<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AID</journal-id><journal-title-group><journal-title>Advances in Infectious Diseases</journal-title></journal-title-group><issn pub-type="epub">2164-2648</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aid.2016.63017</article-id><article-id pub-id-type="publisher-id">AID-71008</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Medicine&amp;Healthcare</subject></subj-group></article-categories><title-group><article-title>
 
 
  Upregulation of &lt;i&gt;GLE&lt;/i&gt;1 and &lt;i&gt;LCP&lt;/i&gt;2 Genes in H5N1 Influenza Virus Infected Patients
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Wenfeng</surname><given-names>Peng</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Yaping</surname><given-names>Shi</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Baolin</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Bo</surname><given-names>Liu</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Zhiyuan</surname><given-names>Peng</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jianyong</surname><given-names>Zhang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ling</surname><given-names>Chen</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hong</surname><given-names>Zhang</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Respiratory Medicine, Affiliated Hospital of Zunyi Medical College, Zunyi, China</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>hzhang@zbiomed.com(HZ)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>02</day><month>08</month><year>2016</year></pub-date><volume>06</volume><issue>03</issue><fpage>138</fpage><lpage>144</lpage><history><date date-type="received"><day>7</day>	<month>September</month>	<year>2016</year></date><date date-type="rev-recd"><day>accepted</day>	<month>26</month>	<year>September</year>	</date><date date-type="accepted"><day>29</day>	<month>September</month>	<year>2016</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Previous study showed that the Gle1 RNA export mediator-like (
  Gle
  1
  l
  ) gene and the lymphocyte cytosolic protein 2 (
  Lcp
  2) gene were upregulated in response to influenza virus A/Puerto Rico/8/1934 (H1N1) in a mouse mode. To determine whether these two genes were upregulated in humans after influenza A virus infection, nasopharyngeal swabs were collected from eleven patients with flu-like symptoms for viral RNA extraction and PCR amplification. Sequencing analysis revealed that nucleoprotein (NP) gene fragments amplified from nasopharyngeal swabs of four patients shared the highest similarity with the NP gene from avian influenza A (H5N1) virus (A/ goose/Shantou/753/2002). Peripheral blood samples were then collected from four patients for quantitative analysis of
   
  GLE
  1 and
   
  LCP
  2 gene expression. Our results demonstrated that both
   
  GLE
  1 and
   
  LCP
  2 genes were upregulated in H5N1 influenza A virus infected patients, suggesting that upregulation of
   
  GLE
  1 and
   
  LCP
  2 genes may be important for the host defense against influenza A viruses.
 
</p></abstract><kwd-group><kwd>Influenza</kwd><kwd> H5N1</kwd><kwd> &lt;i&gt;GLE&lt;/i&gt;1</kwd><kwd> &lt;i&gt;LCP&lt;/i&gt;2</kwd><kwd> Upregulation</kwd><kwd> Host Defense</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Disease outbreaks and human infections of highly pathogenic H5N1 avian influenza virus in Hong Kong in 1997 [<xref ref-type="bibr" rid="scirp.71008-ref1">1</xref>] , H7N9 avian influenza virus in China in 2013 [<xref ref-type="bibr" rid="scirp.71008-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.71008-ref3">3</xref>] , and H5N6 avian influenza virus in China in 2014 [<xref ref-type="bibr" rid="scirp.71008-ref4">4</xref>] were mainly caused by close contact of humans with infected birds or influenza virus-contaminated environments. These events demonstrate that a future pandemic from avian influenza viruses is potentially one of the biggest global health threats. The ability of influenza viruses from different origins to infect humans and cause diseases depends largely on the distribution and expression status of influenza virus receptors on host cells [<xref ref-type="bibr" rid="scirp.71008-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.71008-ref6">6</xref>] , internalization of bound viruses through multiple endocytic pathways [<xref ref-type="bibr" rid="scirp.71008-ref7">7</xref>] , and host-pathogen interactions [<xref ref-type="bibr" rid="scirp.71008-ref8">8</xref>] . Results from studies in mice infected with influenza A viruses have documented that many differentially expressed host genes are related to host-pathogen interactions such as the inflammatory response and intracellular signaling pathways [<xref ref-type="bibr" rid="scirp.71008-ref9">9</xref>] - [<xref ref-type="bibr" rid="scirp.71008-ref11">11</xref>] . Our previous study showed that the Gle1 RNA export mediator-like (Gle1l) gene and the lymphocyte cytosolic protein 2 (Lcp2) gene were upregulated in response to influenza virus A/PR/8/34 in a mouse mode [<xref ref-type="bibr" rid="scirp.71008-ref10">10</xref>] .</p><p>The human GLE1 gene (Gene ID: 2733), also known as GLE1l and LCCS1 (lethal congenital contracture syndrome-1) gene, encodes a predicted 75-kDa protein with high sequence and structure homology to the yeast Gle1p protein. The Gle1 protein can stimulate the DExD/H-box RNA-dependent ATPase Dbp5’s activity and is one of the principal components of the mRNA nuclear export machinery required for poly(A)+RNA export [<xref ref-type="bibr" rid="scirp.71008-ref12">12</xref>] - [<xref ref-type="bibr" rid="scirp.71008-ref14">14</xref>] . The multifunctional Gle1 protein plays an important role in nuclear mRNA export and translation, and mutations in the human GLE1 gene are responsible for the autosomal recessive LCCS1 [<xref ref-type="bibr" rid="scirp.71008-ref15">15</xref>] . Structure prediction and functional analysis suggest that the LCCS1 and lethal arthrogryposis with anterior horn cell disease (LAAHD) mutations disrupt the function of Gle1, indicating the potential impact of altered mRNA transport and gene expression in human diseases [<xref ref-type="bibr" rid="scirp.71008-ref16">16</xref>] . The human LCP2 gene (Gene ID: 3937), also known as SLP-76 (SH2 domain-containing leukocyte protein of 76 kilodaltons) gene, encodes a 76-kDa protein, which was originally identified as a substrate of the ZAP-70 (70-kDa zeta-associated protein kinase) protein tyrosine kinase (PTK) following T cell receptor (TCR) ligation in the leukemic T cell line Jurkat [<xref ref-type="bibr" rid="scirp.71008-ref17">17</xref>] - [<xref ref-type="bibr" rid="scirp.71008-ref19">19</xref>] .</p><p>Identification and characterization of genes that are upregulated after influenza A virus infection can provide insights into the mechanism by which the host interacts with the virus, and potential biomarkers for diagnosis, prevention, and treatment of influenza virus infections. Because of their important functions in host-pathogen interactions, human GLE1 and LCP2 genes were selected for this study to determine whether they were upregulated in influenza A virus infected patients. In the present study, we collected nasopharyngeal swabs from eleven patients with flu-like symptoms and two healthy controls for viral RNA extraction and PCR (polymerase chain reaction) amplification of influenza A virus nucleoprotein (NP) gene. We then sequenced NP gene fragments amplified from four patients to determine the sequence similarity with known NP genes in the GenBank. We further collected peripheral blood samples from four patients at different time points after the disease onset for quantitative analysis of GLE1 and LCP2 gene expression. Our results demonstrated that both GLE1 and LCP2 genes were upregulated at different time points after the disease onset in influenza A virus infected patients.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Study Participants</title><p>This study was approved by the Institutional Review Board of Affiliated Hospital of Zunyi Medical College and all procedures performed in studies involving human participants were in accordance with the ethical standards of the institutional and/or national research committee and with the 1964 Helsinki declaration and its later amendments or comparable ethical standards. Informed consent was obtained from all individual participants included in the study. Eleven patients (16 - 55 years old) with flu-like symptoms (such as fever, runny or stuffy nose, cough, sore throat, headaches and/or body aches), and two healthy volunteers were enrolled from October 2010 to February 2011 for this study. Patients were treated and recovered in about two weeks. Nasopharyngeal swabs and peripheral blood samples were collected from patients and healthy volunteers for viral RNA extraction and PCR amplification of the NP gene of influenza A viruses.</p></sec><sec id="s2_2"><title>2.2. Detection of Influenza Viral RNA</title><p>Collected nasopharyngeal swabs from 11 patients with flu-like symptoms were kept in the sample storage buffer and used immediately for viral RNA extraction with the RNA Kit manufactured by Tiangen Biotech (Beijing, China). The concentration of viral RNA was determined with NanoDrop 1000 Spectrophotometer (Thermo Scientific, Waltham, USA). Extracted viral RNA was reverse transcribed into complementary DNA (cDNA) by using the Quantscript RT Kit manufactured by Tiangen Biotech. Primers specific for the NP gene (<xref ref-type="table" rid="table1">Table 1</xref>) were designed for PCR amplification of a 1156-bp NP gene fragment (nucleotide positions 236 to 1392) from different subtypes of influenza A viruses including H1N1, H3N2, H5N1, H7N7, and H9N2. The reaction mixture (25 μl) containing both primers and complementary DNA was used for PCR amplification with the following cycling conditions: 95˚C for 2 min for denaturation, and 42 cycles of 20 s at 95˚C, 20 s at 60˚C, and 1 min 30 s at 68˚C followed by a final extension at 68˚C for 7 min. PCR products were analyzed by 1% agarose gel electrophoresis and sent to Invitrogen (Shanghai, China) for DNA sequencing. Sequencing results were analyzed and compared to viral sequences at the NCBI website (http://blast.ncbi.nlm.nih.gov/Blast.cgi) using the BLAST program [<xref ref-type="bibr" rid="scirp.71008-ref20">20</xref>] .</p></sec><sec id="s2_3"><title>2.3. Extraction of Total RNA from Lymphocytes</title><p>Peripheral blood samples (3 ml) were collected from four clinically confirmed influenza patients (P1 to P4) at days 3, 7 and 14 after disease onset. Lymphocytes were harvested from collected peripheral blood samples and used for extraction of total RNA by using the TRIzol reagent (Invitrogen). The concentration of total RNA was determined using the NanoDrop 1000 Spectrophotometer. Extracted total RNA was reverse transcribed into cDNA by using the Quantscript RT Kit.</p></sec><sec id="s2_4"><title>2.4. Quantitative Real-Time PCR</title><p>Primer sets specific for human GLEl and LCP2 genes and the endogenous control beta-globin (HBB) gene (Gene ID: 3043) were purchased from Invitrogen and used for the analysis of gene expression in peripheral blood samples of patients and healthy controls. The gene names, primer sequences, and sizes of predicted PCR products are listed in <xref ref-type="table" rid="table1">Table 1</xref>. Complementary DNA (2 μl, 50 ng/μl) was used in the quantitative real-time PCR by using the FQ-PCR Reaction System (Takara, Dalian, China) containing 15 μl SYBR II, 0.5 μl forward primer, 0.5 μl reverse primer and 7 μl distilled water. The iCycler iQ5 Real-Time PCR Detection System (Bio-Rad, USA) was used for the quantitative RT-PCR (reverse transcription polymerase chain reaction) with the following parameters: 3 min at 95˚C for the initial denaturation followed by 45 cycles of 10 s at 95˚C, 30 s at 59˚C, and 1 min 10 s at 72˚C. The PCR quantification data were collected and analyzed, and quantitative Ct (threshold cycle) results were calculated by using the iCycler iQ5 software with the normalized expression analysis method. Differences between samples from patients and healthy controls were generated by the iCycler iQ5 software. Each sample in the quantitative real-time PCR assay was analyzed in duplicate and normalized to the β-globin mean value. The fold changes between patient samples (P1 to P4) and control samples (C1 and C2) were calculated with the relative standard curve method.</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><p>To the best of our knowledge, neither GLE1 gene nor LCP2 gene has been linked to host responses to influenza A virus infections in humans. Therefore, we collected nasopharyngeal swabs from 11 patients with flu-like symptoms and peripheral blood samples from four of the patients as well as two healthy controls to conduct the current study. Collected nasopharyngeal swabs were used in RT-PCR for amplification of DNA fragment with primers specific for the NP gene of influenza A viruses (<xref ref-type="table" rid="table1">Table 1</xref>). Analysis of PCR products showed that the NP gene fragment (1156 bp) was amplified from four of 11 nasopharyngeal swabs collected from patients with flu-like symptoms, but none from 2 healthy controls. These results confirmed that four of the 11 patients were</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primer sequences and sizes of PCR products for four genes</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene</th><th align="center" valign="middle" >Forward primer (5' to 3')</th><th align="center" valign="middle" >Reverse primer (5' to 3')</th><th align="center" valign="middle" >Product size</th></tr></thead><tr><td align="center" valign="middle" >NP</td><td align="center" valign="middle" >AGAGGATGGTGCTTTCTGC</td><td align="center" valign="middle" >CCATCATTCTTATAACTTCTG</td><td align="center" valign="middle" >1156 bp</td></tr><tr><td align="center" valign="middle" >GLE1</td><td align="center" valign="middle" >ATGGCCTTGGAGGACTATCA</td><td align="center" valign="middle" >TCTGTCCTGAGCTCGTGATG</td><td align="center" valign="middle" >145 bp</td></tr><tr><td align="center" valign="middle" >LCP2</td><td align="center" valign="middle" >CCTCTCAGAAGTGAAGGCAG</td><td align="center" valign="middle" >CAATAATATCTGATACAGAC</td><td align="center" valign="middle" >177 bp</td></tr><tr><td align="center" valign="middle" >β-globin</td><td align="center" valign="middle" >ACACAACTGTGTTCACTAGC</td><td align="center" valign="middle" >CAACTTCATCCACGTTCACC</td><td align="center" valign="middle" >110 bp</td></tr></tbody></table></table-wrap><p>infected by influenza A viruses. However, it was unclear whether the rest seven patients were infected by influenza A viruses or not. Therefore, we only collected peripheral blood samples from these four patients (P1 to P4) and two healthy controls (C1 and C2) for further studies. To find out which influenza A virus might have caused the infection of these patients, amplified PCR products were used for DNA sequencing and results were compared to viral sequences at the NCBI website [<xref ref-type="bibr" rid="scirp.71008-ref20">20</xref>] . Sequence analysis revealed that NP gene fragments amplified from four patients shared the highest identity (from 89% to 99%) with the NP gene (GenBank: CY029140.1) from an avian influenza virus A/goose/Shantou/753/2002 (H5N1), indicating that these four patients were infected by an influenza A virus (<xref ref-type="table" rid="table2">Table 2</xref>).</p><p>Total RNAs extracted from peripheral blood samples of two healthy controls (C1 and C2) and four patients (P1 to P4) at days 3, 7 and 14 after disease onset were used for quantitative analysis of GLE1 and LCP2 gene expression. Total RNAs were reverse transcribed into cDNA by using the Quantscript RT Kit. Primer sets specific for human GLEl and LCP2 genes, and the endogenous control β-globin (HBB) gene (Gene ID: 3043) were used for the analysis of gene expression in peripheral blood samples (<xref ref-type="table" rid="table1">Table 1</xref>). The PCR quantification data were analyzed and quantitative Ct (threshold cycle) results were calculated by the iCycler iQ5 software using the normalized expression analysis method. Each sample was analyzed in duplicate and normalized to the β-globin mean value. The differences between samples from patients (P1 to P4) and healthy controls (C1 and C2) were calculated with the relative standard curve method.</p><p>As shown in <xref ref-type="fig" rid="fig1">Figure 1</xref>, GLEl gene expression was upregulated more than ten-fold in patient 2 at Day 3, and in patients 3 and 4 at Day 14; upregulated more than five-fold in patients 2 and 4 at Day 7; upregulated more than two-fold in patients 1 and 2 at Day 14 and in patient 3 at Day 7; but unchanged in patients 1, 3 and 4 at Day 3 after the disease onset compared to the healthy controls. Results from this study demonstrated that GLE1 gene was upregulated between two and ten-fold in influenza A virus infected patients at different time points after disease onset. In eukaryotic cells, the GLE1 protein is one of the principal components of the nuclear pore complexes (NPC) required for poly(A) + RNA export through NPC to the cytoplasm, which is an important step for proper gene expression [<xref ref-type="bibr" rid="scirp.71008-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.71008-ref21">21</xref>] . The fact that human GLEl gene is upregulated in influenza A virus infected patients suggests that the GLE1 protein may be involved in the virus-host interactions and could potentially become a novel therapeutic target for the treatment of influenza. Recently, GLEl gene was identified as one of the targets of microRNA miR-376a-3p which induced significant inhibition of cell proliferation, migration, colony formation and spheroid formation when transfected into giant cell tumor of bone (GCTB) derived stromal cells, indicating that miR-376a-3p and its target gene, GLE1, could be valuable therapeutic targets for treating the GCTB and possibly other types of cancers [<xref ref-type="bibr" rid="scirp.71008-ref22">22</xref>] .</p><p>Similar to GLEl gene, LCP2 gene expression was upregulated more than 40-fold in patient 1 and more than 25-fold in patient 2 at Day 3; more than ten-fold in patients 1, 2 and 4 at Day 7, and in patients 3 and 4 at Day 14; and more than two-fold in patient 1 at Day 14 and in patient 3 at Day 7 after disease onset compared to the healthy controls (<xref ref-type="fig" rid="fig2">Figure 2</xref>). Results showed that LCP2 gene was upregulated between two and 40-fold in influenza A virus infected patients at different time points after disease onset, suggesting that upregulation of LCP2 gene may be involved in the activation of intracellular signaling pathways and virus-host interactions. A recent report showed that quantitative reductions of Lcp2 protein in mutant mice produced excessive amounts of proinflammatory cytokines, autoantibodies, and IgE, which revealed a dose-sensitive threshold for Lcp2 protein in the balance of immunity and immune dysregulation [<xref ref-type="bibr" rid="scirp.71008-ref23">23</xref>] . In addition, LCP2 gene was identified as one of the three novel prognostic genes for diffuse large B-cell lymphoma (DLBCL) by using bioinformatic methods [<xref ref-type="bibr" rid="scirp.71008-ref24">24</xref>] . These studies indicate the importance of LCP2 gene in TCR signaling and immune regulations, and suggest that LCP2 gene could be used for subtyping and potential targets for treatment of DLBCL.</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> NP gene fragments amplified from nasopharyngeal swabs of four patients shared the highest identity with the NP gene of influenza virus A/goose/Shantou/753/2002 (H5N1)</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Patient No.</th><th align="center" valign="middle" >Name and subtype of matched influenza A virus</th><th align="center" valign="middle" >NP gene identity (%)</th></tr></thead><tr><td align="center" valign="middle" >P1</td><td align="center" valign="middle" >A/goose/Shantou/753/2002 (H5N1)</td><td align="center" valign="middle" >89</td></tr><tr><td align="center" valign="middle" >P2</td><td align="center" valign="middle" >A/goose/Shantou/753/2002 (H5N1)</td><td align="center" valign="middle" >99</td></tr><tr><td align="center" valign="middle" >P3</td><td align="center" valign="middle" >A/goose/Shantou/753/2002 (H5N1)</td><td align="center" valign="middle" >91</td></tr><tr><td align="center" valign="middle" >P4</td><td align="center" valign="middle" >A/goose/Shantou/753/2002 (H5N1)</td><td align="center" valign="middle" >97</td></tr></tbody></table></table-wrap><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Fold change of GLE1 gene expression in peripheral blood samples collected from influenza A virus infected patients at days 3, 7, and 14 after disease onset. P1, Patient 1; P2, Patient 2; P3, Patient 3; P4, Patient 4; C1, healthy control 1; and C2, healthy control 2. Each sample was analyzed in duplicate and normalized to the β-globin mean value. The fold changes between patients (P1 to P4) and healthy controls (C1 and C2) were calculated with the relative standard curve method. Data are presented as the mean and the standard deviation</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/6-1950250x7.png"/></fig><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Fold change of LCP2 gene expression in peripheral blood samples collected from influenza A virus infected patients at days 3, 7, and 14 after disease onset. P1, Patient 1; P2, Patient 2; P3, Patient 3; P4, Patient 4; C1, healthy control 1, and C2, healthy control 2. Each sample was analyzed in duplicate and normalized to the β-globin mean value. The fold changes between patients (P1 to P4) and healthy controls (C1 and C2) were calculated with the relative standard curve method. Data are presented as the mean and the standard deviation</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/6-1950250x8.png"/></fig></sec><sec id="s4"><title>4. Conclusion</title><p>In summary, results from this study demonstrated that GLE1 and LCP2 genes were upregulated in influenza A virus infected patients, suggesting that upregulation of these genes may be important for the host defense against influenza A virus infections. However, it is unclear what specific roles upregulation of GLE1 and LCP2 genes may play in the host defense against influenza A virus infections. We tried to compare our findings with similar studies but could not find any study which linked either GLE1 gene or LCP2 gene to host responses to influenza A virus infections in humans. One of the limitations of our study is that a relatively low number of participants were enrolled, because some eligible patients did not agree to sign the informed consent forms during the study period. Therefore, to confirm and extend the results from this study, more patients infected by different influenza A viruses will need to be enrolled, and future studies using established cell lines and animal models (such as Gle1- or Lcp2-knockout mice) challenged with different influenza A viruses should be conducted with methods similar to those reported recently [<xref ref-type="bibr" rid="scirp.71008-ref25">25</xref>] - [<xref ref-type="bibr" rid="scirp.71008-ref27">27</xref>] .</p></sec><sec id="s5"><title>Acknowledgements</title><p>This study was supported by the Fifth Science and Technology Innovation Team of Guizhou Province for Basic and Clinical Technology Innovation in Drug-resistant TB [No. (2012) 4011], the Second 2011 Collaborative Innovation Center of Guizhou Province for TB Prevention and Control in Guizhou Province (Incubation Project), and the Forth Talented Individual Base of Guizhou Province for Infectious Disease Prevention and Control.</p></sec><sec id="s6"><title>Conflicts of Interest</title><p>All authors except H.Z. declare no conflicts of interest. H.Z. is employed by and has shares in Z-BioMed, Inc., which is involved in the infectious disease research.</p></sec><sec id="s7"><title>Cite this paper</title><p>Wenfeng Peng,Yaping Shi,Baolin Wang,Bo Liu,Zhiyuan Peng,Jianyong Zhang,Ling Chen,Hong Zhang, (2016) Upregulation of GLE1 and LCP2 Genes in H5N1 Influenza Virus Infected Patients. Advances in Infectious Diseases,06,138-144. doi: 10.4236/aid.2016.63017</p></sec><sec id="s8"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.71008-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Centers for Disease Control and Prevention (CDC) (1997) Isolation of Avian Influenza A (H5N1) Viruses from Humans-Hong Kong, May-December 1997. Morbidity and Mortality Weekly Report, 46, 1204-1207.</mixed-citation></ref><ref id="scirp.71008-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Chen, Y., Liang, W., Yang, S., Wu, N., Gao, H., Sheng, J., Yao, H., Wo, J., Fang, Q., Cui, D., Li, Y., Yao, X., Zhang, Y., Wu, H., Zheng, S., Diao, H., Xia, S., Zhang, Y., Chan, K.H., Tsoi, H.W., Teng, J.L., Song, W., Wang, P., Lau, S.Y., Zheng, M., Chan, J.F., To, K.K., Chen, H., Li, L. and Yuen, K.Y. (2013) Human Infections with the Emerging Avian Influenza A H7N9 Virus from Wet Market Poultry: Clinical Analysis and Characterisation of Viral Genome. Lancet, 381, 1916-1925. http://dx.doi.org/10.1016/S0140-6736(13)60903-4</mixed-citation></ref><ref id="scirp.71008-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Wang, C., Wang, J., Su, W., Gao, S., Luo, J., Zhang, M., Xie, L., Liu, S., Liu, X., Chen, Y., Jia, Y., Zhang, H., Ding, H. and He, H. (2014) Relationship between Domestic and Wild Birds in Live Poultry Market and a Novel Human H7N9 Virus in China. Journal of Infectious Diseases, 209, 34-37. http://dx.doi.org/10.1093/infdis/jit478</mixed-citation></ref><ref id="scirp.71008-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Yang, Z.F., Mok, C.K., Peiris, J.S. and Zhong, N.S. (2015) Human Infection with a Novel Avian Influenza A(H5N6) Virus. New England Journal of Medicine, 373, 487-489. http://dx.doi.org/10.1056/NEJMc1502983</mixed-citation></ref><ref id="scirp.71008-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, H. (2009) Tissue and Host Tropism of Influenza Viruses: Importance of Quantitative Analysis. Science in China Series C: Life Sciences, 52, 1-10. http://dx.doi.org/10.1007/s11430-009-5009-5</mixed-citation></ref><ref id="scirp.71008-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Wang, B., Liu, B., Chen, L., Zhang, J., He, H. and Zhang, H. (2012) Qualitative and Quantitative Analyses of Influenza Virus Receptors in Trachea and Lung Tissues of Humans, Mice, Chickens and Ducks. Science in China Series C: Life Sciences, 55, 612-617. http://dx.doi.org/10.1007/s11427-012-4341-8</mixed-citation></ref><ref id="scirp.71008-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Sun, X. and Whittaker, G.R. (2013) Entry of Influenza Virus. Advances in Experimental Medicine and Biology, 790, 72-82. http://dx.doi.org/10.1007/978-1-4614-7651-1_4</mixed-citation></ref><ref id="scirp.71008-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">van de Sandt, C.E., Kreijtz, J.H. and Rimmelzwaan, G.F. (2012) Evasion of Influenza A Viruses from Innate and Adaptive Immune Responses. Viruses, 4, 1438-1476. http://dx.doi.org/10.3390/v4091438</mixed-citation></ref><ref id="scirp.71008-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Kash, J.C., Basler, C.F., García-Sastre, A., Carter, V., Billharz, R., Swayne, D.E., Przygodzki, R.M., Taubenberger, J.K., Katze, M.G. and Tumpey, T.M. (2004) Global Host Immune Response: Pathogenesis and Transcriptional Profiling of Type A Influenza Viruses Expressing the Hemagglutinin and Neuraminidase Genes from the 1918 Pandemic Virus. Journal of Virology, 78, 9499-9511. http://dx.doi.org/10.3390/v4091438</mixed-citation></ref><ref id="scirp.71008-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, H., Su, Y.A., Hu, P., Yang, J., Zheng, B., Wu, P., Peng, J., Tang, Y. and Zhang, L. (2006) Signature Patterns Revealed by Microarray Analyses of Mice Infected with Influenza Virus A and Streptococcus pneumoniae. Microbes and Infection, 8, 2172-2185. http://dx.doi.org/10.1016/j.micinf.2006.04.018</mixed-citation></ref><ref id="scirp.71008-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Alberts, R., Srivastava, B., Wu, H., Viegas, N., Geffers, R., Klawonn, F., Novoselova, N., do Valle, T.Z., Panthier, J.J. and Schughart, K. (2010) Gene Expression Changes in the Host Response between Resistant and Susceptible Inbred Mouse Strains after Influenza A Infection. Microbes and Infection, 12, 309-318. http://dx.doi.org/10.1016/j.micinf.2010.01.008</mixed-citation></ref><ref id="scirp.71008-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Watkins, J.L., Murphy, R., Emtage, J.L. and Wente, S.R. (1998) The Human Homologue of Saccharomyces cerevisiae Gle1p Is Required for Poly(A)+ RNA Export. Proceedings of the National Academy of Sciences of the United States of America, 95, 6779-6784. http://dx.doi.org/10.1073/pnas.95.12.6779</mixed-citation></ref><ref id="scirp.71008-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Dossani, Z.Y., Weirich, C.S., Erzberger, J.P., Berger, J.M. and Weis, K. (2009) Structure of the C-Terminus of the mRNA Export Factor Dbp5 Reveals the Interaction Surface for the ATPase Activator Gle1. Proceedings of the National Academy of Sciences of the United States of America, 106, 16251-16256. http://dx.doi.org/10.1073/pnas.0902251106</mixed-citation></ref><ref id="scirp.71008-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Stewart, M. (2010) Nuclear Export of mRNA. Trends in Biochemical Sciences, 35, 609-617. http://dx.doi.org/10.1016/j.tibs.2010.07.001</mixed-citation></ref><ref id="scirp.71008-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Nousiainen, H.O., Kestil?, M., Pakkasj?rvi, N., Honkala, H., Kuure, S., Tallila, J., Vuopala, K., Ignatius, J., Herva, R. and Peltonen, L. (2008) Mutations in mRNA Export Mediator GLE1 Result in a Fetal Motoneuron Disease. Nature Genetics, 40, 155-157. http://dx.doi.org/10.1038/ng.2007.65 </mixed-citation></ref><ref id="scirp.71008-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Folkmann, A.W., Dawson, T.R. and Wente, S.R. (2014) Insights into mRNA Export-Linked Molecular Mechanisms of Human Disease through a Gle1 Structure-Function Analysis. Advances in Biological Regulation, 54, 74-91. http://dx.doi.org/10.1016/j.jbior.2013.10.002</mixed-citation></ref><ref id="scirp.71008-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Wardenburg, J.B., Fu, C., Jackman, J.K., Flotow, H., Wilkinson, S.E., Williams, D.H., Johnson, R., Kong, G., Chan, A.C. and Findell, P.R. (1996) Phosphorylation of SLP-76 by the ZAP-70 Protein-Tyrosine Kinase Is Required for T-Cell Receptor Function. Journal of Biological Chemistry, 271, 19641-19644. http://dx.doi.org/10.1074/jbc.271.33.19641</mixed-citation></ref><ref id="scirp.71008-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Sela, M., Bogin, Y., Beach, D., Oellerich, T., Lehne, J., Smith-Garvin, J.E., Okumura, M., Starosvetsky, E., Kosoff, R., Libman, E., Koretzky, G., Kambayashi, T., Urlaub, H., Wienands, J., Chernoff, J. and Yablonski, D. (2011) Sequential Phosphorylation of SLP-76 at Tyrosine 173 Is Required for Activation of T and Mast Cells. EMBO Journal, 30, 3160-3172. http://dx.doi.org/10.1038/emboj.2011.213</mixed-citation></ref><ref id="scirp.71008-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Hussain, A., Mohammad, D.K., Gustafsson, M.O., Uslu, M., Hamasy, A., Nore, B.F., Mohamed, A.J. and Smith, C.I. (2013) Signaling of the ITK (Interleukin 2-Inducible T Cell Kinase)-SYK (Spleen Tyrosine Kinase) Fusion Kinase Is Dependent on Adapter SLP-76 and on the Adapter Function of the Kinases SYK and ZAP70. Journal of Biological Chemistry, 288, 7338-7350. http://dx.doi.org/10.1074/jbc.M112.374967</mixed-citation></ref><ref id="scirp.71008-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Altschul, S.F., Madden, T.L., Sch?ffer, A.A., Zhang, J., Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs. Nucleic Acids Research, 25, 3389-3402. http://dx.doi.org/10.1093/nar/25.17.3389 </mixed-citation></ref><ref id="scirp.71008-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Cole, C.N. and Scarcelli, J.J. (2006) Transport of Messenger RNA from the Nucleus to the Cytoplasm. Current Opinion in Cell Biology, 18, 299-306. http://dx.doi.org/10.1016/j.ceb.2006.04.006</mixed-citation></ref><ref id="scirp.71008-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Fellenberg, J., S?hr, H., Kunz, P., Zhao, Z., Liu, L., Tichy, D. and Herr, I. (2016) Restoration of miR-127-3p and miR-376a-3p Counteracts the Neoplastic Phenotype of Giant Cell Tumor of Bone Derived Stromal Cells by Targeting COA1, GLE1 and PDIA6. Cancer Letters, 371, 134-141. http://dx.doi.org/10.1016/j.canlet.2015.10.039 </mixed-citation></ref><ref id="scirp.71008-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Siggs, O.M., Miosge, L.A., Daley, S.R., Asquith, K., Foster, P.S., Liston, A. and Goodnow, C.C. (2015) Quantitative Reduction of the TCR Adapter Protein SLP-76 Unbalances Immunity and Immune Regulation. Journal of Immunology, 194, 2587-2595. http://dx.doi.org/10.4049/jimmunol.1400326</mixed-citation></ref><ref id="scirp.71008-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Li, C., Zhu, B., Chen, J. and Huang, X. (2015) Novel Prognostic Genes of Diffuse Large B-Cell Lymphoma Revealed by Survival Analysis of Gene Expression Data. OncoTargets and Therapy, 8, 3407-3413. http://dx.doi.org/10.2147/OTT.S90057</mixed-citation></ref><ref id="scirp.71008-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Tran, A.T., Rahim, M.N., Ranadheera, C., Kroeker, A., Cortens, J.P., Opanubi, K.J., Wilkins, J.A. and Coombs, K.M. (2013) Knockdown of Specific Host Factors Protects against Influenza Virus-Induced Cell Death. Cell Death Discovery, 4, e769. http://dx.doi.org/10.1038/cddis.2013.296</mixed-citation></ref><ref id="scirp.71008-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Zou, Z., Yan, Y., Shu, Y., Gao, R., Sun, Y., Li, X., Ju, X., Liang, Z., Liu, Q., Zhao, Y., Guo, F., Bai, T., Han, Z., Zhu, J., Zhou, H., Huang, F., Li, C., Lu, H., Li, N., Li, D., Jin, N., Penninger, J.M. and Jiang, C. (2014) Angiotensin-Converting Enzyme 2 Protects from Lethal Avian Influenza A H5N1 Infections. Nature Communications, 5, Article Number: 3594. http://dx.doi.org/10.1038/ncomms4594</mixed-citation></ref><ref id="scirp.71008-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Huang, F., Guo, J., Zou, Z., Liu, J., Cao, B., Zhang, S., Li, H., Wang, W., Sheng, M., Liu, S., Pan, J., Bao, C., Zeng, M., Xiao, H., Qian, G., Hu, X., Chen, Y., Chen, Y., Zhao, Y., Liu, Q., Zhou, H., Zhu, J., Gao, H., Yang, S., Liu, X., Zheng, S., Yang, J., Diao, H., Cao, H., Wu, Y., Zhao, M., Tan, S., Guo, D., Zhao, X., Ye, Y., Wu, W., Xu, Y., Penninger, J.M., Li, D., Gao, G.F., Jiang, C. and Li, L. (2014) Angiotensin II Plasma Levels Are Linked to Disease Severity and Predict Fatal Outcomes in H7N9-Infected Patients. Nature Communications, 5, Article Number: 3595. http://dx.doi.org/10.1038/ncomms4595</mixed-citation></ref></ref-list></back></article>