<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">ABB</journal-id><journal-title-group><journal-title>Advances in Bioscience and Biotechnology</journal-title></journal-title-group><issn pub-type="epub">2156-8456</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/abb.2016.710041</article-id><article-id pub-id-type="publisher-id">ABB-71646</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Rapid Screening of Recombinant Plasmids by Direct Colony Quantitative Real-Time PCR
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lei</surname><given-names>Hou</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Xiuying</surname><given-names>Zhang</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yang</surname><given-names>Li</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Shuai</surname><given-names>Chen</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hongyi</surname><given-names>Qu</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jiazhi</surname><given-names>Yu</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Lianhai</surname><given-names>Zhang</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ziyi</surname><given-names>Fan</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff3"><addr-line>Qilu Hospital of Shandong University, Jinan, China</addr-line></aff><aff id="aff5"><addr-line>Liao City Municipal Hospital, Liaocheng, China</addr-line></aff><aff id="aff4"><addr-line>Qianfo Mt. Hospital of Shandong University, Jinan, China</addr-line></aff><aff id="aff2"><addr-line>Shandong Prosthetics Orthotics Rehabilitation Center, Jinan, China</addr-line></aff><aff id="aff1"><addr-line>Department of Thyroid and Breast Surgery, General Hospital of Jinan Military Command, Jinan, China</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>vstelo@163.com(ZF)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>29</day><month>09</month><year>2016</year></pub-date><volume>07</volume><issue>10</issue><fpage>428</fpage><lpage>433</lpage><history><date date-type="received"><day>October</day>	<month>6,</month>	<year>2016</year></date><date date-type="rev-recd"><day>Accepted:</day>	<month>October</month>	<year>28,</year>	</date><date date-type="accepted"><day>October</day>	<month>31,</month>	<year>2016</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Quantitative real-time PCR (qPCR) was applied to rapid screening of positive plasmid clones. Insert-specific primer pairs were used in qPCR colony screening, and false positive colonies could easily be distinguished from true positive ones by comparing their Ct values. In addition, qPCR is particularly suitable when amplicon is small (&lt;150 bp). This method is sensitive, simple and fast, obviates the need for gel electrophoresis, and is a cost-effective alternative to the traditional PCR approach.
 
</p></abstract><kwd-group><kwd>qPCR</kwd><kwd> Colony PCR</kwd><kwd> Plasmid Screening</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Plasmid DNA recombination is the core technique in molecular biology, which is essential for many experimental purposes such as DNA amplification, DNA library construction, protein expression, ShRNA gene knockdown, and in the recent CRISPR/Cas 9 mediated mammalian genome editing [<xref ref-type="bibr" rid="scirp.71646-ref1">1</xref>] . Generally, recombinant plasmids are constructed as follows: circular plasmid DNA is cleaved with one or more restriction enzymes and ligated in vitro to foreign DNA bearing compatible termini. The ligation mixture is subsequently transformed into an appropriate strain of E. coli. The resulting transformed E. coli grown on appropriate selective medium contains recombinant plasmids or self-ligated vector colonies, which are subsequently screened for colonies containing the desired DNA insert with the right orientation [<xref ref-type="bibr" rid="scirp.71646-ref2">2</xref>] .</p><p>Traditionally, plasmid cloning is characterized by picking bacterial colonies, growing bacteria in selective medium overnight, preparing plasmid DNA, and digesting with restriction enzymes. This remains the definitive and often time tested method [<xref ref-type="bibr" rid="scirp.71646-ref2">2</xref>] . However, it can be very tedious and labor intensive when a large number of colonies have to be screened in some difficult cloning procedures [<xref ref-type="bibr" rid="scirp.71646-ref2">2</xref>] . Over the years, many methods have been devised to distinguish bacteria transformed by recombinant plasmids from those carrying empty wild-type plasmids. The most durable and general one of these methods uses a nondestructive histochemical procedure to detect β-galactosidase activity in transformed bacteria. This procedure is commonly used as a test to distinguish colorless colonies of bacterial cells that carry recombinant plasmids from blue colored ones that carry the wild type plasmids. However, false positive colonies remain a major concern for this technique. Alternatively, in situ hybridization methods may be used to identify with certainty bacterial colonies that have been transformed with recombinant plasmids which carry specific sequences of foreign DNA. Other generally useful methods including colony PCR are available to analyze the size of recombinant plasmids and to screen transformed colonies [<xref ref-type="bibr" rid="scirp.71646-ref3">3</xref>] . Today, colony PCR is commonly used to screen bacterial transformants. In this study, we report a sensitive, simple and fast plasmid screening method by using colony quantitative real-time PCR (qPCR).</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Materials</title><p>1) 2 x SYBR Green PCR master mix (life technologies).</p><p>2) 1.5uM stock solution of each oligonucleotide primer.</p><p>3) PCR-grade water.</p><p>4) Real-time thermal cycler (BIO-RAD).</p></sec><sec id="s2_2"><title>2.2. Methods</title><p>1) Following bacterial transformations, check the plates and pick the suitable colonies (1 - 2 mm in diameter) with a sterile 200 ul pipette tip and suspend it in 50 ul sterile water by pipetting up and down a couple of times.</p><p>2) Quantitative real-time PCR reaction. 10ul real-time PCR reaction contains the following: 5 ul 2 x SYBR Green PCR master mix, 1 ul forward and reverse primer mixture, 2 ul water and 2 ul bacterial mixture from step 1. Empty vector alone is used as negative control. The cycling conditions were: an initial denaturation step at 95˚C for 10 min followed by 40 cycles of 95˚C (15 s), 60˚C (1 min) in a real-time thermal cycler.</p><p>3) 20 ul traditional PCR reaction contains the following: 10 ul 2 x Phusion Flash PCR master mix (Thermo Scientific), 2 ul forward and reverse primer mixture, 4 ul water and 4 ul bacterial mixture from step 1. Empty vector alone is used as negative control. The PCR conditions were programmed as follows: an initial denaturation step at 98˚C for 10 seconds followed by 35 cycles of 98˚C (1 second), 55˚C (5 seconds), 72˚C (30 seconds). After 35 cycles, additional extension at 72˚C for 1 minute was added, then PCR products were separated on agarose gel.</p><p>4) The rest of bacterial mixture of positive colonies can be transferred to 5 ml LB media containing appropriate antibiotics to grow overnight for plasmid DNA mini- preparations.</p><p>5) Mini-preparation plasmids were digested by restriction enzymes and sequenced.</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><p>Following qPCR, the Ct curves of positive colonies started going up between 10 and 20 cycles (<xref ref-type="fig" rid="fig1">Figure 1</xref>) compared to negative control and wild type plasmids. The positive colonies were validated by subsequent mini-preparation, restriction enzyme digestion and DNA sequencing (data no shown).</p><p>Occurrence of false positives as high as 90% is a major disadvantage associated with traditional colony PCR [<xref ref-type="bibr" rid="scirp.71646-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.71646-ref4">4</xref>] when only insert-specific primer pairs are used for screening. The false positives have been attributed to unligated insert from ligation mixture, picked up with the colony from the plate, worked as a template, and amplified</p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Three different gene coding sequences were cloned into pCMV-3FLAG vector (stratagene) at EcoRI and XhoI sites, and transformed into Dh5α competence bacteria. Vector-based T3 forward and gene specific reverse primer pairs were used for quantitative real- time PCR colony screening</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/6-7301255x2.png"/></fig><p>in the PCR reaction [<xref ref-type="bibr" rid="scirp.71646-ref4">4</xref>] . Although the use of vector-specific and insert primer pair eliminates false positives, this requirement limits the use of colony PCR to plasmids where vector-specific primers are available [<xref ref-type="bibr" rid="scirp.71646-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.71646-ref4">4</xref>] . Another technique to avoid false positives is to use a simple single-tube technique involving pre-PCR nuclease incubation [<xref ref-type="bibr" rid="scirp.71646-ref4">4</xref>] . A recent work by Skarratt et al. [<xref ref-type="bibr" rid="scirp.71646-ref5">5</xref>] shows that false positives can easily be distinguished from true positives by comparing Ct values derived from qPCR amplifications curves. In agreement with this observation, we found that when we only used insert-specific primer pairs for transformant screening, amplification cycle after 27 cycles always indicated a negative clone, while clones amplified within 20 cycles was confirmed to be positive by restriction digestion after mini-preparation (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b), <xref ref-type="fig" rid="fig2">Figure 2</xref>(d)). Also, no false positive clones were detected by qPCR. However, traditional colony PCR results showed that all colonies contained amplified bands, even though in some negative colonies the PCR bands looked weaker compared to positive ones (<xref ref-type="fig" rid="fig2">Figure 2</xref>(c)). Our data further confirm that colony qPCR eliminated false positive results, and insert-</p><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Human genomic micro RNA 136 stem loop and flanking sequences (520 bp) were cloned into PCDH lentiviral vector (SBI) by PCR-based strategies at NheI and NotI sites, and transformed into Dh5α competence bacteria. (a) 16 colonies were screened by qPCR with cloning PCR primers. (b) Ct value of each colony. (c) 4 ul bacterial mixture was amplified in 20 ul traditional PCR reaction for 35 cycles and separated on 1.2% agarose gel. (d) Mini-preparation plasmid DNA from the colonies were digested with NheI and NotI at 37˚C for 1 hour then separated on 1.2% agarose gel</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/6-7301255x3.png"/></fig><p>specific primers could be exploited for screening bacterial transformants in this system.</p><p>The optimal amplicon length in a SYBR Green qPCR is 75 - 150 bp [<xref ref-type="bibr" rid="scirp.71646-ref6">6</xref>] . It rarely meets this requirement when insert-specific primer pairs are used for screening, unless new screening primers are designed and synthesized. In this study, we used PCR cloning primers for screening; if amplicon was bigger than 1 kb, we extended annealing and extension time to 2 minutes. We tried the latter method in a screening when the amplicon was about 1.5 kb. We did observe decreased qPCR reaction efficiency when amplicon was bigger than 1 kb, since both Ct values increased for positive and negative colonies when amplicons became larger. However, this did not compromise the sensitivity of the technique, as there existed significant Ct differences between positive colonies and negative ones (data not shown).</p><p>CRISPR/Cas9 system is a novel powerful tool for mammalian genome editing by simply specifying a 20-nt targeting sequence within its guide RNA [<xref ref-type="bibr" rid="scirp.71646-ref1">1</xref>] . Currently we use this system extensively in our laboratory to establish gene knockout cell lines. Construction of an expression plasmid for single-guide RNA (sgRNA) is simple and rapid, involving a single cloning step with a pair of partially complementary oligonucleotides. The oligo pairs encoding the 20-nt guide sequences are annealed and ligated into a CRISPR/Cas9 vector [<xref ref-type="bibr" rid="scirp.71646-ref7">7</xref>] . Since this kind of insert is very small, it is usually not feasible to screen positive recombinants by traditional restriction enzyme digestions. Colony quantitative real-time PCR is especially convenient for this kind of plasmid screening. We used vector-based U6 forward sequencing primer (recommended by the vendor) and reverse oligo insert as screening primers, as shown in <xref ref-type="fig" rid="fig3">Figure 3</xref>, two of the five</p><fig-group id="fig3"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> (a) Oligos of sgRNA against human GATA2 were ordered from Fisher (Forward: 5’ CACCGAGGGGTTGCCCTGCGAGTCG 3’ and Reverse: 5’ AAACCGA CTC GCA GGG CAA CCC CTC3’). The oligos were annealed and ligated into the pX458 vector digested with BbsI, then transformed into Dh5α competence bacteria. Five colonies were picked and screened by qPCR with U6 forward primer (5’ GAGGGCCTATTTCCCATGATTCC 3’) and above-mentioned reverse primer. B, 4 ul bacterial mixture was amplified in 20 ul traditional PCR reaction for 35 cycles with the same primer pairs in qPCR and separated on 2% agarose gel.</title></caption><fig id ="fig3_1"><label> (b)</label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/6-7301255x5.png"/></fig></fig-group><p>tested colonies were positive in qPCR and traditional PCR, suggesting that these two colonies contained the desired recombinant. This result was further confirmed by DNA sequencing. However, traditional PCR showed very weak band even after 35 cycle amplification, because the amplified product was small (110 bp) and factored by input DNA. We believe that quantitative real-time PCR is extremely suitable for small-size insert plasmid screening especially when amplicon is small (&lt;150 bp), while small amplicon detection is relatively difficult for traditional PCR.</p><p>To test the viability of inoculated bacteria in sterile water (method step 1) with time, we stored the bacterial mixture at room temperature for 2 or 8 hours, then grew them in 5 ml LB containing appropriate antibiotics overnight, and the plasmid mini-prepa- ration didn’t show any difference between them, suggesting that storage time was not a big concern for the viability of bacteria in sterile water.</p><p>qPCR colony screening is fast and simple, with results visualize “real-time” by using a computer. Generally we know the results within one hour of plate-run on the machine rather than 2 - 4 hours for traditional PCR combined with gel electrophoresis. It also allows screening a large number of colonies in one experiment.</p><p>In conclusion, insert-specific primer pairs can be used in qPCR colony screening. This method obviates traditional PCR detection techniques circumventing the duration and is economical for analysis on a regular basis.</p></sec><sec id="s4"><title>Cite this paper</title><p>Hou, L., Zhang, X.Y., Li, Y., Chen, S., Qu, H.Y., Yu, J.Z., Zhang, L.H. and Fan, Z.Y. (2016) Rapid Screening of Recombinant Plasmids by Direct Colony Quantitative Real-Time PCR. Advances in Bioscience and Biotechnology, 7, 428-433. http://dx.doi.org/10.4236/abb.2016.710041</p></sec></body><back><ref-list><title>References</title><ref id="scirp.71646-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X., Jiang, W., Marraffini, L.A. and Zhang, F. (2013) Multiplex Genome Engineering Using CRISPR/Cas Systems. Science, 339, 819-823. http://dx.doi.org/10.1126/science.1231143</mixed-citation></ref><ref id="scirp.71646-ref2"><label>2</label><mixed-citation publication-type="book" xlink:type="simple">Lu, S. (2003) Rapid Screening of Recombinant Plasmids. In: Casali, N. and Preston, A., Eds., Methods in Molecular Biology, Vol. 235: E. coli Plasmid Vectors, Humana, Totawa, 169-174.</mixed-citation></ref><ref id="scirp.71646-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Dallas-Yang, Q., Jiang, G. and Sladek, M. (1998) Avoiding False Positives in Colony PCR. Biotechniques, 24, 580-581.</mixed-citation></ref><ref id="scirp.71646-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Agrawal, V. and Roy, N. (2008) Contaminating Insert Degradation by Preincubation Colony PCR: A Method for Avoiding False Positives in Transformant Screening. Analytical Biochemistry, 375, 159-161. http://dx.doi.org/10.1016/j.ab.2007.11.029</mixed-citation></ref><ref id="scirp.71646-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Skarratt, K.K. and Fuller, S.J. (2014) Quantitative Real-Time PCR Eliminates False-Positives in Colony Screening PCR. Journal of Microbiological Methods, 96, 99-100. 
http://dx.doi.org/10.1016/j.mimet.2013.11.011</mixed-citation></ref><ref id="scirp.71646-ref6"><label>6</label><mixed-citation publication-type="book" xlink:type="simple">Thornton, B. and Basu, C. (2015) Rapid and Simple Method of qPCR Primer Design. In: Basu, C., Ed., PCR Primer Design, Vol. 1275: Methods in Molecular Biology, Springer, New York, 173-179. http://dx.doi.org/10.1007/978-1-4939-2365-6_13</mixed-citation></ref><ref id="scirp.71646-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Ran, F.A., Hsu, P.D., Wright, J., Agarwala, V., Scott, D.A. and Zhang, F. (2013) Genome Engineering Using the CRISPR-Cas9 System. Nature Protocols, 8, 2281-2308. 
http://dx.doi.org/10.1038/nprot.2013.143</mixed-citation></ref></ref-list></back></article>