<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJMB</journal-id><journal-title-group><journal-title>American Journal of Molecular Biology</journal-title></journal-title-group><issn pub-type="epub">2161-6620</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajmb.2016.64015</article-id><article-id pub-id-type="publisher-id">AJMB-71618</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Genotyping of &lt;i&gt;E. coli&lt;/i&gt; Isolated from Urinary Tract Infection Patients Containing B-Lactamase Resistance Gene CTX-M Group 1 in Sanandaj Medical Health Centers
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Arezoo</surname><given-names>Omati</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Kambiz</surname><given-names>Davari</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Borhan</surname><given-names>Shokrolahi</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Biology, Islamic Azad University, Rasht Branch, Rasht, Iran</addr-line></aff><aff id="aff2"><addr-line>Department of Biology, Islamic Azad University, Sanandaj Branch, Sanandaj, Iran</addr-line></aff><aff id="aff3"><addr-line>Department of Animal Science, Faculty of Agriculture, Islamic Azad University, Sanandaj Branch, Sanandaj, Iran</addr-line></aff><pub-date pub-type="epub"><day>13</day><month>10</month><year>2016</year></pub-date><volume>06</volume><issue>04</issue><fpage>159</fpage><lpage>169</lpage><history><date date-type="received"><day>August</day>	<month>11,</month>	<year>2016</year></date><date date-type="rev-recd"><day>Accepted:</day>	<month>October</month>	<year>25,</year>	</date><date date-type="accepted"><day>October</day>	<month>28,</month>	<year>2016</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  CTX-M-producing bacteria are known as a resistant source against 
  oxyimino-cephalosporin such as cefotaxime and ceftazidime; although laboratory diagnosis of this gene has not been properly defined. The aims of this study are determining the rates of prevalence of CTX-M and CTX-M group 1 in the 
  Escherichia coli (
  E. coli) obtained from urinary tract infections (UTI), and also determining their genetic relationship in the city of Sanandaj. In current study, 180 
  E. coli strains isolated from urinary tract infections were used. Sensitivity to common antibiotics was studied by the disc diffusion method. Phenotypic detection of isolated ESBL-producing starins was done by the combination disc test. CTX-M and CTX-M1 genes were detected using the PCR method and finally, the possible clonal relationship between isolates was determined using the REP-PCR method. 89 samples were ESBL-positive. The PCR assay used for detecting the CTX-M gene, showed that 48 samples out of 180 samples (26.66%) contained that gene; also among these 48 samples, 23 (12.77%) had CTX-M group 1. Based on the REP-PCR assay, 48 genotypes among 48 samples were CTX-M-positive. Results from the REP-PCR assay indicated that the clonal propagation theory of one epidemic strain of 
  Escherichia coli is not apply, 
  i.e. all CTX-M-producing species are not originated from one single strain and the gene is spread between different isolates. Therefore, hospitals and their employees must be more hygiene and, proper disposal of hospital waste can help to prevent the spread of different resistances.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Escherichia coli&lt;/i&gt;</kwd><kwd> Urinary Tract Infection</kwd><kwd> ESBL</kwd><kwd> CTX-M</kwd><kwd> CTX-M Group 1</kwd><kwd> REP-PCR</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Extended-spectrum beta-lactamases (ESBLs) were reported for the first time in Germany 1983 [<xref ref-type="bibr" rid="scirp.71618-ref1">1</xref>] . The CTX-M family of ESBLs is a serious threat for global health [<xref ref-type="bibr" rid="scirp.71618-ref2">2</xref>] to the extent that in the previous decade, it was described pandemic [<xref ref-type="bibr" rid="scirp.71618-ref3">3</xref>] . CTX-M is the most prevalent ESBL in antrobactericeas that produce nosocomial and society-acquired infections [<xref ref-type="bibr" rid="scirp.71618-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.71618-ref4">4</xref>] . CTX-M genes are usually found on plasmids and derivative chromosomes of Beta-lactamase genes are from the Kluyvera spp. genus which are created by “multiple delivery mechanisms” [<xref ref-type="bibr" rid="scirp.71618-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.71618-ref5">5</xref>] . Normally, these plasmids are easily spread among microbial populations and they carry the resistant genes against other antibiotics such as aminoglycoside acetyltransferases and dihydropteroate synthases or other beta-lactamases [<xref ref-type="bibr" rid="scirp.71618-ref6">6</xref>] . This increase in resistance, to a large extend, is due to the spread of E. coli bacteria and Klebsiella pneumonia that carry CTX-M [<xref ref-type="bibr" rid="scirp.71618-ref7">7</xref>] . CTX-M group 1 contains six plasmid-dependent enzymes namely: CTX-M-1, CTX-M-3, CTX-M-10, CTX- M-12, CTX-M-15 and FEC-1 and, unprinted enzymes of CTX-M-22, CTX-M-23 and CTX-M-28 (corresponding gene bank numbers respectively are AY080894, AF488377 and AJ549244) [<xref ref-type="bibr" rid="scirp.71618-ref2">2</xref>] . For epidemiological study and determining the genetic relationships of resistant isolates, a rapid typing method could be a valuable tool. Repetitive Element Palindromic PCR (REP-PCR) is a suitable method for proliferation of repetitive elements of bacterial DNA, with the following characteristics: 1) low costs, 2) high discriminatory power, 3) high speed, and 4) reliable tool for typing and classification of a wide range of Gram-negative and some Gram-positive bacteria [<xref ref-type="bibr" rid="scirp.71618-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.71618-ref9">9</xref>] .</p><p>A lot of research has been done on identifying CTX-M in E. coli. Woodford et al. (2004) conducted a study to identify the CTX-M in E. coli isolated from community and hospital in Britain. In this study, 291 CTX-M-producing samples were identified in Britain which 279 sample involved CTX-M 1and 12 samples involved CTX-M-9. The result of dendrogram indicated that 279 CTX-M-producing samples are related with each other’s [<xref ref-type="bibr" rid="scirp.71618-ref10">10</xref>] .</p><p>Leila Nasehi et al. (2010) studied the CTX-M, PER, SHV and TEM β-lactamase prevalence in Lebsiella pneumoniae isolated from clinical samples in Tehran. The results indicated that the prevalence of blaSHV, blaCTX-M, and blaTEM gens was 7.5%, 16%, 22.5 % and 23%, respectively [<xref ref-type="bibr" rid="scirp.71618-ref11">11</xref>] .</p><p>According to the above description, the aims of this study are determining the rate of prevalence of CTX-M and CTX-M group 1 genes in the Escherichia coli responsible for urinary tract infection and, determining the genetic relationship between isolated starin using the typing method of REP-PCR.</p></sec><sec id="s2"><title>2. Material and Methods</title><sec id="s2_1"><title>2.1. Sampling</title><p>In 2015, 325 urine samples were collected from Sanandaj laboratories. E. coli isolated in 180 samples that their presence were confirmed by biochemical test.</p></sec><sec id="s2_2"><title>2.2. Antibiotic Sensitivity and Phenotypic Identification of ESBLs</title><p>The antibiotic sensitivity of the samples was conducted using the disc diffusion method and based on the Clinical and Laboratory Standards Institute (CLSI standards); also, the antibiotics that were used are listed in <xref ref-type="table" rid="table2">Table 2</xref>. ESBL-producing isolates were detected by the CLSI combination disc test [<xref ref-type="bibr" rid="scirp.71618-ref12">12</xref>] . At first, bacterial suspensions equivalent to Mc-Farland half of resistant isolates were cultured on Molar-Hinton agar media; then, two Ceftazidime and Cefotaxime discs and also, two discs of these materials combined with clavulanic acid were placed 25 mm apart on the media. After incubation, if the difference in diameters of the halos around the combined discs and the halos of the initial discs is ≥5 mm, the isolate is considered as a positive ESBLs phenotype.</p></sec><sec id="s2_3"><title>2.3. Determining MIC by the E-Test</title><p>The E-test was performed with the antibiotics of Ceftazidime and Cefotaxime for all the samples that were detected as ESBLs. In this method, after making a bacterial suspension by the Mc-Farland half method, it was placed on the Molar Hinton agar plate; then, E-test strips, each representing one specific antibiotic, were placed on the Molar Hinton agar and after 24 h of incubation in 37˚C, a triangular growth zones of inhibition was formed. Then by referring to the table provided by the company that had created the E-test strips, the susceptibility of E. coli bacteria to the mentioned antibiotics was determined.</p></sec><sec id="s2_4"><title>2.4. DNA Extraction</title><p>DNA of the bacterium was extracted using gram-negative DNA extraction kit (Sina Gene, Iran). The extracted DNA was checked by the agar gel electrophoresis.</p></sec><sec id="s2_5"><title>2.5. Detection of Resistant Genes</title><p>In this study,primers from previous studies were used which their characteristics are listed in <xref ref-type="table" rid="table1">Table 1</xref> [<xref ref-type="bibr" rid="scirp.71618-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.71618-ref14">14</xref>] . The PCR reaction was done with the final volume of 25 &#181;l that contained 12.5 &#181;l of PCR Master Mix (containing DNA polymerase, salts, magnesium, dNTPs and optimized reaction buffer), 1 &#181;l of each primer, 2 &#181;l of the sample’s DNA and 8.5 &#181;l distilled water. The conditions of reaction for each primer are shown in <xref ref-type="table" rid="table1">Table 1</xref>. The product of PCR was analyzed by electrophoresis in agar gel 1.5% and finally it was visible under UV.</p></sec><sec id="s2_6"><title>2.6. REP-PCR</title><p>In order to determine the genetic relationships between ESBL-producing samples, the</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers and the conditions of their reaction</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Product size</th><th align="center" valign="middle" >PCR condition</th><th align="center" valign="middle" >Primer (5&#180;→3&#180;)</th><th align="center" valign="middle" >Target</th></tr></thead><tr><td align="center" valign="middle" >759 bp</td><td align="center" valign="middle" >94˚C, 5 min; 35 cycles of 94˚C, 45 s; 58˚C, 45 s; 72˚C, 60 s</td><td align="center" valign="middle" >Forward ACGCTGTTGTTAGGAAGTG Reverse TTGAGGCTGGGTGAAGT</td><td align="center" valign="middle" >CTX-M</td></tr><tr><td align="center" valign="middle" >864 bp</td><td align="center" valign="middle" >94˚C, 2 min; 30 cycles of 95˚C, 45 s; 58˚C, 30 s; 72˚C, 45 s</td><td align="center" valign="middle" >Forward GGTTAAAAAATCACTGCGTC Reverse TTGGTGACGATTTTAGCCGC</td><td align="center" valign="middle" >CTX-M-1 group</td></tr></tbody></table></table-wrap><p>typing method of REP-PCR was used. The REP-PCR reaction was done with the final volume of 25 &#181;l containing: 12.5 &#181;l of PCR Master Mix, 1 &#181;l of the sample’s DNA, 1 &#181;l of each primer and 9.5 &#181;l distilled water. REP1 (5'-IIIGCGCCGICATCAGGC-3') and REP2 (ACGTCTTATCAGGCCTAC-3') primers were used for amplification of repetitive sequences in the bacterial genome [<xref ref-type="bibr" rid="scirp.71618-ref15">15</xref>] . The reaction took place in XP Thermal Cycler with the following circumstances: Initial denaturation (2 min at 95˚C), then, 35 cycles of denaturation (1 min at 92˚C), annealing (1 min at 40˚C), extension (8 min at 65˚C) and at last, final extension (8 min at 65˚C). The products of REP-PCR were electrophoresed in Agar gel 1.5%. In the end, the bonds became visible by UV ray and then the image was recorded. The dendrogram relating to the analysis of fingerprinting was drawn by the algorithm of the Unweighted Pair-Group Method (UPGMA) using the software NTSYS v2.02e.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Bacterial Isolated</title><p>All the samples were separated from different patients that had referred to sanandaj diagnostic laboratories. The rates of prevalence of urinary tract infection based on sex and age are shown in <xref ref-type="fig" rid="fig1">Figure 1</xref> and it is logical that UTIs are more prevalent in women.</p></sec><sec id="s3_2"><title>3.2. Sample Antibiotic Sensitivity</title><p>CLSI standard was used to determine the sensitivity. Samples sensitivity to antibiotics was measured and presented in <xref ref-type="table" rid="table2">Table 2</xref> as sensitive, semi sensitive, and resistant.</p></sec><sec id="s3_3"><title>3.3. Phenotypic Detection of ESBL Producers</title><p>89 E. coli samples (49.44%) were detected as ESBL producers by the combination disc test (<xref ref-type="fig" rid="fig2">Figure 2</xref>). Antibiotic susceptibility of the positive- and negative-ESBL samples are compared in <xref ref-type="fig" rid="fig3">Figure 3</xref>.</p></sec><sec id="s3_4"><title>3.4. Results of E-Test</title><p>The results of this E-test for the ESBL-producing samples were in the range of 2 - 4 &#181;g/ml for Cefotaxime and 1 - 16 &#181;g/ml for Ceftazidime (<xref ref-type="fig" rid="fig4">Figure 4</xref>).</p></sec><sec id="s3_5"><title>3.5. Detection of Resistant Genes</title><p>Among SBL-producing samples, 48 out of 89 samples contained the CTX-M gene; also 23 out of 48 samples, were detected as CTX-M group 1.</p><fig-group id="fig1"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title>(a) The rate of prevalence of UTI based on sex; (b) The rate of prevalence of UTI based on age.</title></caption><fig id ="fig1_1"><label>(b)</label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-1070247x2.png"/></fig><fig id ="fig1_2"><label></label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-1070247x3.png"/></fig></fig-group><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Phenotypic detection of ESBL producers by the combination disc test</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-1070247x4.png"/></fig><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Comparison of the susceptibility profiles of positive and negative ESBL-producing E. coli</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-1070247x5.png"/></fig><fig id="fig4"  position="float"><label><xref ref-type="fig" rid="fig4">Figure 4</xref></label><caption><title> Non-growth triangle due to increased antibiotic density around T-Test strip</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-1070247x6.png"/></fig><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Results of antibiotic sensitivity determination based on disc diffusion</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" >Resistant N. (%)</th><th align="center" valign="middle" >Intermediate N. (%)</th><th align="center" valign="middle" >Susceptible N. (%)</th></tr></thead><tr><td align="center" valign="middle" >Cefotaxime</td><td align="center" valign="middle" >144 (57.8)</td><td align="center" valign="middle" >8 (4.4)</td><td align="center" valign="middle" >68 (37.8)</td></tr><tr><td align="center" valign="middle" >Ciprofloxacin</td><td align="center" valign="middle" >87 (48.3)</td><td align="center" valign="middle" >22 (12.2)</td><td align="center" valign="middle" >71 (39.4)</td></tr><tr><td align="center" valign="middle" >Ceftriaxon</td><td align="center" valign="middle" >72 (40)</td><td align="center" valign="middle" >25 (13.9)</td><td align="center" valign="middle" >83 (46.1)</td></tr><tr><td align="center" valign="middle" >Carbenicillin</td><td align="center" valign="middle" >67 (37.3)</td><td align="center" valign="middle" >17 (9.4)</td><td align="center" valign="middle" >96 (53.3)</td></tr><tr><td align="center" valign="middle" >Ceftazidime</td><td align="center" valign="middle" >59 (32.8)</td><td align="center" valign="middle" >35 (19.4)</td><td align="center" valign="middle" >86 (41.8)</td></tr><tr><td align="center" valign="middle" >Imipeneme</td><td align="center" valign="middle" >81 (45)</td><td align="center" valign="middle" >24 (13.3)</td><td align="center" valign="middle" >75 (41.7)</td></tr><tr><td align="center" valign="middle" >Cefepime</td><td align="center" valign="middle" >52 (28.9)</td><td align="center" valign="middle" >16 (8.9)</td><td align="center" valign="middle" >112 (62.2)</td></tr><tr><td align="center" valign="middle" >Piperacillin</td><td align="center" valign="middle" >111 (61.7)</td><td align="center" valign="middle" >25 (13.9)</td><td align="center" valign="middle" >44 (24.4)</td></tr><tr><td align="center" valign="middle" >Amikacin</td><td align="center" valign="middle" >39 (21.7)</td><td align="center" valign="middle" >33 (18.3)</td><td align="center" valign="middle" >108 (60)</td></tr><tr><td align="center" valign="middle" >Piperacillin-tazobactam</td><td align="center" valign="middle" >38 (21.1)</td><td align="center" valign="middle" >46 (25.6)</td><td align="center" valign="middle" >96 (53.3)</td></tr><tr><td align="center" valign="middle" >Gentamicine</td><td align="center" valign="middle" >54 (30)</td><td align="center" valign="middle" >8 (4.4)</td><td align="center" valign="middle" >118 (65.6)</td></tr></tbody></table></table-wrap></sec><sec id="s3_6"><title>3.6. Results of REP-PCR</title><p>The next step was determining the genetic relationship between the samples. After drawing the dendrogram for the obtained results from REP-PCR (<xref ref-type="fig" rid="fig5">Figure 5</xref>), ESBL- producing samples which were patterned as the samples that had 100% genetic similarity, were considered as one pattern and, other samples each were considered as a separate pattern. Based on this, 89 patterns exist among 89 ESBL-producing samples; so 89 positive-ESBL samples, had 89 different genotypes (<xref ref-type="fig" rid="fig6">Figure 6</xref>).</p><p>In this dendrogram, 10 clusters which labeled by letters A-J can be observed. Each cluster A-C-D-F-G-H is divided by two sub-clusters.</p><fig id="fig5"  position="float"><label><xref ref-type="fig" rid="fig5">Figure 5</xref></label><caption><title> Bands created by rep-PCR for sample type</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-1070247x7.png"/></fig><fig id="fig6"  position="float"><label><xref ref-type="fig" rid="fig6">Figure 6</xref></label><caption><title> Dendrogram related to rep-PCR analysis shows 89 genetic patterns in 89 ESBL producing samples</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-1070247x8.png"/></fig></sec></sec><sec id="s4"><title>4. Discussion</title><p>In 1992, a new type of ESBL that gave high level of resistance against Cefotaxime to bacteria was detected in members of Antrobactericeas [<xref ref-type="bibr" rid="scirp.71618-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.71618-ref17">17</xref>] . This new family of ESBLs are from the class A in the Ambler’s classification. As mentioned before, CTX-M is described pandemic. According to several reports, the number of CTX-M B. lactamases is rapidly increasing [<xref ref-type="bibr" rid="scirp.71618-ref18">18</xref>] . In some reports from France [<xref ref-type="bibr" rid="scirp.71618-ref19">19</xref>] , Sweden [<xref ref-type="bibr" rid="scirp.71618-ref20">20</xref>] , and India [<xref ref-type="bibr" rid="scirp.71618-ref21">21</xref>] as well, the prevalence of this B. In a study performed in Tabriz on 188 E. coli separated from urine samples of outpatient and hospitalized patients, it was revealed that 84.1% of the isolates were contained the CTX-M type 1 B. lactamase gene [<xref ref-type="bibr" rid="scirp.71618-ref22">22</xref>] . In order to find a suitable strategy for stopping further spread of this gene, worldwide studies are required. According to <xref ref-type="fig" rid="fig1">Figure 1</xref>, UTI is most prevalent in ages between 16 - 30 and 31 - 45. This result could be attributed to this fact that most sexual intercourses occur in these periods. Also, UTI was more prevalent in women, which seem logical because of anatomical reasons.</p><p>In this study, CTX-M gene was detected in the E. coli isolated separated from UTIs in a specified period (2015). 48 out of 89 ESBL-producing samples (53.93%) contained the CTX-M gene. In addition, the results indicated that 23 samples (47.91%) of these 48, contained CTX-M group 1. Our findings showed the high prevalence of CTX-M enzyme in the ESBL-producing E. coli in the Sanandaj. Furthermore, it was observed that almost half of these enzymes were from the CTX-M group 1. CTX-M-15, which is in CTX-M group 1, has the most rate of prevalence worldwide [<xref ref-type="bibr" rid="scirp.71618-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.71618-ref23">23</xref>] [<xref ref-type="bibr" rid="scirp.71618-ref24">24</xref>] . As it can be seen in <xref ref-type="fig" rid="fig2">Figure 2</xref>, ESBL-producing samples had high resistance against Cefotaxime (97.75%), Ciprofloxacin (78.65%), Ceftriaxone (74.15%), Carbenicillin (65.16%) Ceftazidime (88.76%), Imipenem (74.15%), Piperacillin (87.64%) and Piperacillin-tazobac- tam (61.79%) and, a moderate resistance against gentamicin (40.44%), Amikacin (50.56%) and Cefepime (52.8%).</p><p>In a study in India, resistance of ESBL-producing isolates against non-beta lactam antibiotics were as follows: 93.8% to Ciprofloxacin, 79.1% to Sulfamethoxazole and 14.7% to Amikacin [<xref ref-type="bibr" rid="scirp.71618-ref21">21</xref>] . It is possible that genes that code resistance against these antibiotics are transferred alongside the ESBL genes. In a study conducted in the USA, among 20 isolated bacteria resistant to antibiotics that were separated from patients from hospitals and nursing homes, 17 bacteria contained 54-kb plasmid that endoced the resistance to Ceftazidime by TEM-10.This plasmid was the mediator of resistance against Co-trimoxazole, Gentamicin and Tobramycin [<xref ref-type="bibr" rid="scirp.71618-ref25">25</xref>] .</p><p>According to reports, CTX-M B. lactamases hydrolyze Cefotaxime more than Ceftazidime [<xref ref-type="bibr" rid="scirp.71618-ref26">26</xref>] . In the present study, 95.83% of the CTX-M B. lactamase-producing isolates that were detected in the study, were resistant to or an intermediary for Cefotaxime, while lack of sensitivity to Ceftazidime was equal to 87.5%.</p><p>In order to differentiate between the two following hypotheses, the REP-PCR method was necessary. 1) An epidemic E. coli strain had been spread among all the patients, so one ancestral strain is possibly the cause of spread of resistance. 2) CTX-M gene had been spread among different E. coli isolated.</p><p>This study recognized 48 different genotypes as positive among 48 CTX-M samples; therefore, the results of this experiment indicated that the clonal propagation theory of one epidemic E. coli strain is not applicaple. This means that not all the types of CTX-M producers were originated from one single strain and, the gene had been spread among different isolates. Therefore, it can be concluded that one plasmid or mobile genetic element (MGE) containing the CTX-M gene, is responsible for the spread of the gene among different isolated of E. coli.</p><p>In the drawn dendrogram, it was observed that the samples in Clusters B, E, I and J do not contain the CTX-M-resistant gene and the number of samples in these clusters is very low. For instance, in clusters E and J there are only one sample and in clusters B and I, there are 3 samples and based on that, it can be concluded that the samples without the CTX-M gene, have a lower survival rate and their spread among the patients are lower.</p></sec><sec id="s5"><title>5. Conclusions</title><p>In this study genotyping of E. coli from urinary tract of infection patients containing B-lactamase resistance gene CTX-M group 1 was assessed. 48 out of 89 ESBL-produc- ing samples (53.93%) contained the CTX-M gene. In addition, the results indicated that 23 out of (47.91%) of these 48 samples, contained CTX-M group 1. The samples without the CTX-M gene, have a lower survival rate and the spread among the patients is lower.</p><p>Our findings showed the high prevalence of CTX-M enzyme in the ESBL-producing E. coli in the Sanandaj. Also, UTI was more prevalent in women, which seemed logical because of anatomical reasons. According to the obtained results from REP-PCR, it was concluded that the resistant genes were spread among different isolates. So hospitals and their staff must be more hygiene and, proper disposal of hospital waste and using antibiotics only by the doctors’ order can help to prevent the spread of resistances.</p></sec><sec id="s6"><title>6. Limitations and Recommendations for Future Research</title><p>Limitations of the current study were lack of proper access to some of the reagents and instruments in the tests and due to financial constraints, the study was under-powered, and because of small sample size, it is impossible to generalize the study results, certainly. For future studies, the results of study recommended that in order to generalize the results, study be repeated with big enough population of patients. Also, it is suggested that other ESBL gens prevalence and risk factors related to the spread of ESBL genes can be studied in future.</p></sec><sec id="s7"><title>Acknowledgements</title><p>This is a part of Arezoo Omati’s M.Sc. thesis. The authors wish to extend their gratitude to Rasht branch of Islamic Azad University for its financial support.</p></sec><sec id="s8"><title>Cite this paper</title><p>Omati, A., Davari, K. and Shokrolahi, B. (2016) Genotyping of E. coli Isolated from Urinary Tract Infection Patients Containing B-Lactamase Resistance Gene CTX-M Group 1 in Sanandaj Medical Health Centers. American Journal of Molecular Biology, 6, 159-169. http://dx.doi.org/10.4236/ajmb.2016.64015</p></sec></body><back><ref-list><title>References</title><ref id="scirp.71618-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Coque, T.M., Oliver, A., Pérez-Díaz, J.C., Baquero, F. and Cantón, R. (2002) Genes Encoding TEM-4, SHV-2, and CTX-M-10 Ex-tended-Spectrum β-Lactamases Are Carried by Multiple Klebsiella pneumoniae Clones in a Single Hospital (Madrid, 1989 to 2000). Antimicrobial Agents and Chemotherapy, 46, 500-510. http://dx.doi.org/10.1128/AAC.46.2.500-510.2002</mixed-citation></ref><ref id="scirp.71618-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Bonnet, R. (2004) Growing Group of Extended-Spectrum β-Lactamases: The CTX-M Enzymes. Antimicrobial Agents and Chemotherapy, 48, 1-14.http://dx.doi.org/10.1128/AAC.48.1.1-14.2004</mixed-citation></ref><ref id="scirp.71618-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Cantón, R. and Coque, T.M. (2006) The CTX-M β-Lactamase Pandemic. Current Opinion in Microbiology, 9, 466-475. http://dx.doi.org/10.1016/j.mib.2006.08.011</mixed-citation></ref><ref id="scirp.71618-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Vervoort, J., Baraniak, A., Gazin, M., Sabirova, J., Lammens, C., Kazma, M., et al. (2012) Characterization of Two New CTX-M-25-Group Extended-Spectrum β-Lactamase Variants Identified in Escherichia coli Isolates from Israel. PLoS ONE, 7, e46329.http://dx.doi.org/10.1371/journal.pone.0046329</mixed-citation></ref><ref id="scirp.71618-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Barlow, M., Reik, R.A., Jacobs, S.D., Medina, M., Meyer, M.P., McGowan Jr., J.E., et al. (2008) High Rate of Mobilization for blaCTX-Ms. Emerging Infectious Diseases, 14, 423-428. http://dx.doi.org/10.3201/eid1403.070405</mixed-citation></ref><ref id="scirp.71618-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Woodford, N., Carattoli, A., Karisik, E., Underwood, A., Ellington, M.J. and Livermore, D.M. (2009) Complete Nucleotide Sequences of Plasmids pEK204, pEK499, and pEK516, Encoding CTX-M Enzymes in Three Major Escherichia coli Lineages from the United Kingdom, All Belonging to the International O25:H4-ST131 Clone. Antimicrobial Agents and Chemotherapy, 53, 4472-4482. http://dx.doi.org/10.1128/AAC.00688-09</mixed-citation></ref><ref id="scirp.71618-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Nielsen, J.B., Skov, M.N., J&amp;oslashrgensen, R.L., Heltberg, O., Hansen, D.S. and Sch&amp;oslashnning, K. (2011) Identification of CTX-M15-, SHV-28-Producing Klebsiella pneumoniae ST15 as an Epidemic Clone in the Copenhagen Area Using a Semi-Automated Rep-PCR Typing Assay. European Journal of Clinical Microbiology &amp; Infectious Diseases, 30, 773-778.http://dx.doi.org/10.1007/s10096-011-1153-x</mixed-citation></ref><ref id="scirp.71618-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Versalovic, J., Schneider, G.M., De Bruijn, F. and Lupski, J.R. (1994) Genomic Fingerprinting of Bacteria Using Repetitive Sequence-Based Polymerase Chain Reaction. Methods in Molecular and Cellular Biology, 5, 25-40.</mixed-citation></ref><ref id="scirp.71618-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Olive, D.M. and Bean, P. (1999) Principles and Applications of Methods for DNA-Based Typing of Microbial Organisms. Journal of Clinical Microbiology, 37, 1661-1669.</mixed-citation></ref><ref id="scirp.71618-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Woodford, N., Ward, M., Kaufmann, M., Turton, J., Fagan, E., James, D. and Cheasty, T. (2004) Community and Hospital Spread of Escherichia coli Producing CTX-M Extended-Spectrum β-Lactamases in the UK. Journal of Antimicrobial Chemotherapy, 54, 735-743.http://dx.doi.org/10.1093/jac/dkh424</mixed-citation></ref><ref id="scirp.71618-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Nasehi, L., Shahcheraghi, F., Nikbin, V. and Nematzadeh, S. (2010) PER, CTX-M, TEM and SHV Beta-Lactamases in Clinical Isolates of Klebsiella pneumoniae Isolated from Tehran, Iran. Iranian Journal of Basic Medical Sciences, 13, 111-118.</mixed-citation></ref><ref id="scirp.71618-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Turnidge, J.D. (2015) Susceptibility Test Methods: General Considerations. Manual of Clinical Microbiology. 11th Edition, American Society of Microbiology.</mixed-citation></ref><ref id="scirp.71618-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Barguigua, A., El Otmani, F., Talmi, M., Reguig, A., Jamali, L., Zerouali, K., et al. (2013) Prevalence and Genotypic Analysis of Plasmid-Mediated [Beta]-Lactamases among Urinary Klebsiella pneumoniae Isolates in Moroccan Community. Journal of Antibiotics, 66, 11-16.http://dx.doi.org/10.1038/ja.2012.91</mixed-citation></ref><ref id="scirp.71618-ref14"><label>14</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Ramazanzadeh</surname><given-names> R. </given-names></name>,<etal>et al</etal>. (<year>2010</year>)<article-title>Etiologic Agents and Extended-Spectrum Beta-Lactamase Production in Urinary Tract Infections in Sanandaj, Iran</article-title><source> Eastern Journal of Medicine</source><volume> 15</volume>,<fpage> 57</fpage>-<lpage>62</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.71618-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Bou, G., Cartelle, M., Tomas, M., Canle, D., Molina, F., Moure, R., et al. (2002) Identification and Broad Dissemination of the CTX-M-14 Beta-Lactamase in Different Escherichia coli Strains in the Northwest Area of Spain. Journal of Clinical Microbiology, 40, 4030-4036. http://dx.doi.org/10.1128/JCM.40.11.4030-4036.2002</mixed-citation></ref><ref id="scirp.71618-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Barthélémy, M., Péduzzi, J., Bernard, H., Tancrède, C. and Labia, R. (1992) Close Amino Acid Sequence Relationship between the New Plasmid-Mediated Extended-Spectrum β-Lactamase MEN-1 and Chromosomally Encoded Enzymes of Klebsiella oxytoca. Biochimica et Biophysica Acta, 1122, 15-22. http://dx.doi.org/10.1016/0167-4838(92)90121-S</mixed-citation></ref><ref id="scirp.71618-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Bauernfeind, A., Holley, M., Jungwirth, R., Mangold, P., R&amp;oumlhnisch, T., Schweighart, S., et al. (1992) A New Plasmidic Cefotaximase from Patients Infected with Salmonella typhimurium. Infection, 20, 158-163. http://dx.doi.org/10.1007/BF01704610</mixed-citation></ref><ref id="scirp.71618-ref18"><label>18</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Al-Jasser</surname><given-names> A.M. </given-names></name>,<etal>et al</etal>. (<year>2006</year>)<article-title>Extended-Spectrum Beta-Lactamases (ESBLs): A Global Problem</article-title><source> Kuwait Medical Journal</source><volume> 38</volume>,<fpage> 171</fpage>-<lpage>185</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.71618-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Lavigne, J.P., Marchandin, H., Delmas, J., Moreau, J., Bouziges, N., Lecaillon, E., et al. (2007) CTX-M Beta-Lactamase-Producing Escherichia coli in French Hospitals: Prevalence, Molecular Epidemiology, and Risk Factors. Journal of Clinical Microbiology, 45, 620-626.http://dx.doi.org/10.1128/JCM.01917-06</mixed-citation></ref><ref id="scirp.71618-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Fang, H., Ataker, F., Hedin, G. and Dornbusch, K. (2008) Molecular Epidemiology of Extended-Spectrum Beta-Lactamases among Escherichia coli Isolates Collected in a Swedish Hospital and Its Associated Health Care Facilities from 2001 to 2006. Journal of Clinical Microbiology, 46, 707-712. http://dx.doi.org/10.1128/JCM.01943-07</mixed-citation></ref><ref id="scirp.71618-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Goyal, A., Prasad, K.N., Prasad, A., Gupta, S., Ghoshal, U. and Ayyagari, A. (2009) Extended Spectrum Beta-Lactamases in Escherichia coli &amp; Klebsiella pneumoniae &amp; Associated Risk Factors. The Indian Journal of Medical Research, 129, 695-700.</mixed-citation></ref><ref id="scirp.71618-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Soltan Dallal, M.M., Azarsa, M., Shirazi, M.H., Owlia, P., Sabbaghi, A., Shamkani, F., et al. (2011) The Prevalence of Extended-Spectrum Beta-Lactamases and CTX-M-1 Producing Escherichia coli in Urine Samples Collected at Tabriz City Hospitals. Tehran University of Medical Sciences, 69, 273-278.</mixed-citation></ref><ref id="scirp.71618-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Rossolini, G.M., D’Andrea, M.M. and Mugnaioli, C. (2008) The Spread of CTX-M-Type Extended-Spectrum Beta-Lactamases. Clinical Microbiology and Infection: The Official Publication of the European Society of Clinical Microbiology and Infectious Diseases, 14, 33-41. http://dx.doi.org/10.1111/j.1469-0691.2007.01867.x</mixed-citation></ref><ref id="scirp.71618-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Rogers, B.A., Sidjabat, H.E. and Paterson, D.L. (2011) Escherichia coli O25b-ST131: A Pandemic, Multiresistant, Community-Associated Strain. The Journal of Antimicrobial Chemotherapy, 66, 1-14. http://dx.doi.org/10.1093/jac/dkq415</mixed-citation></ref><ref id="scirp.71618-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Wiener, J., Quinn, J.P., Bradford, P.A., Goering, R.V., Nathan, C., Bush, K., et al. (1999) Multiple Antibiotic-Resistant Klebsiella and Escherichia coli in Nursing Homes. JAMA, 281, 517-523. http://dx.doi.org/10.1001/jama.281.6.517</mixed-citation></ref><ref id="scirp.71618-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Bradford, P. (2001) Extended-Spectrum Beta-Lactamases in the 21st Century: Characterization, Epidemiology, and Detection of This Important Resistance Threat. Clinical Microbiology Reviews, 14, 933-951. http://dx.doi.org/10.1128/CMR.14.4.933-951.2001</mixed-citation></ref></ref-list></back></article>