<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">OJAS</journal-id><journal-title-group><journal-title>Open Journal of Animal Sciences</journal-title></journal-title-group><issn pub-type="epub">2161-7597</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ojas.2016.64031</article-id><article-id pub-id-type="publisher-id">OJAS-71038</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Tyrosinase (&lt;i&gt;Tyr&lt;/i&gt;) Gene Mutation in Albino Mongolian Gerbil (&lt;i&gt;Meriones unguiculatus&lt;/i&gt;)
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Takao</surname><given-names>Ukaji</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Masahiro</surname><given-names>A. Iwasa</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Osamu</surname><given-names>Kai</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Animal Science and Resources, College of Bioresource Sciences, Nihon University, Fujisawa, Japan</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>kai.osamu@nihon-u.ac.jp(OK)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>17</day><month>08</month><year>2016</year></pub-date><volume>06</volume><issue>04</issue><fpage>259</fpage><lpage>268</lpage><history><date date-type="received"><day>August</day>	<month>18,</month>	<year>2016</year></date><date date-type="rev-recd"><day>Accepted:</day>	<month>September</month>	<year>27,</year>	</date><date date-type="accepted"><day>September</day>	<month>30,</month>	<year>2016</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
   
   Tyrosinase is encoded by the 
   Tyr
    (
   c or albino
   ) locus and is the key enzyme in pigment biosynthesis. Loss of function of this enzyme caused by gene mutation results in albinism. Most cases of albinism are caused by missense mutations of tyrosinase. Albino mutations in 
   Tyr
    have been identified in various animals, including human, mouse, rat, rabbit, cattle, cat, and ferret, but not in gerbil. We created two new gerbil strains: MON/Num/a (inbred agouti phenotype) and MON/Num/c (albino phenotype). Here, we report that four nucleotide substitutions in the Tyr gene caused two missense mutations in amino acids in the albino gerbil: a G-to-A mutation at position 204 in exon 1 caused R77H, and A-to-G at position 1392 and G-to-T at position 1393 in exon 5 caused Q473R. The substitution at position 1408 in exon 5 was silent. These missense mutations are conserved in all albino phenotypes we tested. Therefore, we suggest that these mutations are responsible for albinism in gerbil. 
  
 
</p></abstract><kwd-group><kwd>Tyrosinase (&lt;i&gt;Tyr&lt;/i&gt;) Gene</kwd><kwd> Mongolian Gerbil (&lt;i&gt;Meriones unguiculatus&lt;/i&gt;)</kwd><kwd> Albino</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The Mongolian gerbil (Meriones unguiculatus) is extensively used as an animal model in studies of pharmacology [<xref ref-type="bibr" rid="scirp.71038-ref1">1</xref>] , parasitology [<xref ref-type="bibr" rid="scirp.71038-ref2">2</xref>] , aging [<xref ref-type="bibr" rid="scirp.71038-ref3">3</xref>] , oncology [<xref ref-type="bibr" rid="scirp.71038-ref4">4</xref>] , and reproduction [<xref ref-type="bibr" rid="scirp.71038-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.71038-ref6">6</xref>] . Gerbils used in scientific research originated from 20 pairs captured in the basin of the Amur River in eastern Mongolia and were imported into Japan in 1935. They were sent to the Kitasato Institute for rickettsial studies [<xref ref-type="bibr" rid="scirp.71038-ref7">7</xref>] . Agouti gerbils in our laboratory have been kept as a closed colony since 1983 from their origins at Tokyo Women’s University and Tokyo University of Agriculture [<xref ref-type="bibr" rid="scirp.71038-ref6">6</xref>] . By repeated sub-mating of these gerbils, we have created the inbred agouti strain MON/Num/a (<xref ref-type="fig" rid="fig1">Figure 1</xref>(A)). In addition, albino gerbils were introduced from Chiba City Zoo, and their phenotype has been maintained in the heterozygous state by sub-mating with MON/Num/a gerbils. After repeated sub-mating, we established a closed colony of MON/Num/c albino gerbils (<xref ref-type="fig" rid="fig1">Figure 1</xref>(B)).</p><p>In general, albinism is an autosomal recessive disorder, which occurs as a consequence of mutations in genes involved in regulating melanin biosynthesis [<xref ref-type="bibr" rid="scirp.71038-ref8">8</xref>] [<xref ref-type="bibr" rid="scirp.71038-ref9">9</xref>] . Many albino mouse strains (e.g., A, AKR, BALB/c, and ICR) lack pigmentation owing to mutations in the Tyrosinase (Tyr) gene [<xref ref-type="bibr" rid="scirp.71038-ref10">10</xref>] . Tyrosinase encoded by Tyr is well known as the key enzyme in pigment biosynthesis in mammals and is the first enzyme in the melanin synthesis pathway, converting tyrosine to dihydroxyphenylalanine (DOPA) and then to dopaquinone [<xref ref-type="bibr" rid="scirp.71038-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.71038-ref12">12</xref>] . Albinism caused by mutations in Tyr has been characterized in human [<xref ref-type="bibr" rid="scirp.71038-ref13">13</xref>] , mouse [<xref ref-type="bibr" rid="scirp.71038-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.71038-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.71038-ref15">15</xref>] , rat [<xref ref-type="bibr" rid="scirp.71038-ref16">16</xref>] , rabbit [<xref ref-type="bibr" rid="scirp.71038-ref17">17</xref>] , cat [<xref ref-type="bibr" rid="scirp.71038-ref18">18</xref>] , ferret [<xref ref-type="bibr" rid="scirp.71038-ref19">19</xref>] , and cattle [<xref ref-type="bibr" rid="scirp.71038-ref20">20</xref>] . The first report of complete albinism (cc) in gerbil was published by Matsuzaki et al. [<xref ref-type="bibr" rid="scirp.71038-ref21">21</xref>] . Additionally, some coat-color phenotypes (e.g., black chinchilla medium, aac<sup>chm</sup>c<sup>chm</sup>; siamese, aac<sup>chm</sup>c<sup>h</sup>; dark-tailed white, aac<sup>h</sup>c<sup>h</sup>; recessive yellow, ee; black recessive yellow, aaee; and fading recessive yellow, e<sup>f</sup>e<sup>f</sup>), considered to be related to Tyr mutations, have been reported [<xref ref-type="bibr" rid="scirp.71038-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.71038-ref23">23</xref>] . However, genetic evidence of albino mutation in gerbil has not been characterized yet.</p><p>Here, to identify the gene responsible for albinism in gerbil, we analyzed the cDNA sequence of the Tyr gene in albino phenotype gerbil (MON/Num/c) and compared it with that of wild-type gerbils (agouti, MON/Num/a; and MON/Jms/GbsSlc).</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Animals</title><p>MON/Num/a (n = 5), MON/Num/c (n = 4), and MON/Jms/GbsSlc (n = 5) gerbils were used in this study. MON/Jms/GbsSlc gerbils were purchased from Japan SLC Inc. (Shizuoka, Japan). The gerbils were maintained at 22˚C &#177; 3˚C with lighting from 0700 to 1900 h (12 light:12 dark) and were given food pellets (Labo MR Stock, Nosan</p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> External characteristics of (A) MON/Num/a (agouti) and (B) MON/Num/c (albino) gerbils</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-1400458x2.png"/></fig><p>Corporation, Kanagawa, Japan) and water ad libitum. All of the procedures used here were reviewed and approved by Nihon University’s Animal Care and Use Committee (AP14B078).</p></sec><sec id="s2_2"><title>2.2. Determination of Tyr cDNA Sequence in Gerbil</title><p>Gerbils were euthanized with carbon dioxide. Total RNA was isolated from the eye with a Trizol reagent kit (Invitrogen Life Technologies, CA, USA) according to the manufacturer’s protocol. RT-PCR was performed with an RNA PCR Kit (AMV) v. 2.1 (Takara, Shiga, Japan) according to the manufacturer’s instructions. Three primer sets for sequencing gerbil Tyr cDNA were designed from highly conserved regions of mouse (BC079678), rat (NM001107535), and human (NM000372) Tyr cDNAs (<xref ref-type="fig" rid="fig2">Figure 2</xref>, <xref ref-type="table" rid="table1">Table 1</xref>). PCR consisted of an initial denaturation for 2 min at 94˚C; 40 cycles of 30 s at 94˚C, 1 min at 60˚C, and 1 min at 72˚C; and a final extension for 5 min at 72˚C. The PCR products were electrophoresed in 1.5% agarose gels and stained with ethidium bromide. The fragments were purified and sequenced directly with a BigDye Terminator v. 3.1 Cycle Sequencing Kit (Applied Biosystems, CA, USA) in an ABI PRISM 310 genetic analyzer (Applied Biosystems).</p></sec><sec id="s2_3"><title>2.3. Sequence Analysis</title><p>Each determined nucleotide and predicted amino acid sequence was aligned for comparison with mouse, rat, and human counterparts by ClustalW multiple alignment [<xref ref-type="bibr" rid="scirp.71038-ref24">24</xref>] , and homology was calculated from the p-distance in MEGA 4 software [<xref ref-type="bibr" rid="scirp.71038-ref25">25</xref>] .</p><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Nucleotide positions of primer sets</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-1400458x3.png"/></fig><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used for the present sequencing gerbil Tyr gene</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  colspan="2"   rowspan="2"  >Primer</th><th align="center" valign="middle" >Sequence</th><th align="center" valign="middle"  rowspan="2"  >Product Size (bp)</th><th align="center" valign="middle"  rowspan="2"  >Amplification region</th></tr></thead><tr><td align="center" valign="middle" >5' &#174; 3'</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >P1</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >TCTGTGGAGTTTCCAGATCT</td><td align="center" valign="middle"  rowspan="2"  >541</td><td align="center" valign="middle"  rowspan="2"  >Exon 1</td></tr><tr><td align="center" valign="middle" >R</td><td align="center" valign="middle" >AAGCAGTGTGTCCCTTGACA</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >P2</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >ACCTATGGCCAAATGAACAA</td><td align="center" valign="middle"  rowspan="2"  >571</td><td align="center" valign="middle"  rowspan="2"  >Exon 1-3</td></tr><tr><td align="center" valign="middle" >R</td><td align="center" valign="middle" >AGTGGACTGGCAAATCCTTC</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >P3</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >ACCACTATTACGTAATCCTG</td><td align="center" valign="middle"  rowspan="2"  >549</td><td align="center" valign="middle"  rowspan="2"  >Exon 2-5</td></tr><tr><td align="center" valign="middle" >R</td><td align="center" valign="middle" >AGCCATGGCCAGATACGACT</td></tr></tbody></table></table-wrap></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Coat Color of Each Strain</title><p>MON/Num/a has the typical agouti (wild-type) phenotype characterized by dorsal hairs with a gray base, a yellow center band, and black tips. The belly and paws are creamy white. A demarcation line between dorsal and ventral side is present. The eyes, claws, and tip of the tail are black (<xref ref-type="fig" rid="fig1">Figure 1</xref>(A)). These characteristics are similar to MON/ Jms/GbsSlc. MON/Num/c has a pure white coat and red eyes. Nose, ears, feet, and tail are covered with pure white hairs. A demarcation line between dorsal and ventral side is absent (<xref ref-type="fig" rid="fig1">Figure 1</xref>(B)).</p></sec><sec id="s3_2"><title>3.2. Determination of Tyr cDNA Sequences</title><p>The cDNA sequences of Tyr in MON/Jms/GbsSlc (GenBank accession no. LC177618), MON/Num/a (LC177619), and MON/Num/c (LC177620) were determined (<xref ref-type="fig" rid="fig3">Figure 3</xref>). The 1408-bp sequences encoded 469 amino acids (<xref ref-type="fig" rid="fig4">Figure 4</xref>), and corresponded to part of the exon 1-to-5 regions of counterparts in other species, equivalent to 87.9% of the complete mouse (BC079678) Tyr cDNA and 88.4% of rat (NM001107535). Tyr cDNA and amino acid sequences of MON/Jms/GbsSlc and MON/Num/a matched completely in the region that we determined (<xref ref-type="fig" rid="fig3">Figure 3</xref>, <xref ref-type="fig" rid="fig4">Figure 4</xref>).</p></sec><sec id="s3_3"><title>3.3. Comparison of Tyr Gene among Three Gerbil Strains and Other Species</title><p>Comparison of Tyr cDNA sequences between agouti (MON/Num/a and MON/Jms/ GbsSlc) and albino gerbils (MON/Num/c) revealed four nucleotide substitutions: G-to-A at position 204 in exon 1, A-to-G at position 1392 in exon 5, G-to-T at position 1393 in exon 5, and C-to-A at position 1408 in exon 5 (<xref ref-type="fig" rid="fig3">Figure 3</xref>). The nucleotide substitution at position 204 caused an R77H alteration, and those at positions 1392-93 caused a Q473R alteration (<xref ref-type="fig" rid="fig4">Figure 4</xref>). That at position 1408 was silent. The Tyr cDNA sequence of agouti gerbil (MON/Num/a and MON/Jms/GbsSlc) showed &gt;90% identity at the nucleotide and amino acid levels with those of mouse and rat, and &gt;84% with those of human (<xref ref-type="table" rid="table2">Table 2</xref>).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Albinism in gerbil was first reported by Matsuzaki et al. [<xref ref-type="bibr" rid="scirp.71038-ref21">21</xref>] , but not since, and genetic evidence of albino mutations has not been characterized yet. Oculocutaneous albinism (OCA), which is a group of autosomal recessive diseases in humans and other animals, is characterized by reduced or absent melanin in skin, hair, and eyes. Type 1 OCA (OCA1) results from mutations in the Tyr gene, which codes for tyrosinase, a copper- containing enzyme that catalyzes the first two steps in the melanin biosynthesis pathway: the hydroxylation of tyrosine to DOPA and the subsequent oxidation of DOPA to dopaquinone [<xref ref-type="bibr" rid="scirp.71038-ref26">26</xref>] . It is well known that OCA1 is caused by nonsense, missense, frameshift, or splice-site alterations in Tyr. Various mutations causing OCA1 have been reported. In human, a single-base C-to-A substitution in exon 3, which causes a</p><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Alignment of Tyr cDNA sequences in gerbils. Nucleotide substitutions between agouti and albino strains are highlighted. GenBank accession numbers: MON/Jms/GbsSlc Tyr, LC177618; MON/Num/a Tyr, LC177619; MON/Num/c Tyr, LC177620</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-1400458x4.png"/></fig><fig id="fig4"  position="float"><label><xref ref-type="fig" rid="fig4">Figure 4</xref></label><caption><title> Missense nucleotide mutations in the Tyr gene in albino gerbil cause R77H and Q473R alterations. GenBank accession numbers for encoding genes: MON/Jms/GbsSlc Tyr, LC177618; MON/Num/a Tyr, LC177619; MON/Num/c Tyr, LC177620; mouse Tyr, BC079678; rat Tyr, NM001107535; human Tyr, NM000372</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-1400458x5.png"/></fig><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Homologies between the gerbil and other mammals in the Tyr gene and its amino acids. Nucleotide and amino acid sequences were compared with mouse Tyr (BC079678), rat Tyr (NM001107535), and human Tyr (NM000372)</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle"  colspan="2"  >Gerbil (MON/Num/a and MON/Jms/GbsSlc)</th></tr></thead><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Nucleotide homology (%)</td><td align="center" valign="middle" >Amino acid homology (%)</td></tr><tr><td align="center" valign="middle" >Mouse</td><td align="center" valign="middle" >91.5</td><td align="center" valign="middle" >93.6</td></tr><tr><td align="center" valign="middle" >Rat</td><td align="center" valign="middle" >91.5</td><td align="center" valign="middle" >93.8</td></tr><tr><td align="center" valign="middle" >Human</td><td align="center" valign="middle" >81.1</td><td align="center" valign="middle" >86.4</td></tr></tbody></table></table-wrap><p>T373K alteration, is frequently found [<xref ref-type="bibr" rid="scirp.71038-ref27">27</xref>] . In BALB/c mouse, a G-to-C mutation at position 387, which causes a C85S alteration, is common [<xref ref-type="bibr" rid="scirp.71038-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.71038-ref15">15</xref>] . In albino rat, a single G-to-A mutation at position 896 in exon 2 causes an R299H alteration [<xref ref-type="bibr" rid="scirp.71038-ref16">16</xref>] . In the cattle, a frame-shift mutation caused by an insertion in codon 316 is associated with complete albinism [<xref ref-type="bibr" rid="scirp.71038-ref20">20</xref>] . The absence of codon 325 in the domestic albino cat causes a premature stop codon [<xref ref-type="bibr" rid="scirp.71038-ref18">18</xref>] . In the white New Zealand rabbit, complete albinism is due to a missense alteration at residue 373 [<xref ref-type="bibr" rid="scirp.71038-ref17">17</xref>] . As these reports show, most albino mutations in mammals result from a missense or frameshift mutation in Tyr. In albino gerbil, on the other hand, we find two missense mutations (R77H encoded in exon 1 and Q473R encoded in exon 5) in tyrosinase (<xref ref-type="fig" rid="fig4">Figure 4</xref>), which are conserved all albino gerbils we tested. Therefore, we suggest that both missense mutations of Tyr are conserved in the albino phenotype and are responsible for albinism in gerbil. The gerbil is commonly used as a model animal in studies of a wide range of infectious diseases by reason of its high sensitivity to various parasite [<xref ref-type="bibr" rid="scirp.71038-ref2">2</xref>] and pathogens [<xref ref-type="bibr" rid="scirp.71038-ref1">1</xref>] . However, the mechanism of these sensitivities remains to be identified. So far, we have reported molecular information on immunoglobulin [<xref ref-type="bibr" rid="scirp.71038-ref28">28</xref>] [<xref ref-type="bibr" rid="scirp.71038-ref29">29</xref>] and variation in the IgG subclass [<xref ref-type="bibr" rid="scirp.71038-ref30">30</xref>] in the agouti (MON/Num/a) strain to investigate acquired immunity in gerbil, and have established methods for producing gerbil mAb [<xref ref-type="bibr" rid="scirp.71038-ref31">31</xref>] and cytokines [<xref ref-type="bibr" rid="scirp.71038-ref32">32</xref>] with heterohybridoma techniques. Although immune systems have not been compared in detail between albino (MON/Num/c) and agouti strains yet, use of the albino strain for immunological research may further contribute to the establishment of new strains as models of infectious disease.</p><p>In this study, we identified two missense mutations in exons 1 and 5 of the Tyr gene in albino gerbil. These mutations support the functional significance of tyrosinase in albinism in gerbil. However, we did not determine the full Tyr cDNA sequence in gerbil. As a next step, phenotypic characterization of albino-by-agouti crosses is needed to clarify how these missense mutations result in albinism. Our results will provide valuable information on albinism in gerbil and will contribute to the establishment of albino strains.</p></sec><sec id="s5"><title>Conflict of Interest</title><p>The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.</p></sec><sec id="s6"><title>Cite this paper</title><p>Ukaji, T., Iwasa, M.A. and Kai, O. (2016) Tyrosinase (Tyr) Gene Mutation in Albino Mongolian Gerbil (Meriones unguiculatus). Open Journal of Animal Sciences, 6, 259-268. http://dx.doi.org/10.4236/ojas.2016.64031</p></sec></body><back><ref-list><title>References</title><ref id="scirp.71038-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Wu, C., Shi, Y., Guo, H., Zou, W.Y., Guo, G., Xie, Q.H., Mao, X.H., Tong, W.D. and Zou, Q.M. (2008) Protection against Helicobacter pylori Infection in Mongolian gerbil by Intragastric or Intramuscular Administration of Helicobacter pylori Multicomponent Vaccine. Helicobacter, 13, 191-199. http://dx.doi.org/10.1111/j.1523-5378.2008.00609.x</mixed-citation></ref><ref id="scirp.71038-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Lim, B.H., Noordin, R., Nor, Z.M., Rahman, R.A., Abdullah, K.A. and Sinnadurai, S. (2004) Brugia malayi Infection in Meriones unguiculatus: Antibody Response to Recombinant BmR1. Experimental Parasitology, 108, 1-6. http://dx.doi.org/10.1016/j.exppara.2004.06.004</mixed-citation></ref><ref id="scirp.71038-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Spangler, E.L., Hengemihle, J., Blank, G., Speer, D.L., Brzozowski, S., Patel, N. and Ingram, D.K. (1997) An Assessment of Behavioral Aging in the Mongolian gerbil. Experimental gerontology, 32, 701-717. http://dx.doi.org/10.1016/S0531-5565(97)00055-7</mixed-citation></ref><ref id="scirp.71038-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Fujioka, T., Honda, S. and Tokieda, M. (2000) Helicobacter pylori Infection and Gastric Carcinoma in Animal Models. Journal of Gastroenterology and Hepatology, 15, D55-D59. 
http://dx.doi.org/10.1046/j.1440-1746.2000.02139.x</mixed-citation></ref><ref id="scirp.71038-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Elwood, R.W. and Broom, D.M. (1978) The Influence of Litter Size and Parental Behavior on the Development of Mongolian Gerbil Pups. Animal Behaviour, 26, 438-454. 
http://dx.doi.org/10.1016/0003-3472(78)90061-1</mixed-citation></ref><ref id="scirp.71038-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Kai, O., Sakemi, K., Suzuki, Y., Sonoda, Y. and Imai, K. (1995) Effects of Age at First-Pairing on the Reproductive Performance of Mongolian Gerbils (Meriones unguiculatus). Experimental Animals, 44, 307-313. http://dx.doi.org/10.1538/expanim.44.307</mixed-citation></ref><ref id="scirp.71038-ref7"><label>7</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Rich</surname><given-names> S.T. </given-names></name>,<etal>et al</etal>. (<year>1968</year>)<article-title>The Mongolian Gerbil (Meriones unguiculatus) in Research</article-title><source> Laboratory Animal Care</source><volume> 18</volume>,<fpage> 235</fpage>-<lpage>243</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.71038-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Sturm, R.A. and Frudakis, T.N. (2004) Eye Colour: Portals into Pigmentation Genes and Ancestry. Trends in Genetics, 20, 327-332. http://dx.doi.org/10.1016/j.tig.2004.06.010</mixed-citation></ref><ref id="scirp.71038-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Tomita, Y. and Suzuki, T. (2004) Genetics of Pigmentary Disorders. American Journal of Medical Genetics, 131, 75-81. http://dx.doi.org/10.1002/ajmg.c.30036</mixed-citation></ref><ref id="scirp.71038-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Beermann, F., Orlow, S.J. and Lamoreux, M.L. (2004) The Tyr (Albino) Locus of the Laboratory Mouse. Mammalian Genome, 15, 749-758.  
http://dx.doi.org/10.1007/s00335-004-4002-8</mixed-citation></ref><ref id="scirp.71038-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Cooksey, C.J., Garratt, P.J., Land, E.J., Pavel, S., Ramsden, C.A., Riley, P.A. and Smit, N.P.M. (1997) Evidence of the Indirect Formation of the Catecholic Intermediate Substrate Responsible for the Autoactivation Kinetics of Tyrosinase. The Journal of Biological Chemistry, 272, 26226-26235. http://dx.doi.org/10.1074/jbc.272.42.26226</mixed-citation></ref><ref id="scirp.71038-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Ray, K., Chaki, M. and Sengupta, M. (2007) Tyrosinase and Ocular Diseases: Some Novel Thoughts on the Molecular Basis of Oculocutaneous Albinism Type 1. Progress in Retinal and Eye Research, 26, 323-358. http://dx.doi.org/10.1016/j.preteyeres.2007.01.001</mixed-citation></ref><ref id="scirp.71038-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Oetting, W.S. and King, R.A. (1999) Molecular Basis of Albinism: Mutations and Polymorphisms of Pigmentation Genes Associated with Albinism. Human Mutation, 13, 99-115. http://dx.doi.org/10.1002/(SICI)1098-1004(1999)13:2&lt;99::AID-HUMU2&gt;3.0.CO;2-C</mixed-citation></ref><ref id="scirp.71038-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Halaban, R., Svedine, S., Cheng, E., Smicun, Y., Aron, R. and Hebert, D.N. (2000) Endoplasmic Reticulum Retention Is a Common Defect Associated with Tyrosinase-Negative Albinism. Proceedings of the National Academy of Sciences of the United States of America, 97, 5889-5894. http://dx.doi.org/10.1073/pnas.97.11.5889</mixed-citation></ref><ref id="scirp.71038-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Shibahara, S., Okinaga, S., Tomita, Y., Takeda, A., Yamamoto, H., Sato, M. and Takeuchi, M. (1990) A Point Mutation in the Tyrosinase Gene of BALB/c Albino Mouse Causing the Cysteine  Serine Substitution at Position 85. European Journal of Biochemistry, 189, 455-461. http://dx.doi.org/10.1111/j.1432-1033.1990.tb15510.x</mixed-citation></ref><ref id="scirp.71038-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Blaszczyk, W.M., Arning, L., Hoffmann, K.P. and Epplen, J.T. (2005) A Tyrosinase Missense Mutation Causes Albinism in the Wistar Rat. Pigment Cell Research, 18, 144-145.  
http://dx.doi.org/10.1111/j.1600-0749.2005.00227.x</mixed-citation></ref><ref id="scirp.71038-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Aigner, B., Besenfelder, U., Muller, M. and Brem, G. (2000) Tyrosinase Gene Variants in Different Rabbit Strains. Mammalian Genome, 11, 700-702.  
http://dx.doi.org/10.1007/s003350010120</mixed-citation></ref><ref id="scirp.71038-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Imes, D.L., Geary, L.A., Grahn, R.A. and Lyons, L.A. (2006) Albinism in the Domestic Cat (Felis catus) Is Associated with a Tyrosinase (TYR) Mutation. Animal Genetics, 37, 175-178. http://dx.doi.org/10.1111/j.1365-2052.2005.01409.x</mixed-citation></ref><ref id="scirp.71038-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Blaszczyk, W.M., Distler, C., Dekomien, G., Arning, L., Hoffmann, K.P. and Epplen, J.T. (2007) Identification of a Tyrosinase (TYR) Exon 4 Deletion in Albino Ferrets (Mustela putorius furo). Animal Genetics, 38, 421-423.  
http://dx.doi.org/10.1111/j.1365-2052.2007.01619.x</mixed-citation></ref><ref id="scirp.71038-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Schmutz, S.M., Berryere, T.G., Ciobanu, D.C., Mileham, A.J., Schmidtz, B.H. and Fredholm, M. (2004) A Form of Albinism in Cattle Is Caused by a Tyrosinase Frameshift Mutation. Mammalian Genome, 15, 62-67. http://dx.doi.org/10.1007/s00335-002-2249-5</mixed-citation></ref><ref id="scirp.71038-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Matsuzaki, T., Yasuda, Y. and Nonaka, S. (1989) The Genetics of Coat Colors in the Mongolian Gerbil (Meriones unguiculatus). Experimental Animals, 38, 337-341.</mixed-citation></ref><ref id="scirp.71038-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Petrij, F., van Veen, K., Mettler, M. and Brückmann, V. (2001) A Second Acromelanistic Allelomorph at the Albino Locus of the Mongolian Gerbil (Meriones unguiculatus). The Journal of Heredity, 1, 74-78. http://dx.doi.org/10.1093/jhered/92.1.74</mixed-citation></ref><ref id="scirp.71038-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Petrij, F., Mettler, M., Brückmann, V. and van Veen, K. (2007) Recessive Yellow in the Mongolian Gerbil (Meriones unguiculatus). Journal of Experimental Animal Science, 43, 319-327. http://dx.doi.org/10.1016/j.jeas.2006.09.006</mixed-citation></ref><ref id="scirp.71038-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Higgins, D.G., Thompson, J.D. and Gibson, T.J. (1996) Using CLUSTAL for Multiple Sequence Alignments. Methods in Enzymology, 266, 383-402.  
http://dx.doi.org/10.1016/S0076-6879(96)66024-8</mixed-citation></ref><ref id="scirp.71038-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Tamura, K., Dudley, J., Nei, M. and Kumar, S. (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0. Molecular Biology and Evolution, 24, 1596-1599. http://dx.doi.org/10.1093/molbev/msm092</mixed-citation></ref><ref id="scirp.71038-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Giebel, L.B., Tripathi, R.K., King, R.A. and Spritz, R.A. (1991) A Tyrosinase Gene Missense Mutation in Temperature-Sensitive Type I Oculocutaneous Albinism. A Human Homologue to the Siamese Cat and the Himalayan Mouse. The Journal of Clinical Investigation, 87, 1119-1122. http://dx.doi.org/10.1172/JCI115075</mixed-citation></ref><ref id="scirp.71038-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Park, C.K., Chintamaneni, C.D., Halaban, R., Witkop Jr., C.J. and Kwon, B.S. (1993) Molecular Analyses of a Tyrosinase-Negative Albino Family. American Journal of Human Genetics, 52, 406-413.</mixed-citation></ref><ref id="scirp.71038-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Ukaji, T., Sumiyama, D. and Kai, O. (2011) Partial Sequence of Mongolian Gerbils (Meriones unguiculatus) Immunoglobulin Gamma Heavy Chain Constant Region. Animal Science Journal, 82, 713-716. http://dx.doi.org/10.1111/j.1740-0929.2011.00938.x</mixed-citation></ref><ref id="scirp.71038-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Ukaji, T., Sumiyama, D. and Kai, O. (2012) Sequence Determination of Heavy-Chain Constant Region in Four Immunoglobulin Classes of Mongolian Gerbil (Meriones unguiculatus). Experimental Animals, 61, 99-107. http://dx.doi.org/10.1538/expanim.61.99</mixed-citation></ref><ref id="scirp.71038-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Ukaji, T. and Kai, O. (2012) Isotype Analysis of Gerbil-Mouse Heterohybridomas by RT-PCR. Journal of Immunological Methods, 386, 108-111.  
http://dx.doi.org/10.1016/j.jim.2012.09.001</mixed-citation></ref><ref id="scirp.71038-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Ukaji, T., Iwasa, M.A. and Kai, O. (2011) Establishment of Gerbil-Mouse Heterohybridoma Secreting Immunoglobulin of Mongolian Gerbil (Meriones unguiculatus). Journal of Immunological Methods, 373, 174-180. http://dx.doi.org/10.1016/j.jim.2011.08.015</mixed-citation></ref><ref id="scirp.71038-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Ukaji, T., Hashimoto, M. and Kai, O. (2015) Conditioned Medium from Gerbil-Mouse T Cell Heterohybridomas Improved Cell Proliferation and Antibody Secretion. Experimental Animals, 64, 199-205. http://dx.doi.org/10.1538/expanim.14-0078</mixed-citation></ref></ref-list></back></article>