The infected agarwood samples were collected from Dibrugarh, Hojai and Rain Forest Research Institute, Jorhat of Assam State and Sarkkapathi, Aliyar Nagar of Tamil Nadu State and Kumily, Idukki District of Kerala State in India. The wood samples were chipped into 1 cm² and used for the isolation of fungal microorganisms. The cut chips were surface sterilized in 0.1% mercury chloride for 30 Sec and rinsed in sterile distilled water for three times and placed on PDA medium prepared in Petri dishes and incubated at room temperature (26˚C ± 2˚C) for 7 - 14 days. The fungal colonies appeared on PDA plates were sub-cultured and an axenic culture of the fungi was obtained by single hyphal tip technique and maintained in PDA slants to carry out further characterization studies.

The pure culture of individual fungi was observed for mycelial colour, texture and growth characters [9] . The microscopic slides were prepared from individual cultures to observe spores and mycelia under microscope. Based on the colony characters and morphology, the fungal isolates were tentatively identified.

The estimation of cellulose degradation was carried out as described in Gajera et al., 2008 [10] . The fungal cultures were grown in petri plates containing PDA. After eight days of inoculation, 10ml of sterile distilled water was added to each of the petri dishes and the mycelium was sufficiently wet. The mycelium from the petri dishes were transferred to conical flask and shaken well in orbital shaker at 120 RPM at 28˚C for about 4 hours. After that it was transferred to 30 ml centrifuge tubes and centrifuged at 10,000 RPM for 10 min. The culture (0.2 ml) was incubated with 0.4 ml of 0.1 M sodium citrate buffer (pH 5.0) containing 1% Carboxy Methyl Cellulose (CMC). After 30 min of incubation at 55˚C, the glucose released was estimated by DNS method. The activity of cellulase was expressed in μmols∙min⁻¹∙litre⁻¹. The experiment was repeated with three replications for each isolate and the mean values were calculated.

The activity of lignin modifying enzymes was detected by dye staining of lignin modifying basal medium (LBM) (KH₂PO₄: 1.00 g; Yeast Extract: 0.01 g; C₄H₁₂N₂O₆: 0.5 g; CuSO₄∙5H₂O: 0.001 g; MgSO₄∙7H₂O: 0.5 g; Fe(SO₄)₃: 0.001 g; CaCl₂∙2H₂O: 0.01 g per litre). LBM was supplemented with 1.6% w/v agar and autoclaved. To 100 ml of LBM, 1 ml of 20% aqueous glucose solution and 1 ml of 1% w/v aqueous tannic acid solution was added. After sterilization, the medium was transferred aseptically into the petri plates and used for the assessment of lignin degrading enzyme activity of the fungal isolates. Eight days old fungal culture was inoculated on LBM medium and the plates were incubated at 25˚C in darkness. The plates were examined regularly up to ten days. The lignin degrading enzyme activity was recorded based on the appearance of brown oxidation zones around the colony [11] .

The fungal cultures were grown in Petri plates containing PDA. After eight days of inoculation, 10ml of sterile distilled water was added to each of the petri dishes and the mycelium was sufficiently wet. The mycelium from the petri dishes were transferred to conical flask and shaken well in orbital shaker at 120 RPM at 28˚C for about 4 hours. After that, it was transferred to 30 ml centrifuge tubes and centrifuged at 10,000 RPM for 10 min. The supernatant was used for the assay of laccase. There action mixture consisted of 3 ml acetate buffer, 1 ml guaiacol and 1 ml enzyme source. The blank sample was prepared using 1 ml of deionized distilled water instead of enzyme source. The mixture was incubated at 28˚C for 5 min and absorbance was read at 450 nm in UV spectrophotometer. Enzyme activity was expressed as International Units (IU), where 1 IU is defined as amount of enzyme required to oxidize 1 micromole of guaiacol per min. The laccase activity in Uml⁻¹ is calculated from the extinction coefficient of guaiacol (6.39 M⁻¹∙cm⁻¹) at 450 nm by the formula:

where E∙A = Enzyme Activity (Uml⁻¹), A = Absorbance at 450 nm, V = Total volume of reaction mixture (ml), v = enzyme volume (ml), t = Incubation time (min) and e = Extinction Coefficient (M⁻¹∙cm⁻¹) [12] . The experiment was repeated with three replications for each fungus and the mean values were presented.

DNA was extracted from the mycelial mat of each strain grown on PDB for 7 days at 28˚C by CTAB method described by O’Donnel et al. [13] and Srinivasa et al. [14] . The mycelium was thoroughly ground into a fine homogenate using pallet pestle mixer. Seven hundred μl of CTAB buffer [2% CTAB (hexadecyltrimethylammonium bromide) 100 mM Tris-HCl [pH = 8] 20 mM EDTA, 1.4 M NaCl 0.2% β-mercaptoethanol [added just before use] 0.1 mg∙ml⁻¹ proteinase K [added just before use] was added to the tubes, mixed well and vortexed. This mixer was incubated at 65˚C for 10 minutes. Afterwards 400 μl extraction buffer (chloroform: isoamyl alcohol, 24:1, v/v/v) was added followed by gentle stirring on a vortex mixer till emulsion formation. The emulsion was centrifuged at 10,000 RPM for 10 minutes in a microcentrifuge at room temperature. An aliquot of the upper aqueous layer (600 μl) was collected, mixed with an equal volume of extraction buffer and re-centrifuged at 10,000 RPM for 10 min. From that upper layer 300 μl was taken and 0.5 volume of (150 μl) of 5 M NaCl and 600 μl of ice cold is opropanol was added and incubated at −20˚C for overnight. The mixture was centrifuged at 14,000 RPM for 10 minutes at 4˚C and the pellet was collected and suspended in 70% ethanol and re-centri- fuged at 5000 RPM for 10 min. Finally, the pellet was air-dried for 10 - 15 minutes and resuspended in 100 μl of Tris-EDTA (TE) buffer having 10 mM Tris-HCl (pH 8.0) 1 mM EDTA. To this, 2 μl RNAase was added and incubated at 37˚C for 90 min. The DNA concentration was estimated in DNA photometer and further confirmed by gel electrophoresis in 0.8% agarose gel containing 0.05% ethidium bromide.

The Internal Transcribed Spacers (ITS) primers ITS1 5’(TCCGTAGGTGAACCTGCGG)3’ as forward primer and ITS2 5’(GCTGCGTTCTTCATCGATGC)3’ as reverse primer were used for PCR amplification studies [15] . The PCR reaction was carried out in 50 μl volume. The PCR reaction contained 1 μl template DNA (100 ng∙μl⁻¹) from agarwood fungi, 1 μl (4.5 pMol) of respective primers, 5 μl Red eye master mix which contains 1 μl dNTPs (10 mM dNTP stock), 5 μl PCR buffer (TrisHCl buffer), 5 μl MgCl₂ (25 mM stock), 2.5 μl gelatin (1%) and taqpolymerase 0.5 μl of (5 units∙μl⁻¹). Deionized water was used to make the total reaction volume up to 50 μl. In order to ensure the reproducibility of the reaction, appropriate negative controls (without DNA template) were also run.PCR tubes were placed in thermocycler (Eppendorf) for DNA amplification with following PCR program: Initial denaturation at 94˚C for 4 minutes, forty cycles of 94˚C for 1 minute, 36˚C for 1 minute and 72˚C for 2 minutes. Following the cycling, mixture was incubated at 72˚C for 10 minutes and then kept at 4˚C for 12 hours. The PCR products were resolved on 2% agarose at 50 V stained with ethidium bromide (0.5 μg∙ml⁻¹) and photographed using gel documentation system (Alpha Innotech Corporation, USA).

Of several isolates amplified, the PCR product from the fungal isolate AR13 was purified from reaction mixture by agarose (1.2%, w/v) gel electrophoresis in TBE buffer containing 0.5 μg of ethidium bromide per ml. A small agarose slice containing the band of interest (observed under long-wavelength [312-nm] UV light) was excised from the gel and purified by using a QIA quick gel extraction kit (Qiagen, Inc., Chatsworth, California) according to the supplier’s instructions. This purification was performed to remove primer dimers and other residues from the PCR amplification. PCR product was sequenced at Chromous Biotech Pvt. Ltd., Bangalore, India. PCR sequence was identified using the basic local alignment search tool and submitted in GenBank nucleotide data bank, National Center for Biotechnology Information, Bethesda, MD, USA (http://www.ncbi.nlm.nih.gov/) and accession number was obtained for the isolate AR13.

A total of 17 fungal cultures were isolated from agarwood infected samples collected from Dibrugarh, Hojai and Rain Forest Research Institute, Jorhat of Assam, Sarkkapathi, Aliyar Nagar, Tamil Nadu and Kumily, Idukki District of Kerala, India. Of these, 3 isolates were from Dibrugarh (DIB1, DIB2, DIB3) and 4 isolates from Jorhat (RFRI4, RFRI5, RFRI6, RFRI7) of Assam, 6 isolates from Tamil Nadu (AR10, AR11, AR12, AR13, AR14, AR15) and 4 isolates from Kerala (K1, K2, K3 and K4). The colony characters such as colour of the mycelia mat, texture, mycelia growth of individual fungal isolates were observed on PDA medium. The mycelium and conidial characters of the individual fungal isolates were examined under microscope. The observations on colony characters and conidial characters were aided in tentative identification of the fungal cultures (Table 1). The fungi were identified as Aspergillus, Penicillium, Fusarium, Lasiodiploidia and Chaetomium.

A significantly higher activity of cellulase was measured in Aspergillus isolate AR13 (1181.952 μmole∙L⁻¹∙min) isolated from Aliyar Nagar of Tamil Nadu followed by Aspergillus isolate K1 (1140.608 μmole∙L⁻¹∙min) whereas the lesser activity was observed in Chaetomium isolate K4 (449.92 μmole∙L⁻¹∙min) (Table 2).

Laccase activity of fungal isolates revealed the higher secretion of laccase enzyme by Aspergillus isolates K1 (18.116 Uml⁻¹) and AR13 (17.125 Uml⁻¹). These two isolates showed significantly greater activity of laccase production when compared to the other isolates of agarwood fungi (Table 2).

The results of lignin degradation in LME medium supplemented with tannic acid showed brown layer as indicator of positive reaction for lignin degradation. Of seventeen isolates, Aspergillus isolates AR13 and K1 showed stronger ligninolytic activity. The isolates of Fusarium DIB2, RFRI7 showed the medium activity whereas less activity was observed in Lasiodiploidia DIB3, Chaetomium AR11 and Aspergillus K1 (Table 2).

Out of 17 isolates used in the PCR studies, the isolates RFRI4 (Lasiodiploidia sp.), AR10 (Chaetomium sp.), AR11 (Chaetomium sp.), AR14 (Penicillium sp.) and AR13 and K3 (Aspergillus sp.) have amplified ITS1 and ITS2 primers. The DNA gel electrophoresis showed that the amplified products were around 560 bp. Of this, the PCR product amplified from the isolate AR13 (Aspergillus sp.) was purified and sequenced (Figure 1). The nucleotide sequence data showed 93% homology to Aspergillus genus when blast with NCBI database. The nucleotide sequence of agarwood fungal isolate AR13 was submitted to NCBI and assigned with Accession No. KF263963.

¹Note: slope value = 7296. ²Note: Extinction coefficient for Guiacol 6.39. **Enzyme activity is significantly different from the other fungal microbes.