concentrated spore suspension of Magnaporthe oryzae in the presence of potato sucrose agar medium. The inoculated plate was kept in a moist chamber at 25˚C - 27˚C for 7 days</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-2270901x6.png"/></fig></sec></sec><sec id="s4"><title>4. Discussion</title><p>The application of fungicides is generally an effective control method for fungal pathogens of plants. However, extensive use of synthetic fungicides to control these pathogens has induced fungal resistance. The use of microorganisms as biological control agent for these pathogens has been reported. Recently, we constructed a library of microorganisms isolated from soil in Shimane. The isolate GT4028 is one of the microorganisms exhibiting a high inhibitory activity against the mycelial growth of M. oryzae [<xref ref-type="bibr" rid="scirp.74197-ref5">5</xref>] . In this study, it was observed that GT4028 had inhibitory activity against several plant pathogenic fungi, such as A. alternata Japanese pear pathotype, C. cassiicola, C. orbiculare, F. oxysporum f. sp. spinaciae, and C. miyabeanus as well as against M. oryzae. The phylogenetic analysis of isolate GT4028 revealed that the organism was most closely related to genus Burkholderia. The bacteria in the genus Burkholderia comprise more than 80 species that are inhabitants of diverse ecological niches and are nutritionally versatile. However, their use in experiments requires caution partly because of the presence of opportunistic human pathogens in the population [<xref ref-type="bibr" rid="scirp.74197-ref11">11</xref>] . However, an increasing number of plant-associated strains and species of Burkholderia have been reported to confer resistance to plants against biotic and abiotic stresses; many species enhance the nitrogen fixing capabilities of the plants, as well [<xref ref-type="bibr" rid="scirp.74197-ref4">4</xref>] . Field trials have highlighted the ability of Burkholderia cepacia strains to colonize the rhizosphere of many crops, including, corn, rice pea, sunflower, and radish, leading to the enhanced growth of such plants and suppression of soil borne pathogens [<xref ref-type="bibr" rid="scirp.74197-ref12">12</xref>] . A study by Mao et al. (2006) demonstrated the in vitro inhibitory activity of purified compounds of Burkholderia sp MP-1 against a wide range of plant pathogenic fungi [<xref ref-type="bibr" rid="scirp.74197-ref13">13</xref>] . These compounds include phenylacetic acid, hydrocinnamic acid, 4-hydroxyphenylacetic acid, and 4-hydroxy- phenylacetate methyl ester. The antifungal 2-hydroxymethyl-chroman-4-one was isolated from Burkholderia sp. CEB01056 [<xref ref-type="bibr" rid="scirp.74197-ref14">14</xref>] and was shown to be active against Pythium ultimum, Phytophthora capsici, and Sclerotinia sclerotiorum. Burkholderines isolated from Burkholderia ambifaria 2.2N were characterized as a complex heat stable cyclic lipopeptide capable of inhibiting a broad spectrum of fungal pathogens [<xref ref-type="bibr" rid="scirp.74197-ref15">15</xref>] . Similarly, occidiofungin is a compound purified from Burkholderia contaminans MS14 that shows broad-spectrum activity against plant and animal fungal pathogens [<xref ref-type="bibr" rid="scirp.74197-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.74197-ref17">17</xref>] . Another strain known for its gibberellin-production and phosphate solubilization ability is Burkholderia sp KCTC 11096BP. Treatment of cucumber and Crown daisy plants with culture suspension of this strain promotes plant growth parameters [<xref ref-type="bibr" rid="scirp.74197-ref18">18</xref>] . In our study, plant growth promotion activity of the isolate GT4028 has not yet been investigated. The cultures and culture filtrates of Burkholderia gladioli pv agaricicola and B. gladioli have been shown to inhibit the growth of important soil borne plant pathogenic fungi as well as the postharvest fungal rot of apple, lemon, and orange [<xref ref-type="bibr" rid="scirp.74197-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.74197-ref19">19</xref>] . These strains showed protease, chitinase, and cellulase activities, which could have played important inhibitory roles against the development of fungal disease via cell wall-degradative effects of the extracellular enzymes. In our study, the inhibitory compounds against M. oryzae were detected at origin (Rf 0.0) on the TLC plates by a growth inhibition assay. Inhibitory compounds in the culture filtrate of isolate GT4028 were heat-stable and had molecular weight of 3000 or less. However, the activity of heat-treated culture filtrate was slightly decreased compared to that of non-heat-treated culture filtrate. These results suggested that isolate GT4028 might produce both heat-stable and heat-labile compounds, such as chitinase. In addition, the formation of blast lesions was significantly inhibited in the presence of the culture suspension of the isolate. Furthermore, isolate GT4028 was tolerant to Blastin/tricyclazole (triazolobenzo-thiazole), Kasugamycin (hexopyranosyl antibiotic), and Amistar (azoxystrobin) fungicides. However, the inhibitory compound that provided this protection has not yet been identified. Thus, further studies are required to identify the active compounds secreted in the culture of isolate GT4028.</p><p>The present study on isolate GT4028 might contribute to the development of a new fungicide and a biological fungicide.</p></sec><sec id="s5"><title>Acknowledgements</title><p>This investigation was supported by the African Business Education Initiative for Youth Program of the Japan International Cooperation Agency.</p></sec><sec id="s6"><title>Cite this paper</title><p>Lemtukei, D., Tamura, T., Nguyen, Q.T. and Ueno, M. (2017) Inhibitory Activity of Burkholderia sp. Isolated from Soil in Gotsu City, Shimane, against Magnaporthe oryzae. Advances in Microbiology, 7, 137-148. https://doi.org/10.4236/aim.2017.72011</p></sec></body><back><ref-list><title>References</title><ref id="scirp.74197-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Dean, R., Van Kan, J.A., Pretorius, Z.A., Hammond-Kosach, K.E., Di Pietro, A., Spanu, P.D., Rudd, J.J., Dickman, M., Kahmann, R., Ellis, J. and Foster, G.D. (2012) The Top 10 Fungal Pathogens in Molecular Plant Pathology. Molecular Plant Pathology, 13, 414-430. https://doi.org/10.1111/j.1364-3703.2011.00783.x</mixed-citation></ref><ref id="scirp.74197-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Liu, J., Wang, X., Mitchell, T., Hu, Y., Liu, X., Dai, L. and Wang, G.L. (2010) Recent Progress and Understanding of the Molecular Mechanisms of the Rice-Magnaporthe oryzae Interaction. Molecular Plant Pathology, 11, 419-427.  
https://doi.org/10.1111/j.1364-3703.2009.00607.x</mixed-citation></ref><ref id="scirp.74197-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Ishii, H. (2006) Impact of Fungicide Resistance in Plant Pathogens on Crop Disease Control and Agricultural Environment. Japan Agricultural Research Quarterly, 40, 205-211. https://doi.org/10.6090/jarq.40.205</mixed-citation></ref><ref id="scirp.74197-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Elshafie, H.S., Camele, I., Racioppi, R., Scrano, L., Iacobellis, N.S. and Bufo, S.A. (2012) In Vitro Antifungal Activity of Burkholderia gladioli pv. agaricicola against Some Phytopathogenic Fungi. International Journal of Molecular Sciences, 13, 16291-16302. https://doi.org/10.3390/ijms131216291</mixed-citation></ref><ref id="scirp.74197-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Lemtukei, D., Tamura, T., Nguyen, T.Q., Kihara, J. and Ueno, M. (2016) Antagonistic Potential of Isolated Microorganisms from Soil in Shimane Prefecture against Rice Blast Disease Cause by Magnaporthe oryzae. Bulletin of the Faculty of Life and Environmental Science, Shimane University, 21, 9-12.</mixed-citation></ref><ref id="scirp.74197-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Huong, N.L., Itoh, K. and Suyama, K. (2007) Diversity of 2,4-Dichlorophenoxyacetic Acid (2,4-D) and 2,4,5-Trichlorophenoxyacetic Acid (2,4,5-T)-Degrading Bacteria in Vietnamese Soils. Microbes and Environments, 22, 243-256.  
https://doi.org/10.1264/jsme2.22.243</mixed-citation></ref><ref id="scirp.74197-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Matsui, T., Kato, K., Namihira, T., Shinzato, N. and Semba, H. (2009) Stereospecific Degradation of Phenylsuccinate by Actinomycetes. Chemosphere, 76, 1278-1282.  
https://doi.org/10.1016/j.chemosphere.2009.06.021</mixed-citation></ref><ref id="scirp.74197-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Suzuki, S., Taketani, H., Kusumoto, K. and Kashiwagi, Y. (2006) High-Throughput Genotyping of Filamentous Fungus Aspergillus oryzae Based on Colony Direct Polymerase Chain Reaction. Journal of Bioscience and Bioengineering, 102, 572-574. https://doi.org/10.1263/jbb.102.572</mixed-citation></ref><ref id="scirp.74197-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Saitou, N. and Nei, M. (1987) The Neighbor-Joining Method: A New Method for Reconstructing Phylogenetic Trees. Molecular Biology and Evolution, 4, 406-425.</mixed-citation></ref><ref id="scirp.74197-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Nguyen, Q.T., Ueda, K., Kihara, J., Arase, S. and Ueno, M. (2012) Effect of Culture Filtrates of Trichoderma sp. Isolated from Wild Mushrooms on the Infectious Behavior of Plant Pathogenic Fungi. Bulletin of the Faculty of Life and Environmental Science, Shimane University, 17, 23-27.</mixed-citation></ref><ref id="scirp.74197-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Coenye, T. and Vandamme, P. (2003) Diversity and Significance of Burkholderia species Occupying Diverse Ecological Niches. Environmental Microbiology, 5, 719-729. https://doi.org/10.1046/j.1462-2920.2003.00471.x</mixed-citation></ref><ref id="scirp.74197-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">McLoughlin, T.J., Quinn, J.P., Bettermann, A. and Bookland, R. (1992) Pseudomonas cepacia Suppression of Sunflower Wilt Fungus and Role of Antifungal Compounds in Controlling the Disease. Applied and Environmental Microbiology, 58, 1760-1763.</mixed-citation></ref><ref id="scirp.74197-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Mao, S., Lee, S.J., Hwangbo, H., Kim, Y.W., Park, K.H., Cha, G.S., Park, R.D. and Kim, K.Y. (2006) Isolation and Characterization of Antifungal Substances from Burkholderia sp. Culture Broth. Current Microbiology, 53, 358-364.  
https://doi.org/10.1007/s00284-005-0333-2</mixed-citation></ref><ref id="scirp.74197-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Kang, J.G., Shin, S.Y., Kim, M.J., Bajpai, V., Maheshwari, D.K. and Kang, S.C. (2004) Isolation and Anti-fungal Activities of 2-Hydroxymethyl-Chroman-4-One Produced by Burkholderia sp. MSSP. The Journal of Antibiotics, 57, 726-731.   
https://doi.org/10.7164/antibiotics.57.726</mixed-citation></ref><ref id="scirp.74197-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Tawfik, K.A., Jeffs, P., Bray, B., Dubay, G., Falkinham, J.O., Mostafa, M., Youssef, D., Khalifa, S. and Schmidt, E.W. (2010) Burkholdines 1097 and 1229, Potent Antifungal Peptides from Burkholderia ambifaria 2.2N. Organic Letters, 12, 664-666.   
https://doi.org/10.1021/ol9029269</mixed-citation></ref><ref id="scirp.74197-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Lin, Z., Falkinham, J.O., Tawfik, K.A., Jeffs, P., Bray, B., Dubay, G., Cox, J.E. and Schmidt, E.W. (2012) Burkholdines from Burkholderia ambifaria: Antifungal agents and Possible Virulence Factors. Journal of Natural Products, 75, 1518-1523.  
https://doi.org/10.1021/np300108u</mixed-citation></ref><ref id="scirp.74197-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Lu, S., Novak, J., Austin, F.W., Gu, G., Ellis, D., Kirk, M., Wilson-Stanford, S., Tonelli, M. and Smith, L. (2009) Occidiofungin, a Unique Antifungal Glycopeptide Produced by a Strain of Burkholderia contaminans. Biochemistry, 48, 8312-8321.  
https://doi.org/10.1021/bi900814c</mixed-citation></ref><ref id="scirp.74197-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Joo, G.J., Kang, S.M., Hamayun, M., Kim, S.K., Na, C.I., Shin, D.H. and Lee, I.J. (2009) Burkholderia sp. KCTC 11096BP as a Newly Isolated Gibberellin Producing Bacterium. The Journal of Microbiology, 47, 167-171.   
https://doi.org/10.1007/s12275-008-0273-1</mixed-citation></ref><ref id="scirp.74197-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Scuderi, G., Bonaccorsi, A., Panebianco, S., Vitale, A., Polizzi, G. and Cirvilleri, G. (2009) Some Strain of Burkholderia gladioli are Potential Candidates for Postharvest Biocontrol of Fungal Rots in Citrus and Apple Fruits. Journal of Plant Pathology, 91, 207-213.</mixed-citation></ref></ref-list></back></article>