<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2017.71001</article-id><article-id pub-id-type="publisher-id">AiM-73273</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Prevalence of &lt;i&gt;Helicobacter pylori vacA&lt;/i&gt;, &lt;i&gt;cagA&lt;/i&gt;, &lt;i&gt;dupA&lt;/i&gt; and &lt;i&gt;oipA&lt;/i&gt; Genotypes in Patients with Gastric Disease
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mayara</surname><given-names>Luciana Sallas</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jessica</surname><given-names>Lima Melchiades</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Luanna</surname><given-names>Munhoz Zabaglia</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Juliana</surname><given-names>Ribeiro do Prado Moreno</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Wilson</surname><given-names>Aparecido Orcini</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Elizabeth</surname><given-names>Suchi Chen</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Marilia</surname><given-names>de Arruda Cardoso Smith</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Spencer</surname><given-names>Luiz Marques Payão</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lucas</surname><given-names>Trevizani Rasmussen</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Federal University of S&amp;amp;atilde;o Paulo (UNIFESP), S&amp;amp;atilde;o Paulo, Brazil</addr-line></aff><aff id="aff1"><addr-line>Sagrado Cora&amp;amp;ccedil;&amp;amp;atilde;o University (USC), Bauru, Brazil</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>lucasrasmussen@gmail.com(MLS)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>04</day><month>01</month><year>2017</year></pub-date><volume>07</volume><issue>01</issue><fpage>1</fpage><lpage>9</lpage><history><date date-type="received"><day>October</day>	<month>27,</month>	<year>2016</year></date><date date-type="rev-recd"><day>Accepted:</day>	<month>January</month>	<year>1,</year>	</date><date date-type="accepted"><day>January</day>	<month>4,</month>	<year>2017</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Gastric diseases such as chronic gastritis and gastric cancer are most commonly caused by virulence factors of 
  Helicobacter pylori (
  H. pylori), such as the 
  vacA, 
  cagA, 
  dupA and 
  oipA genes. Therefore, this study investigated the prevalence and the combination of these virulence factors from patients with gastric diseases. The endoscopic biopsies were obtained from 516 patients with gastric symptoms, 101 of which were from patients with normal gastric tissue, 365 of which were from patients with chronic gastritis, and 50 of which were from patients with gastric cancer. 
  H. pylori and the virulence factors were detected by PCR. The 
  oipA gene exhibited an increased risk for chronic gastritis (p = 0.0296), and the vacA gene demonstrated a risk for gastric cancer from chronic gastritis (p = 0.0002). Based on the combination of the virulence factors, 
  cagA, 
  vacA, 
  dupA and 
  oipA genes exhibited a high prevalence in patients with chronic gastritis and gastric cancer. The 
  cagA+/
  dupA+ genotype demonstrated a significant correlation in patients with normal gastric mucosa (p = 0.0278). In the chronic gastritis group, a significant association was observed between the 
  cagA+ and the vacA s1m1 genotypes (p &lt; 0.0001), the 
  cagA+/
  dupA+ genotypes (p = 0.0183), the 
  dupA+/
  oipA+ genotypes (p &lt; 0.0001), and the dupA+/vacA s1m1 genotypes (p = 0.0008) genotypes. This study revealed a high prevalence of the combination of 
  cagA, 
  vacA, 
  dupA, and 
  oipA genes, which contributed to the risk of developing gastroduodenal diseases. Furthermore, this is the first study to reveal a high prevalence of the 
  oipA gene in 
  H. pylori isolates in Brazil.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Helicobacter pylori&lt;/i&gt;</kwd><kwd> Virulence Factors</kwd><kwd> &lt;i&gt;cagA&lt;/i&gt;</kwd><kwd> &lt;i&gt;dupA&lt;/i&gt;</kwd><kwd> &lt;i&gt;oipA&lt;/i&gt;</kwd><kwd> &lt;i&gt;vacA&lt;/i&gt;</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Helicobacter pylori (H. pylori) is a gram-negative and microaerophilic bacterium that infects approximately 50% of the world’s population. However, the prevalence of the infection varies between developed and developing countries. A higher prevalence of H. pylori infection (75% - 83%) was found in Latin American countries than in Japan (40%) and other developed countries [<xref ref-type="bibr" rid="scirp.73273-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref2">2</xref>] .</p><p>H. pylori infection is the main cause of peptic or duodenal ulcers, gastritis, and gastric cancer. The bacterium colonizes the gastric mucosa by using urease activity to resist the hostile acidic condition of the stomach. After surviving in the stomach environment, flagellar motility is necessary to move the bacterium through the gastric epithelium cells. The interaction of H. pylori adhesins and cellular receptors supports gastric mucosa infection, and it is followed by the secretion of virulence factors (such as vacA, cagA, dupA and oipA genes) which cause tissue damage [<xref ref-type="bibr" rid="scirp.73273-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref4">4</xref>] .</p><p>The vacA gene encodes the vacuolating cytotoxin A, which may participate in several cellular activities, including the inhibition of T-cell proliferation and activation and the onset of proinflammatory response. These activities depend on differences in the gene’s structure, the signal region, or s (s1 and s2), and the middle region, or m (m1 and m2). Strains containing s1/m1 are more cytotoxic than those containing s1/m2, and they also increase the risk for developing gastric cancer. Meanwhile, s2/m2 does not exhibit cytotoxic activity [<xref ref-type="bibr" rid="scirp.73273-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref7">7</xref>] .</p><p>cagA (cytotoxin-associated gene A) is the most frequently studied virulence factor encoded by the cag pathogenicity island (PAI). This protein is injected into gastric cells, causing oncogenic activity and modification to normal cell differentiation, such as cell polarity and cell adhesion. This gene is associated with increased inflammatory response and risk of gastric cancer and peptic ulcers [<xref ref-type="bibr" rid="scirp.73273-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref8">8</xref>] .</p><p>The dupA (duodenal ulcer promoter gene A) gene was identified as the first disease-specific virulence factor in 2005, for its ability to increase the risk for duodenal ulcers. It was also reported that dupA had a suppressive effect on gastric cancer. Recent studies have reported an association between the dupA gene and elevated IL-8 production from gastric epithelial cells in vivo. However, the presence of dupA and the increased IL-8 production in vitro is still under discussion [<xref ref-type="bibr" rid="scirp.73273-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref9">9</xref>] .</p><p>oipA (outer inflammatory protein A) was identified in 2000 by Yamaoka, et al. [<xref ref-type="bibr" rid="scirp.73273-ref10">10</xref>] as one of the outer membrane proteins. The oipA gene has two functional statuses: “on”, which reveals the functional gene; and “off”, which reveals the non-functional gene. This condition is regulated by a repair mechanism known as slipped strand mispairing, which is based on the number of CT dinucleotide repeats in the 5’ region of the oipA gene [<xref ref-type="bibr" rid="scirp.73273-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref8">8</xref>] . The presence of oipA and cagA and/or cag PAI seems to be associated with β-catenin signaling, which promotes the opening of cell-cell junctions [<xref ref-type="bibr" rid="scirp.73273-ref6">6</xref>] . Furthermore, the oipA’s “on” status is associated with higher risks of gastric cancer and peptic ulcers than it is with gastritis and functional dyspepsia [<xref ref-type="bibr" rid="scirp.73273-ref11">11</xref>] .</p><p>These virulence factors may be related by acting synergistically with each other, thus increasing the risks of several gastric diseases [<xref ref-type="bibr" rid="scirp.73273-ref6">6</xref>] . Therefore, more studies on the clinical importance of H. pylori virulence markers are necessary, particularly research that considers the recent dupA and oipA genes, the functions of which have not yet been clarified.</p><p>Considering the unclear epidemiological aspects of H. pylori, the aim of present study was to detect status of cagA, vacA, oipA and dupA genotypes in H. pylori isolated from patients with chronic gastritis and gastric cancer.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Study Populations</title><p>Five hundred and sixteen gastric mucosa biopsy samples were collected from patients with gastric symptoms who had undergone an endoscopic investigation at the Bauru State Hospital (HEB), the Gastrointerology Department of the Marilia School of Medicine (FAMEMA), and the Federal University of S&#227;o Paulo (UNIFESP). Informed consent was obtained from all patients, and the study was approved by the Research Ethics Committee of Universidade do Sagrado Cora&#231;&#227;o (USC) in Bauru, S&#227;o Paulo, Brazil (No. 1.045.181).</p><p>The macroscopic aspects of the mucosa and histological routine results were considered. The study analyzed 101 participants (32♂/69♀, mean age 54 &#177; 14.6 years) with normal gastric tissue (Control-C), 365 patients (175♂/190♀, mean age 53 &#177; 14.4 years) with chronic gastritis (CG), and 50 patients (30♂/20♀, mean age 59 &#177; 13.8 years) with gastric cancer (GC). Patients who received antimicrobial therapy, anti-cholinergic therapy, chemotherapy and anti-inflammatory agents or proton pump inhibitors within 30 days of the investigation were excluded from the study.</p></sec><sec id="s2_2"><title>2.2. DNA Extraction and H. pylori Detection</title><p>Genomic DNA from the gastric biopsy samples was extracted using the QIA amp<sup>&#174;</sup> tissue kit (Qiagen, Germany) according to the manufacturer’s instructions. Polymerase chain reaction (PCR) was used to detect the presence of Helicobacter pylori and virulence factors from the vacA, cagA, dupA and oipA genes. All samples were submitted to diagnosis of H. pylori but just the positive samples were submitted to detection of virulence factors. PCR and the primer information from each amplicon are summarized in <xref ref-type="table" rid="table1">Table 1</xref>.</p></sec><sec id="s2_3"><title>2.3. Statistical Analysis</title><p>To estimate the statistical differences between the diseases and the various genotypes, the Chi square test and Fischer’s exact test were used. The risk was estimated using an odds ratio (OR) and a 95% confidence interval (CI). A p value of 0.05 was considered statistically significant.</p></sec></sec><sec id="s3"><title>3. Results</title><p>Helicobacter pylori was detected in 256/516 (49.6%) of the samples. The prevalence of H. pylori and its virulence factors in each group of patients (the normal group, the chronic gastritis group, and the gastric cancer group) are detailed in <xref ref-type="table" rid="table2">Table 2</xref>, as are the ORs, the 95% CI, and the p value.</p><p>The results suggest a significant association between gastric diseases and the presence of H. pylori. Likewise, the oipA gene was found to be associated with an increased risk of chronic gastritis. In the comparison between the groups of patients with chronic gastritis and the group with gastric cancer, the OR (2.46), the 95% CI (1.244-4.861), and the p value (0.0089) of the bacterium’s presence also indicated a significant association. After the detection of the virulence factors in this comparison (Gastritis and Gastric Cancer groups), only the vacA gene was found to be statistically significant (OR: 7.314; 95% CI: 2.157-24.8; p = 0.0002).</p><p>Based on the combination of the cagA gene with the other virulence factors represented in <xref ref-type="table" rid="table3">Table 3</xref>, a significant correlation was observed between the cagA and the dupA gene in the normal group (OR: 24.2; 95% CI: 0.9298-629.8; p = 0.0278). In the</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> PCR conditions and primers used to detect H. pylori, vacA, cagA, dupA, and oipA</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Genes</th><th align="center" valign="middle" >Primers</th><th align="center" valign="middle" >Primer sequence (5’-3’)</th><th align="center" valign="middle" >PCR conditions</th><th align="center" valign="middle" >Amplicons</th><th align="center" valign="middle" >References</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >16SrRNA</td><td align="center" valign="middle" >Hpx1<sup>a </sup></td><td align="center" valign="middle" >CTGGAGARACTAAGYCCTCC</td><td align="center" valign="middle"  rowspan="2"  >94˚C, 1 min; 59˚C, 1 min; 72˚C, 1 min (40 cycles)</td><td align="center" valign="middle"  rowspan="2"  >150 bp</td><td align="center" valign="middle"  rowspan="2"  >Scholte et al., 1997</td></tr><tr><td align="center" valign="middle" >Hpx2</td><td align="center" valign="middle" >GAGGAATACTCATTGCGAAGGCGA</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >vacA s1/s2</td><td align="center" valign="middle" >SA</td><td align="center" valign="middle" >ATGGAAATACAACAAACACAC</td><td align="center" valign="middle"  rowspan="2"  >94˚C, 45 s; 54˚C, 45 s; 72˚C, 45 s (40 cycles)</td><td align="center" valign="middle"  rowspan="2"  >s1: 176 bp s2: 203 bp</td><td align="center" valign="middle" >Atherton et al., 1995</td></tr><tr><td align="center" valign="middle" >SC<sup>a </sup></td><td align="center" valign="middle" >CCTGARACCGTTCCTACAGC</td><td align="center" valign="middle" >Van Doorn et al., 1998</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >vacA m1/m2</td><td align="center" valign="middle" >MA<sup>a </sup></td><td align="center" valign="middle" >CACAGCCACTTTYAATAACGA</td><td align="center" valign="middle"  rowspan="2"  >94˚C, 45 s; 55˚C, 45 s; 72˚C, 1 min (35 cycles)</td><td align="center" valign="middle"  rowspan="2"  >m1: 400 bp m2: 475 bp</td><td align="center" valign="middle"  rowspan="2"  >Van Doorn et al., 1998</td></tr><tr><td align="center" valign="middle" >MB</td><td align="center" valign="middle" >CGTCAAAATAATTCCAAGGG</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >cagA</td><td align="center" valign="middle" >Cag1</td><td align="center" valign="middle" >ATGACTAACGAAACTATTGATC</td><td align="center" valign="middle"  rowspan="2"  >94˚C, 1 min; 53˚C, 1 min; 72˚C, 1 min (40 cycles)</td><td align="center" valign="middle"  rowspan="2"  >232 bp</td><td align="center" valign="middle"  rowspan="2"  >Rasmussen et al., 2010</td></tr><tr><td align="center" valign="middle" >Cag2</td><td align="center" valign="middle" >CAGGATTTTTGATCGCTTTATT</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >dupA</td><td align="center" valign="middle" >Dupa1</td><td align="center" valign="middle" >CGTGATCAATATGGATGCTT</td><td align="center" valign="middle"  rowspan="2"  >94˚C, 45 s; 52˚C, 45 s; 72˚C, 45 s (35 cycles)</td><td align="center" valign="middle"  rowspan="2"  >197 bp</td><td align="center" valign="middle"  rowspan="2"  >Gomes et al., 2008</td></tr><tr><td align="center" valign="middle" >Dupa2</td><td align="center" valign="middle" >TCTTTCTAGCTTGAGCGA</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >oipA</td><td align="center" valign="middle" >HPO638F</td><td align="center" valign="middle" >GTTTTTGATGCATGGGATTT</td><td align="center" valign="middle"  rowspan="2"  >94˚C, 45 s; 57˚C, 45 s; 72˚C, 45 s (35 cycles)</td><td align="center" valign="middle"  rowspan="2"  >401 bp</td><td align="center" valign="middle"  rowspan="2"  >Ben Mansour et al., (2010)</td></tr><tr><td align="center" valign="middle" >HPO638R</td><td align="center" valign="middle" >GTGCATCTCTTATGGCTTTG</td></tr></tbody></table></table-wrap><p>Alleles s1 and m1 of vacA gene, H. pylori strain 60190 (GeneBank U05676); Alleles s2 and m2 of vacA gene, H. pylori strain Tx30a (GeneBank U29401); a R = A or G and Y = C or T.</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Distribution of the Helicobacter pylori genotypes and the risk of developing chronic gastritis and gastric cancer Comparisons between the normal group and the chronic gastritis group and the normal group versus the gastric cancer group</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" >Normal (n = 101)</th><th align="center" valign="middle" >Chronic Gastritis (n = 365)</th><th align="center" valign="middle" >OR (95% CI), p</th><th align="center" valign="middle" >Gastric Cancer (n = 50)</th><th align="center" valign="middle" >OR (95% CI), p</th></tr></thead><tr><td align="center" valign="middle" >vacA</td><td align="center" valign="middle" >Hp+ (n = 12)</td><td align="center" valign="middle" >Hp+ (n = 206)</td><td align="center" valign="middle" >9.55 (5.05 - 18.06), &lt;0.0001*</td><td align="center" valign="middle" >Hp+ (n = 38)</td><td align="center" valign="middle" >23.49 (9.684 - 56.96), &lt;0.0001*</td></tr><tr><td align="center" valign="middle" >s1/m1</td><td align="center" valign="middle" >07 (58.3%)</td><td align="center" valign="middle" >105 (50.9%)</td><td align="center" valign="middle"  rowspan="3"  >0.62 (0.16-2.50), 0.7422</td><td align="center" valign="middle" >32 (84.2%)</td><td align="center" valign="middle"  rowspan="3"  >4.57 (0.7575-27.59), 0.1129</td></tr><tr><td align="center" valign="middle" >s2/m2</td><td align="center" valign="middle" >03 (25%)</td><td align="center" valign="middle" >72 (34.9%)</td><td align="center" valign="middle" >03 (7.8%)</td></tr><tr><td align="center" valign="middle" >others</td><td align="center" valign="middle" >02 (16.6%)</td><td align="center" valign="middle" >29 (14%)</td><td align="center" valign="middle" >03 (7.8%)</td></tr><tr><td align="center" valign="middle" >cagA</td><td align="center" valign="middle" >05 (41.6%)</td><td align="center" valign="middle" >101 (49%)</td><td align="center" valign="middle" >1.34 (0.41-4.38), 0.7691</td><td align="center" valign="middle" >19 (50%)</td><td align="center" valign="middle" >1.4 (0.3769-5.20), 0.7447</td></tr><tr><td align="center" valign="middle" >dupA</td><td align="center" valign="middle" >07 (58.3%)</td><td align="center" valign="middle" >109 (52.9%)</td><td align="center" valign="middle" >0.80 (0.25-2.61), 0.7739</td><td align="center" valign="middle" >18 (47.3%)</td><td align="center" valign="middle" >0.64 (0.1730-2.39), 0.7416</td></tr><tr><td align="center" valign="middle" >oipA</td><td align="center" valign="middle" >06 (50%)</td><td align="center" valign="middle" >163 (79.1%)</td><td align="center" valign="middle" >3.79 (1.16-12.35), 0.0296*</td><td align="center" valign="middle" >26 (68.4%)</td><td align="center" valign="middle" >2.17 (0.5773-8.13), 0.3088</td></tr></tbody></table></table-wrap><p>Hp: Helicobacter pylori; n: number of samples. *statistically significant.</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Association between the cagA gene and the vacA, dupA, and oipA genes</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  colspan="2"  ></th><th align="center" valign="middle"  colspan="9"  >Normal</th></tr></thead><tr><td align="center" valign="middle"  colspan="2"   rowspan="2"  >Virulence Factor</td><td align="center" valign="middle"  rowspan="2"  >n (%)</td><td align="center" valign="middle"  colspan="4"  >vacA n (%)</td><td align="center" valign="middle"  colspan="2"  >dupA n (%)</td><td align="center" valign="middle"  colspan="2"  >oipA n (%)</td></tr><tr><td align="center" valign="middle" >s1m1</td><td align="center" valign="middle" >s2m2</td><td align="center" valign="middle" >outros</td><td align="center" valign="middle"  colspan="2"  >pos</td><td align="center" valign="middle" >neg</td><td align="center" valign="middle" >pos</td><td align="center" valign="middle" >neg</td></tr><tr><td align="center" valign="middle"  rowspan="3"  >cagA</td><td align="center" valign="middle" >pos</td><td align="center" valign="middle" >5 (100)</td><td align="center" valign="middle" >4 (80)</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1 (20)</td><td align="center" valign="middle"  colspan="2"  >5 (100)*</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >4 (80)</td><td align="center" valign="middle" >1 (20)</td></tr><tr><td align="center" valign="middle" >neg</td><td align="center" valign="middle" >7 (100)</td><td align="center" valign="middle" >3 (42.85)</td><td align="center" valign="middle" >3 (42.85)</td><td align="center" valign="middle" >1 (14.3)</td><td align="center" valign="middle"  colspan="2"  >2 (28.6)</td><td align="center" valign="middle" >5 (71.4)</td><td align="center" valign="middle" >2 (28.6)</td><td align="center" valign="middle" >5 (71.4)</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >12 (100)</td><td align="center" valign="middle" >7 (58.3)</td><td align="center" valign="middle" >3 (25)</td><td align="center" valign="middle" >2 (16.7)</td><td align="center" valign="middle"  colspan="2"  >7 (58.3)</td><td align="center" valign="middle" >5 (41.7)</td><td align="center" valign="middle" >6 (50)</td><td align="center" valign="middle" >6 (50)</td></tr><tr><td align="center" valign="middle"  colspan="11"  >Chronic Gastritis</td></tr><tr><td align="center" valign="middle"  rowspan="3"  >cagA</td><td align="center" valign="middle" >pos</td><td align="center" valign="middle" >101 (100)</td><td align="center" valign="middle" >78 (77.2)*</td><td align="center" valign="middle" >11 (10.9)</td><td align="center" valign="middle" >12 (11.9)</td><td align="center" valign="middle"  colspan="2"  >62 (61.4)*</td><td align="center" valign="middle" >39 (38.6)</td><td align="center" valign="middle" >77 (76.2)</td><td align="center" valign="middle" >24 (23.8)</td></tr><tr><td align="center" valign="middle" >neg</td><td align="center" valign="middle" >105 (100)</td><td align="center" valign="middle" >27 (25.7)</td><td align="center" valign="middle" >61 (58.1)</td><td align="center" valign="middle" >17 (16.2)</td><td align="center" valign="middle"  colspan="2"  >47 (44.8)</td><td align="center" valign="middle" >58 (55.2)</td><td align="center" valign="middle" >86 (81.9)</td><td align="center" valign="middle" >19 (18.1)</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >206 (100)</td><td align="center" valign="middle" >105 (51)</td><td align="center" valign="middle" >72 (34.9)</td><td align="center" valign="middle" >29 (14.1)</td><td align="center" valign="middle"  colspan="2"  >109 (52.9)</td><td align="center" valign="middle" >97 (47.1)</td><td align="center" valign="middle" >163 (79.1)</td><td align="center" valign="middle" >43 (20.9)</td></tr><tr><td align="center" valign="middle"  colspan="11"  >Gastric Cancer</td></tr><tr><td align="center" valign="middle"  rowspan="3"  >cagA</td><td align="center" valign="middle" >pos</td><td align="center" valign="middle" >19 (100)</td><td align="center" valign="middle" >18 (94.7)</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1 (5.3)</td><td align="center" valign="middle"  colspan="2"  >10 (52.6)</td><td align="center" valign="middle" >9 (47.4)</td><td align="center" valign="middle" >16 (84.2)</td><td align="center" valign="middle" >3 (15.8)</td></tr><tr><td align="center" valign="middle" >neg</td><td align="center" valign="middle" >19 (100)</td><td align="center" valign="middle" >14 (73.7)</td><td align="center" valign="middle" >3 (15.8)</td><td align="center" valign="middle" >2 (10.5)</td><td align="center" valign="middle"  colspan="2"  >8 (42.1)</td><td align="center" valign="middle" >11 (57.9)</td><td align="center" valign="middle" >10 (52.6)</td><td align="center" valign="middle" >9 (47.4)</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >38 (100)</td><td align="center" valign="middle" >32 (84.2)</td><td align="center" valign="middle" >3 (7.9)</td><td align="center" valign="middle" >3 (7.9)</td><td align="center" valign="middle"  colspan="2"  >18 (47.4)</td><td align="center" valign="middle" >20 (52.6)</td><td align="center" valign="middle" >26 (68.4)</td><td align="center" valign="middle" >12 (31.6)</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap><p>n: number of samples. *association statistically significant.</p><p>chronic gastritis group, two associations were found to be statistically significant. The first relationship was between the cagA and the vacA s1m1 genes (OR: 16.02; 95% CI: 7.364-34.85; p &lt; 0.0001), and the second was between the cagA and the dupA genes (OR: 1.962; 95% CI: 1.126-3.419; p = 0.0183). However, no significant correlations werefound between the virulence factors in the gastric cancer group.</p><p>Moreover, an analysis of the combinations between the virulence factors, as outlined in <xref ref-type="fig" rid="fig1">Figure 1</xref>, revealed interesting correlations. Among the strains isolated from the patients with chronic gastritis, the statistically significant genotypes were cagA+/vacA s1m1 (data shown previously), cagA+/dupA+ (data shown previously), dupA+/oipA+ (OR: 5.105; 95% CI: 2.353-11.07; p &lt; 0.0001), and dupA+/ vacA s1m1 (OR: 9.185; 95% CI: 2.582-32.67; p = 0.0008).There were no statistical associations among the strains from the patients with gastric cancer.</p></sec><sec id="s4"><title>4. Discussion</title><p>The association between Helicobacter pylori and the development of duodenal and peptic ulcers, chronic gastritis, and an increased risk for gastric cancer is now a consensus [<xref ref-type="bibr" rid="scirp.73273-ref12">12</xref>] . Thus, our results demonstrate a significant relationship between the presence of H. pylori and the increased risks for gastric diseases. The results are in accordance with many studies that have been published since the discovery of H. pylori [<xref ref-type="bibr" rid="scirp.73273-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref16">16</xref>] . These clinical outcomes vary according to the host and H. pylori factors, such as the vacA, cagA, dupA, and oipA genes.</p><p>VacA activity depends on the structure of the gene. Studies have found that in Western countries, strains containing the s1m1 genotype are associated with a higher risk of gastric disease, as well as with enhanced proinflammatory response [<xref ref-type="bibr" rid="scirp.73273-ref17">17</xref>] . Similar to our results, Asrat, et al. [<xref ref-type="bibr" rid="scirp.73273-ref18">18</xref>] and Suzuki, et al. [<xref ref-type="bibr" rid="scirp.73273-ref19">19</xref>] also found s1m1 to be the most common</p><fig-group id="fig1"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Combination among cagA, vacA, dupA, and oipA genotypes. (a) Chronic gastritis group; (b) Gastric cancer group. *Statistically significant association.</title></caption><fig id ="fig1_1"><label> (b)</label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-2270848x2.png"/></fig></fig-group><p>vacA genotype. Interestingly, all of these virulence factors have a mutual relationship; for example, cagA-positive strains often have the s1m1 genotype, and several studies have provided evidence of an association between the cagA+/vacA s1m1 genotype and the risk of gastric disease, which was also found in our study [<xref ref-type="bibr" rid="scirp.73273-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref22">22</xref>] . However, the significant association between this genotype and gastric diseases was only observed in the chronic gastritis group (p &lt; 0.0001). No associations were found in the gastric cancer group, a result which conflicts with the data provided by Suzuki, et al. [<xref ref-type="bibr" rid="scirp.73273-ref21">21</xref>] .</p><p>When the oncoprotein cagA is present in host cells, the risks for peptic ulcer and gastric cancer have been found to increase in Western countries when compared to cagA-negative strains [<xref ref-type="bibr" rid="scirp.73273-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.73273-ref19">19</xref>] . This data was found to be inconsistent with our study, because the cagA gene alone was not found to be associated with any clinical outcome; however, our report is consistent with the results found by Kim, et al. [<xref ref-type="bibr" rid="scirp.73273-ref23">23</xref>] .</p><p>The prevalence of the cagA gene may vary according to the region. In Eastern countries, cagA-positive strains reach almost 100%, while in some Western countries the prevalence is less than 50% [<xref ref-type="bibr" rid="scirp.73273-ref6">6</xref>] . The present study detected 50% or fewer cagA-positive strains among a cohort of Brazilian patients. This number is similar to what Sasaki, et al. [<xref ref-type="bibr" rid="scirp.73273-ref24">24</xref>] observed in Ecuador (45.9%) and Panama (20%), though it is not in agreement with what Yamaoka, et al. [<xref ref-type="bibr" rid="scirp.73273-ref25">25</xref>] found in Japan or what Watada, et al. [<xref ref-type="bibr" rid="scirp.73273-ref22">22</xref>] found in Colombia.</p><p>In our report, the cagA gene also exhibited a significant association with another virulence factor, the dupA gene, which is a protecting factor against gastric cancer and which is associated with an increased risk for duodenal ulcer [<xref ref-type="bibr" rid="scirp.73273-ref26">26</xref>] Gomes, et al. [<xref ref-type="bibr" rid="scirp.73273-ref27">27</xref>] also found a correlation between cagA-positive and dupA-positive strains, but the association was in patients with duodenal ulcers. In a meta-analysis, Shiota, et al. [<xref ref-type="bibr" rid="scirp.73273-ref26">26</xref>] reported a higher prevalence of dupA in Western countries than in Eastern countries. The study performed by Gomes, et al. [<xref ref-type="bibr" rid="scirp.73273-ref27">27</xref>] revealed an increased prevalence of dupA in Brazilian patients with chronic gastritis (92.3%) and gastric cancer (87.6%), a finding which differed from that provided by Lu et al. (2005) in a study on strains from Colombia. It also differs from our findings. This difference likely occurred because the patients were from different regions in Brazil.</p><p>One interesting point about the dupA gene was that we observed a statistically significant association between it and the vacA s1m1 genotype. This fact has not been described previously. The only report on this association was provided by Arachchi et al. (2007), who observed a correlation between s1 and m1 alone. Interestingly, the dupA gene also exhibited a significant association with the oipA gene in our study; both genes are involved in the induction of IL-8 secretion [<xref ref-type="bibr" rid="scirp.73273-ref7">7</xref>] . However, our findings differ from those of Souod, et al. [<xref ref-type="bibr" rid="scirp.73273-ref28">28</xref>] , who reported a statistically significant association with the dupA+/oipA- genotype, and with the same p value as ours (p &lt; 0.0001). Though the clinical outcomes resulting from the presence of the oipA gene are still unclear, Souod, et al. [<xref ref-type="bibr" rid="scirp.73273-ref28">28</xref>] similarly observed a significant correlation between the oipA gene and chronic gastritis. In addition, they found no relationship with gastric cancer, as Yamaoka, et al. [<xref ref-type="bibr" rid="scirp.73273-ref29">29</xref>] also reported.</p></sec><sec id="s5"><title>5. Conclusion</title><p>Taken together, our results suggest that the high prevalence of virulent factors contributes to the risk of developing gastroduodenal diseases. We hypothesize that the more virulent combination may be a trigger for chronic gastritis, a precursor lesion of gastric cancer. This is the first study to reveal a high prevalence of the oipA gene in H. pylori isolates in Brazil. Furthermore, this study reveals a high prevalence of the combination of cagA, vacA, dupA, and oipA genes. Our findings reinforce the importance of understanding the correlation between the virulence of H. pylori and host susceptibility.</p></sec><sec id="s6"><title>Acknowledgements</title><p>The authors would like to thank the State of S&#227;o Paulo Research Foundation (FAPESP) for the funding of this research (Grant Numbers: 2015/11371-5 and 2015/15253-7).</p></sec><sec id="s7"><title>Cite this paper</title><p>Sallas, M.L., Melchiades, J.L., Zabaglia, L.M., do Prado Moreno, J.R., Orcini, W.A., Chen, E.S., de Arruda Cardoso Smith, M., Pay&#227;o, S.L.M. and Rasmussen, L.T. (2017) Prevalence of Helicobacter pylori vacA, cagA, dupA and oipA Genotypes in Patients with Gastric Disease. Advances in Microbiology, 7, 1-9. http://dx.doi.org/10.4236/aim.2017.71001</p></sec></body><back><ref-list><title>References</title><ref id="scirp.73273-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Kao, C.Y., Sheu, B.S. and Wu, J.J. (2016) Helicobacter pylori Infection: An Overview of Bacterial Virulence Factors and Pathogenesis. Biomedical Journal, 39, 14-23.  
https://doi.org/10.1016/j.bj.2015.06.002</mixed-citation></ref><ref id="scirp.73273-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Safavi, M., Sabourian, R. and Foroumadi, A. (2016) Treatment of Helicobacter pylori Infection: Current and Future Insights. World Journal of Clinical Cases, 4, 5-19.  
https://doi.org/10.12998/wjcc.v4.i1.5</mixed-citation></ref><ref id="scirp.73273-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Shiota, S. and Yamaoka, Y. (2014) Biomarkers for Helicobacter pylori Infection and Gastroduodenal Diseases. Biomarkers in Medicine, 8, 1127-1137.  
https://doi.org/10.2217/bmm.14.72</mixed-citation></ref><ref id="scirp.73273-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Vinagre, I.D., Queiroz, A.L., Silva Jr., M.R., Vinagre, R.M. and Martins, L.C. (2015) Helicobacter pylori Infection in Patients with Different Gastrointestinal Diseases from Northern Brazil. Arquivos de Gastroenterologia, 52, 266-271.  
https://doi.org/10.1590/S0004-28032015000400004</mixed-citation></ref><ref id="scirp.73273-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Malfertheiner, P., Bornschein, J. and Selgrad, M. (2010) Role of Helicobacter pylori Infection in Gastric Cancer Pathogenesis: A Chance for Prevention. Journal of Digestive Diseases, 11, 2-11. https://doi.org/10.1111/j.1751-2980.2009.00408.x</mixed-citation></ref><ref id="scirp.73273-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Yamaoka, Y. (2010) Mechanisms of Disease: Helicobacter pylori Virulence Factors. Nature Reviews Gastroenterology and Hepatology, 7, 629-641.  
https://doi.org/10.1038/nrgastro.2010.154</mixed-citation></ref><ref id="scirp.73273-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Yamaoka, Y. and Graham, D.Y. (2014) Helicobacter pylori Virulence and Cancer Pathogenesis. Future Oncology, 10, 1487-1500. https://doi.org/10.2217/fon.14.29</mixed-citation></ref><ref id="scirp.73273-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Shiota, S., Suzuki, R. and Yamaoka, Y. (2013) The Significance of Virulence Factors in Helicobacter pylori. Journal of Digestive Diseases, 14, 341-349.  
https://doi.org/10.1111/1751-2980.12054</mixed-citation></ref><ref id="scirp.73273-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Lu, H., Hsu, P.I., Graham, D.Y. and Yamaoka, Y. (2005) Duodenal Ulcer Promoting Gene of Helicobacter pylori. Gastroenterology, 128, 833-848.  
https://doi.org/10.1053/j.gastro.2005.01.009</mixed-citation></ref><ref id="scirp.73273-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Yamaoka, Y., Kwon, D.H. and Graham, D.Y. (2000) A Mr 34,000 Proinflammatory Outer Membrane Protein (oipA) of Helicobacter pylori. Proceedings of the National Academy of Sciences of the United States of America, 97, 7533-7538.  
https://doi.org/10.1073/pnas.130079797</mixed-citation></ref><ref id="scirp.73273-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Liu, J., He, C., Chen, M., Wang, Z., Xing, C. and Yuan, Y. (2013) Association of Presence/Absence and on/off Patterns of Helicobacter pylori oipA Gene with Peptic Ulcer Disease and Gastric Cancer Risks: A Meta-Analysis. BMC Infectious Diseases, 13, 555.  
https://doi.org/10.1186/1471-2334-13-555</mixed-citation></ref><ref id="scirp.73273-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Sugano, K., Tack, J., Kuipers, E.J., Graham, D.Y., El-Omar, E.M., Miura, S., et al. (2015) Kyoto Global Consensus Report on Helicobacter pylori Gastritis. Gut, 64, 1353-1367.  
https://doi.org/10.1136/gutjnl-2015-309252</mixed-citation></ref><ref id="scirp.73273-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Marshall, B.J. and Warren, J.R. (1984) Unidentified Curved Bacilli in the Stomach of Patients with Gastritis and Peptic Ulceration. The Lancet, 323, 1311-1315.  
https://doi.org/10.1016/S0140-6736(84)91816-6</mixed-citation></ref><ref id="scirp.73273-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Huang, J.Q., Sridhar, S., Chen, Y. and Hunt, R.H. (1998) Meta-Analysis of the Relationship between Helicobacter pylori Seropositivity and Gastric Cancer. Gastroenterology, 114, 1169-1179. https://doi.org/10.1016/S0016-5085(98)70422-6</mixed-citation></ref><ref id="scirp.73273-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Suerbaum, S. and Michetti, P. (2002) Helicobacter pylori Infection. The New England Journal of Medicine, 347, 1175-1186. https://doi.org/10.1056/NEJMra020542</mixed-citation></ref><ref id="scirp.73273-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Ahn, H.J. and Lee, D.S. (2015) Helicobacter pylori in Gastric Carcinogenesis. World Journal of Gastrointestinal Oncology, 7, 455-465.</mixed-citation></ref><ref id="scirp.73273-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Ribeiro, R.B., Martins, H.S., Dos Santos, V.A., El Khouri, M., Duarte, L.S., Burattini, M.N., et al. (2010) Evaluation of Helicobacter pylori Colonization by Serologic Test (IgG) and Dyspepsia in Volunteers from the Countryside of Monte Negro, in the Brazilian Western Amazon Region. Revista do Instituto de Medicina Tropical de S&amp;atilde;o Paulo, 52, 203-206.  
https://doi.org/10.1590/S0036-46652010000400007</mixed-citation></ref><ref id="scirp.73273-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Asrat, D., Nilsson, I., Mengistu, Y., Kassa, E., Ashenafi, S., Ayenew, K., et al. (2004) Prevalence of Helicobacter pylori vacA and cagA Genotypes in Ethiopian Dyspeptic Patients. Journal of Clinical Microbiology, 42, 2682-2684.  
https://doi.org/10.1128/JCM.42.6.2682-2684.2004</mixed-citation></ref><ref id="scirp.73273-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Suzuki, R., Shiota, S. and Yamaoka, Y. (2012) Molecular Epidemiology, Population Genetics, and Pathogenic Role of Helicobacter pylori. Infection, Genetics and Evolution, 12, 203-213. https://doi.org/10.1016/j.meegid.2011.12.002</mixed-citation></ref><ref id="scirp.73273-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Atherton, J.C., Cao, P., Peek Jr., R.M., Tummuru, M.K., Blaser, M.J. and Cover, T.L. (1995) Mosaicism in Vacuolating Cytotoxin Alleles of Helicobacter pylori. Association of Specific vacA Types with Cytotoxin Production and Peptic Ulceration. The Journal of Biological Chemistry, 270, 17771-17777. https://doi.org/10.1074/jbc.270.30.17771</mixed-citation></ref><ref id="scirp.73273-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Suzuki, H., Hibi, T. and Marshall, B.J. (2007) Helicobacter pylori: Present Status and Future Prospects in Japan. Journal of Gastroenterology, 42, 1-15.  
https://doi.org/10.1007/s00535-006-1990-z</mixed-citation></ref><ref id="scirp.73273-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Watada, M., Shiota, S., Matsunari, O., Suzuki, R., Murakami, K., Fujioka, T., et al. (2011) Association between Helicobacter pylori cagA-Related Genes and Clinical Outcomes in Colombia and Japan. BMC Gastroenterology, 11, 141.  
https://doi.org/10.1186/1471-230X-11-141</mixed-citation></ref><ref id="scirp.73273-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Kim, J.Y., Kim, N., Nam, R.H., Suh, J.H., Chang, H., Lee, J.W., et al. (2014) Association of Polymorphisms in Virulence Factor of Helicobacter pylori and Gastroduodenal Diseases in South Korea. Journal of Gastroenterology and Hepatology, 29, 984-991.  
https://doi.org/10.1111/jgh.12509</mixed-citation></ref><ref id="scirp.73273-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Sasaki, T., Hirai, I. and Yamamoto, Y. (2009) Analysis of Helicobacter pylori Infection in a Healthy Panamanian Population. Kansenshogaku Zasshi, 83, 127-132.  
https://doi.org/10.11150/kansenshogakuzasshi.83.127</mixed-citation></ref><ref id="scirp.73273-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Yamaoka, Y., Kodama, T., Kita, M., Imanishi, J., Kashima, K. and Graham, D.Y. (1999) Relation between Clinical Presentation, Helicobacter pylori Density, Interleukin 1Beta and 8 Production, and cagA Status. Gut, 45, 804-811. https://doi.org/10.1136/gut.45.6.804</mixed-citation></ref><ref id="scirp.73273-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Shiota, S., Matsunari, O., Watada, M., Hanada, K. and Yamaoka, Y. (2010) Systematic Review and Meta-Analysis: The Relationship between the Helicobacter pylori dupA Gene and Clinical Outcomes. Gut Pathogens, 2, 13. https://doi.org/10.1186/1757-4749-2-13</mixed-citation></ref><ref id="scirp.73273-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Gomes, L.I., Rocha, G.A., Rocha, A.M., Soares, T.F., Oliveira, C.A., Bittencourt, P.F., et al. (2008) Lack of Association between Helicobacter pylori Infection with dupA-Positive Strains and Gastroduodenal Diseases in Brazilian Patients. International Journal of Medical Microbiology, 298, 223-230. https://doi.org/10.1016/j.ijmm.2007.05.006</mixed-citation></ref><ref id="scirp.73273-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Souod, N., Sarshar, M., Dabiri, H., Momtaz, H., Kargar, M., Mohammadzadeh, A., et al. (2015) The Study of the oipA and dupA Genes in Helicobacter pylori Strains and Their Relationship with Different Gastroduodenal Diseases. Gastroenterology and Hepatology from Bed to Bench, 8, S47-S53.</mixed-citation></ref><ref id="scirp.73273-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Yamaoka, Y., Kikuchi, S., El-Zimaity, H.M., Gutierrez, O., Osato, M.S. and Graham, D.Y. (2002) Importance of Helicobacter pylori oipA in Clinical Presentation, Gastric Inflammation, and Mucosal Interleukin 8 Production. Gastroenterology, 123, 414-424.  
https://doi.org/10.1053/gast.2002.34781</mixed-citation></ref></ref-list></back></article>