<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">ABB</journal-id><journal-title-group><journal-title>Advances in Bioscience and Biotechnology</journal-title></journal-title-group><issn pub-type="epub">2156-8456</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/abb.2016.76024</article-id><article-id pub-id-type="publisher-id">ABB-67646</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Therapeutic Potential of Bone Marrow Derived Mesenchymal Stem Cells in Modulating Astroglyosis of Surgical Induced Experimental Spinal Cord Injury
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Moataz</surname><given-names>A. Elawady</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mohammed</surname><given-names>M. Elmaghrabi</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Nesrine</surname><given-names>Ebrahim</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mona</surname><given-names>A. Elawady</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Dina</surname><given-names>Sabry</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ashraf</surname><given-names>Shamaa</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Alyaa</surname><given-names>Ragaei</given-names></name><xref ref-type="aff" rid="aff6"><sup>6</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>General Histology Department, Faculty of Medicine, Banha University, Banha, Egypt</addr-line></aff><aff id="aff5"><addr-line>Surgical and Radiology Department, Faculty of Veterinary Medicine, Cairo University, Giza, Egypt</addr-line></aff><aff id="aff6"><addr-line>General Histology Department, Faculty of Oral and Dental Medicine, Future University, Cairo, Egypt</addr-line></aff><aff id="aff3"><addr-line>Community Medicine Department, Faculty of Medicine, Banha University, Banha, Egypt</addr-line></aff><aff id="aff4"><addr-line>Medical Biochemistry Department, Faculty of Medicine, Cairo University, Giza, Egypt</addr-line></aff><aff id="aff1"><addr-line>Neurosurgery Department, Faculty of Medicine, Banha University, Banha, Egypt</addr-line></aff><pub-date pub-type="epub"><day>23</day><month>06</month><year>2016</year></pub-date><volume>07</volume><issue>06</issue><fpage>251</fpage><lpage>265</lpage><history><date date-type="received"><day>4</day>	<month>January</month>	<year>2016</year></date><date date-type="rev-recd"><day>accepted</day>	<month>20</month>	<year>June</year>	</date><date date-type="accepted"><day>23</day>	<month>June</month>	<year>2016</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Background: Spinal cord injury (SCI) unsuccessful regeneration was due to glial scar development. It was a major obstacle to axonal restoration. Safe therapeutic intervention by the use of bone marrow derived stem cells (BMMSCs) transplantation applied in the present study could reduce spinal disability. Material and methods: Forty male albino rats were divided into four groups: GI: negative control (n = 10 rats); GII: positive control after SCI (n = 10 rats); GIII: SCI + BM － MSCs intravenous injected and GIV: SCI + BM － MSCs intra lesion injected (n = 10 rats in each group). The samples were taken from spinal cord tissues around the region of injury and were subjected to histological, immunohistochemical assessment. RNA extraction and real time PCR for detection of nerve regeneration and astrocyte response to the injury were also performed. Results: Clinical improvement occurred by the enhancement in the Basso, Beattie and Bresnahan (BBB) score after SCI. Histological examinations showed positive regenerative responses in GIV compared to GIII. Conclusion: BM-MSCs transplantation has a promising role in enhancing the microenvironment for nerve regeneration through stumbling the glial scaring formation and inflammatory response after chronic spinal cord injury especially by using intra-lesion route injection.
 
</p></abstract><kwd-group><kwd>Spinal Cord Injury—Bone Marrow Mesenchymal Stem Cells</kwd><kwd> Rats and Glial Tissue</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>In the last couple of years, spinal cord injury (SCI) was the most devastating ailment afflicting males. A complete injury results in: permanent paralysis with complete loss of sensation in the affected limbs and trunk, as well as loss of bowel, bladder, and sexual functions [<xref ref-type="bibr" rid="scirp.67646-ref1">1</xref>] .</p><p>SCI does not only cause disabilities. It also has a deep impact on the social and economic prospects of the individual and the whole community. The high costs of treatment and prolonged hospitalization are an economic load on individual, the family and the society [<xref ref-type="bibr" rid="scirp.67646-ref2">2</xref>] .</p><p>The main cause for SCI especially at a young age was found to be accidents. As of now, there is no established therapeutic intervention capable of restoring significant neurological functions after SCI [<xref ref-type="bibr" rid="scirp.67646-ref3">3</xref>] .</p><p>Recent advances in stem cell research have bestowed great hope amongst researchers for the development of new treatments for many serious diseases. Finding out the potential of these cells demands significant scientific and medical evidence to derive beneficial ways which may then be offered as a clinical alternative to other existing present therapies [<xref ref-type="bibr" rid="scirp.67646-ref4">4</xref>] .</p><p>SCI is followed by secondary events including a strong inflammatory reaction which results in secondary tissue destruction and additional loss of the tissue function [<xref ref-type="bibr" rid="scirp.67646-ref5">5</xref>] . The unembellished lesions become dominated by the deposition of scar tissue composed of connective tissue and fluid-filled cysts, surrounded by dense, astroglial scars [<xref ref-type="bibr" rid="scirp.67646-ref6">6</xref>] .</p><p>Several studies on experimental animals exhibit how this scar represents a physical and molecular barrier, which isolates the lesion site from adjacent, healthy tissues. Meanwhile, it is also considered a center for the lack of axonal regrowth after injury [<xref ref-type="bibr" rid="scirp.67646-ref7">7</xref>] .</p><p>In our study, we aimed at focusing on the role of BM-MSCs and some growth factors in increasing or decreasing SCI.</p><p>Under normal physiological conditions, there is a dynamic balance between synthesis and degradation of tissue using the help of Matrix Metalloproteinases (MMPs)―a family of proteolytic enzymes―which is largely controlled by chemokines and cytokines secreted by inflammatory cells such as: Transforming Growth Factor-β (TGF-β) [<xref ref-type="bibr" rid="scirp.67646-ref8">8</xref>] .</p><p>The role of TGF-β in scar formation post-spinal cord injury explains why we use it as a parameter to observe the healing effect pronounced after BM-MSCs injection [<xref ref-type="bibr" rid="scirp.67646-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.67646-ref10">10</xref>] .</p><p>In previous experiments of SCI, TGF-β isoforms were shown not only to be involved in the early inflammatory response, but also to play an essential role in the formation of the scar at the lesion site. However, the extent to which experimental SCI induced changes of TGF-β expression, reflecting the events taking place following human SCI; remains unknown. Thus, the present investigation was undertaken to determine the pattern of TGF-β expression in samples, taken from animals of different groups following severe SCI and treatment [<xref ref-type="bibr" rid="scirp.67646-ref11">11</xref>] - [<xref ref-type="bibr" rid="scirp.67646-ref13">13</xref>] .</p><p>It was postulated that the functional recovery after SCI is not simply a significance of the mechanical destruction of tissue, but also ascribed to the appearance of complex secondary events leading to the regenerative failure of injured axons and formation of a glial scar.</p><p>The glial scar consists mainly of reactive astrocytes that arrest axon regeneration by secretion of chondroitin sulfate proteoglycans (CSPGs) which chemically arrest the regrowth [<xref ref-type="bibr" rid="scirp.67646-ref14">14</xref>] .</p><p>The glial scar formation took place due to astrocyte migration in the area of the lesion [<xref ref-type="bibr" rid="scirp.67646-ref15">15</xref>] [<xref ref-type="bibr" rid="scirp.67646-ref16">16</xref>] . The proliferative action of astrocytes depends on: actin cytoskeleton mediated by the small GTPases [<xref ref-type="bibr" rid="scirp.67646-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.67646-ref18">18</xref>] , integrity of the intermediate filament including vimentin and glial fibrillary acidic protein (GFAP), cell adhesion [<xref ref-type="bibr" rid="scirp.67646-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.67646-ref20">20</xref>] , and water invasion through the cells’ plasma membrane [<xref ref-type="bibr" rid="scirp.67646-ref21">21</xref>] .</p><p>Matrix metalloproteinases (MMPs) is a family of zinc-dependent endopeptidases that can destroy a variety of protein constituents in the extracellular matrix (ECM) and thus remodel per cellular microenvironment for cell translocation [<xref ref-type="bibr" rid="scirp.67646-ref22">22</xref>] . MMPs modulate numerous pathological and tissue-repair processes in the nervous system; particularly those that require cell migration [<xref ref-type="bibr" rid="scirp.67646-ref23">23</xref>] .</p><p>In the injured spinal cord, it is likely that MMPs may exert both constructive and disadvantageous effects, depending upon which members of the family are involved and where they are actively expressed [<xref ref-type="bibr" rid="scirp.67646-ref24">24</xref>] [<xref ref-type="bibr" rid="scirp.67646-ref25">25</xref>] .</p><p>Many investigators observed that MMP-2 and MMP-9 are expressed in reactive astrocytes after SCI, raising the possibility that these MMPs may participate in the formation of the glial scar. Recent studies have shown that astrocyte migration is modulated by MMPs [<xref ref-type="bibr" rid="scirp.67646-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.67646-ref27">27</xref>] .</p><p>The multipotent properties of MSCs and their remarkable malleability -to the extent that they can differentiate into lineage other than the tissue origin-sorted them into a suitable choice for studying their therapeutic effects in different injuries [<xref ref-type="bibr" rid="scirp.67646-ref28">28</xref>] .</p></sec><sec id="s2"><title>2. Materials and Methods</title><p>Forty male Albino rats were of 6 weeks old, weighing between 200 and 250 g. Rats were bred and maintained in an air-conditioned animal house with specific pathogen-free conditions. All experimental animals have ethical approval from the institutional animal care committee. They were subjected to a normal cycle and allowed to balance diet and water. All experimental protocols followed the guidelines of the Animal Committee of the Faculty of Medicine of Cairo University.</p><sec id="s2_1"><title>2.1. Experimental Design</title><p>Rats were divided into the following groups:</p><p>1) G I (Control group): 10 rats not exposed to SCI and served as −ve control.</p><p>2) GII (Spinal cord Injured group): 10 rats have surgical induced SCI and served as +ve control.</p><p>3) GIII (Spinal cord injury/BM-MSCs Intravenous group): 10 rats have surgical induced SCI. The rats were infused with 10<sup>7</sup> MScs/rat intravenously (through tail vein) and scarified after 6 weeks.</p><p>4) GIV (Spinal cord injured/BM-MSCs Intra-lesion group): 10 rats have surgical induced SCI. The rats were infused with 10<sup>7</sup> MScs/rat intra lesion and scarified after 6 weeks.</p><p>All rats were sacrificed and spinal cord tissue was harvested for histopathological, immunohistochemical examination and real time PCR analysis.</p></sec><sec id="s2_2"><title>2.2. Induction of Spinal Cord Injury</title><p>We performed surgical SCI induction according to Erbayraktar, Gokmen and Yilmaz [<xref ref-type="bibr" rid="scirp.67646-ref29">29</xref>] . In brief, Aseptic T9-T10 laminectomy under anesthesia (pentobarbital sodium; dose 50 - 80 mg/kg IP; Hospira, Lake Forest, IL) was performed. Spinal cord contusion was induced using a weight-drop apparatus, where a guided 10 g rod was dropped 12.5 or 25 mm onto the exposed dura mater, representing moderate or severe SCI, respectively.</p></sec><sec id="s2_3"><title>2.3. Isolation and Culture of BM-MSCs</title><p>Bone marrow cells were flushed from tibia and fibula of rat bones with phosphate-buffered saline (PBS) containing 2 mM EDTA. Over 15 ml Ficoll-Paque (Gibco-Invitrogen, Grand Island, NY), 35 ml of the diluted sample was carefully layered, centrifuged for 35 minutes at 400 xg rpm and the upper layer was aspirated leaving undisturbed mononuclear cell (MNC) layer at the interphase. This MNC layer was aspirated, washed twice in PBS containing 2 mM EDTA and centrifuged for 10 minutes at 200 xg rpm at 10˚C. The cell pellet was re-suspended in a final volume of 300 μl of buffer. Isolated MSCs were cultured on 25 ml culture flasks in minimal essential medium (MEM) supplemented with 15% fetal bovine serum (FBS) and incubated for 2 hours at 37˚C and 5% CO<sub>2</sub>. Adherent MSCs were cultured in MEM supplemented with 30% FBS, 0.5% penicillin, streptomycin and at 37˚C in 5% CO<sub>2</sub> in air [<xref ref-type="bibr" rid="scirp.67646-ref12">12</xref>] . Cultured MSCs was confirmed by morphology and Florescent Analysis Cell Sorting (FACS) by detection of CD29<sup>+</sup> and CD44<sup>+</sup> specific to MSCs.</p></sec><sec id="s2_4"><title>2.4. Labeling Stem Cells with GFP</title><p>At 4<sup>th</sup> passage, MSCs were harvested and labeled with GFP (amaxa GmbH, amaxa Inc. Europe/World USA Scientific Support). MSCs were nucleofected using the MSC Nucleofector Kit and a plasmid encoding the fluorescent protein GFP. Cells were centrifuged, washed twice in serum free medium, pelleted and suspended in nucleofector solutions. A final concentration of (4 - 5) &#215; 10<sup>5</sup> cells/100 μl nucleofector solutions was applied. The sample was placed in cuvette of elactroporation transfection instrument at program U-23 (for high transfection efficiency) or C-17 (for high cell survival). 24 hours post-nucleofection cells were analyzed by light and fluorescence microscopy. Transfection efficiencies of around 80% can be reached with GFP. Labeled cells were injected intravenously in rat with surgical induced SCI. After 6 weeks, spinal cord tissue was examined with a fluorescence microscope (Leica, Germany) to detect and trace the cells stained with GFP.</p></sec><sec id="s2_5"><title>2.5. Histopathological Examination</title><p>Spinal tissues were collected and divided into two sections. The first section was assessed for tracing of injected labeled cells with GFP. The second section was washed with PBS and fixed overnight in 40 g/L paraformaldehyde at 4˚C. Serials (μm sections of the dissected spinal cord tissues were stained with hematoxylin and eosin (H&amp;E) [<xref ref-type="bibr" rid="scirp.67646-ref30">30</xref>] .</p></sec><sec id="s2_6"><title>2.6. Immunohistochemistry</title><p>Immunohistochemical staining was performed on 5-&#181;m, formalin-fixed, paraffin-embedded sections using the glialfibillary acidic protein (GFAP) antibodies and anti myline basic protein (MBP) antibody at 1:50 dilution (DAKO, Carpinteria, CA). Antigen retrieval was performed in all cases by steam heating the slides in a 1-mmol/L solution of EDTA (pH 8.0) for 30 minutes. After blocking of endogenous biotin, staining was performed using an automated immunostainer (DAKO) followed by detection by using a streptavidin-biotin detection system (DAKO). Positive and negative control sections were used for each assay [<xref ref-type="bibr" rid="scirp.67646-ref31">31</xref>] .</p></sec><sec id="s2_7"><title>2.7. Computer Assisted Digital Image Analysis (Digital Morphometric Study)</title><p>Slides were photographed using Olympus digital camera installed on microscope with 1/2 X photo adaptor, using 40 X objective. The result images were analyzed by using (Russia) software with a specific built-in routine for stain quantification. 5 slides from each case were prepared, 5 random fields from each slides were analyzed. Integrated density of the immunostain was quantified and exported to an excel sheet for statistical analysis.</p></sec><sec id="s2_8"><title>2.8. RNA Extraction</title><p>Tissue of all studied groups was homogenized and total RNA was isolated with RNAeasy Mini Kit (Qiagen) and further analyzed for quantity and quality with Beckman dual spectrophotometer (USA).</p></sec><sec id="s2_9"><title>2.9. Real Time PCR (qRT-PCR)</title><p>For quantitative expression of TGF-β, MMP-2 and MMP-9 genes; the following procedure were assessed. 200 ng of the total RNA from each sample were used for cDNA synthesis by reverse transcription using High capacity cDNA Reverse Transcriptase kit (Applied Biosystem, USA). The cDNA was subsequently amplified with the Syber Green I PCR Master Kit (Fermentas) in a 48-well plate using the Step One instrument (Applied Biosystem, USA) as follows: 10 minutes at 95˚C for enzyme activation followed by 40 cycles of 15 seconds at 95˚C, 20 seconds at 55˚C and 30 second at 72˚C for the amplification step. Changes in the expression of each target gene were normalized relative to the mean critical threshold (CT) values of GAPDH housekeeping gene by the ΔΔCt method. We used 1 μM of both primers specific for each target gene. Primers sequence and annealing temperature specific for each gene demonstrated in <xref ref-type="table" rid="table1">Table 1</xref>.</p></sec><sec id="s2_10"><title>2.10. Behavioral Assessment</title><p>The functional status of the hindlimbs was assessed 6 weeks after SCI, using the Basso, Beattie and Bresnahan</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers sequence and annealing temperature specific for each gene</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Target gene</th><th align="center" valign="middle" >Primer sequence: 5’-3’</th><th align="center" valign="middle" >Gene bank accession number</th></tr></thead><tr><td align="center" valign="middle" >TGF-β</td><td align="center" valign="middle" >Forward: TGCGCCTGCAGAGATTCAAG Reverse: AGGTAACGCCAGGAATTGTTGCTA</td><td align="center" valign="middle" >NM021578.2</td></tr><tr><td align="center" valign="middle" >MMP-2</td><td align="center" valign="middle" >Forward: CTATTCTGTCAGCACTTTGG Reverse: CAGACTTTGGTTCTCCAACTT</td><td align="center" valign="middle" >NM031054.2</td></tr><tr><td align="center" valign="middle" >MMP-9</td><td align="center" valign="middle" >Forward: AAATGTGGGTGTACACAGGC Reverse: TTCACCCGGTTGTGGAAACT</td><td align="center" valign="middle" >NM031055.1</td></tr><tr><td align="center" valign="middle" >GAPDH</td><td align="center" valign="middle" >Forward: CACCCTGTTGCTGTAGCCATATTC Reverse :GACATCAAGAAGGTGGTGAAGCAG</td><td align="center" valign="middle" >NG028301.2</td></tr></tbody></table></table-wrap><p>(BBB) locomotor rating scale [<xref ref-type="bibr" rid="scirp.67646-ref32">32</xref>] .</p></sec><sec id="s2_11"><title>2.11. Statistical Analysis</title><p>Measurement data are expressed as the mean &#177; SD. Statistical analyses were performed with SPSS 12.0 software (SPSS, Chicago, IL, USA). For cell viability assays, analysis of variance (ANOVA) was applied to identify significant differences. BBB locomotor rating scores and cell counts at different time points were carried out using repeated measures analysis of variance. p &lt; 0.05 was considered statistically significant.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Morphological, Phenotype Characteristics and GFP-Labeling Identification of Expanded Undifferentiated (BMSCs)</title><p>Under an inverted microscope (Leica, Germany).Undifferentiated (BMSCs) were typical of adherent spindle and fibrocyte-like at one week culture and reached 80% - 90% confluence at 2 weeks culture (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a) and <xref ref-type="fig" rid="fig1">Figure 1</xref>(b) respectively). After plastic adherence selection, BMSCs were culture over four passages. Flow cytometric analysis of the MSCs at the 4th passage showed that these cells were positive for CD90 (96.2%) and CD 73 (98.7%) and negative of hematopoietic/ endothelial markers CD45 (0%) (<xref ref-type="fig" rid="fig1">Figure 1</xref>(c)). These results indicated that relatively purified (BM-MSCs) were isolated. Before cells injecting, GFP-labelled BM-MSCs were analyzed and confirmed for their green auto fluorescence for in vivo cells tracing (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)).</p></sec><sec id="s3_2"><title>3.2. BMSCs Homing and Florescence Assessment</title><p>Frozen florescence microscopy of the section of the cell treated spinal cord tissue of all groups indicated that the GFP-transduced injected cells were assimilated within spinal cord tissue (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)).</p></sec><sec id="s3_3"><title>3.3. Behavior Assessment</title><p>At 5<sup>th</sup> week after injection of mesenchymal stem cells, there are improvements in locomotor function (p &gt; 0.01)</p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> (a) BMSCS at one week of culture (30% - 40% confluent), (b) BMSCs at two weeks of culture (80% - 90% confluent), (c) it shows CD markers expressed for mesenchymal stem cells</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-7301173x7.png"/></fig><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> (a) Labeling of BMSCs with GFP fluorescent dye (in vitro), (b) homing of the injected labeled BMSCs by detecting GFP fluorescent dye in the rat spinal cord tissue (in vivo)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-7301173x8.png"/></fig><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Showed histogram for the assessed motor and sensory functions of rats in all studied groups</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-7301173x9.png"/></fig><p>such that GIII and GIV showed a significant increase in BBB score compared with control group p &gt; 0.01.</p><p>This trend indicates that mesenchymal stem cells injection is necessary for locomotor function recovery. At the 1<sup>st</sup> week after injection GIV showed significant increase in BBB score compared with GI but at 1<sup>st</sup> week after injection intravenous GIII showed significant decrease in BBB score compared with GI p &gt; 0.01 which was gradually increased showing increased locomotor function at the fifth week post stem cells injection. Motor and sensory functions were demonstrated at <xref ref-type="fig" rid="fig3">Figure 3</xref>.</p></sec></sec><sec id="s4"><title>4. Histopathological Results</title><p>GI (Control group): Spinal cord sections showed normal architecture where the grey matter surrounded by white matter. The ventral horn with number of processes extends into the white mater. Large multipolar cells that are relatively large compared to the nerve fibers which surround these cells. The surrounding nerve fibers are neuroglial cells, although the cytoplasm of these cells is not visible (<xref ref-type="fig" rid="fig4">Figure 4</xref>(a), <xref ref-type="fig" rid="fig4">Figure 4</xref>(b)).</p><p>Meanwhile Untreated GII: spinal cord sections 36 days post injury showed hemorrhagic emphasis in the grey and white matters with complete destruction of the tissue, this was represented in neuron dissolution giving liquefied appearance in grey matter (<xref ref-type="fig" rid="fig5">Figure 5</xref>(a)). Sections of this injured group showed as well eosinophilic (degenerating) neurons and pyknotic nuclei. Swollen cells and many vacuoles were demonstrated. Some dark shrunken neurons were also detected (<xref ref-type="fig" rid="fig5">Figure 5</xref>(b)). There was deceptive cellular destruction and necrosis as compared to all other groups (<xref ref-type="fig" rid="fig5">Figure 5</xref>(c), <xref ref-type="fig" rid="fig5">Figure 5</xref>(d)).</p><fig id="fig4"  position="float"><label><xref ref-type="fig" rid="fig4">Figure 4</xref></label><caption><title> (a) Photomicrograph GI: showing normal view of the grey matter (G) of the spinal cord which is clearly surrounded by white matter (W). The ventral horn has a number of processes which extend into the white mater (H&amp;E &#215;100). (b) Photomicrograph GI: normal spinal cord tissue displaying number of multipolar cells (arrow) that are relatively large compared to the nerve fibers which surround these cells (H&amp;E &#215;200)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-7301173x10.png"/></fig><fig id="fig5"  position="float"><label><xref ref-type="fig" rid="fig5">Figure 5</xref></label><caption><title> (a) photomicrograph of spinal cord tissue section of GII (untreated group): showing hemorrhagic focus (H) in the grey and white matters (H&amp;E &#215;100). (b) photomicrograph of spinal cord tissue section GII :showing neuron dissolution giving liquefied appearance in grey matter (arrow), degenerated areas and well eosinophilic degenerating neuron (arrow heads) (H&amp;E &#215;100). (c) Photomicrograph of spinal cord tissue section GII: showing swollen cells and many vacuoles (arrow) some dark irregular shrunken neurons with pyknotic nuclei (P) were demonstrated (H&amp;E &#215;200). (d) Photomicrograph of spinal cord tissue section GII: showing apparent cellular destruction and necrosis (N) as compared to all other groups (H&amp;E &#215;100)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-7301173x11.png"/></fig><p>Group III in which animals were intravenously treated with BM-MSCs spinal cord sections showed, apparently more glia cells and less dark neurons as compared to both normal control and untreated groups (<xref ref-type="fig" rid="fig6">Figure 6</xref>(a)). In addition, some areas showed inflammatory infiltrates, pyknotic cells surrounded by diffused glial cells with the presence of some vacuoles (<xref ref-type="fig" rid="fig6">Figure 6</xref>(b)).</p><p>Group IV animals were treated intra lesion with BM-MSCs. spinal cord sections showed normal structure of spinal cord tissue: the neurons are well observed, the outer limits of the grey &amp; white matters are marked with no cystic spaces (<xref ref-type="fig" rid="fig7">Figure 7</xref>(a), <xref ref-type="fig" rid="fig7">Figure 7</xref>(b)). However, a small hemorrhage aggregation was still observed in some sections as well as slight gathering of gliocytes were still denoted (<xref ref-type="fig" rid="fig7">Figure 7</xref>(c)).</p></sec><sec id="s5"><title>5. Quantitative Genes Expression</title><p>Regarding gene expression, TGF-β, gene was highly expressed in GII and expression was significantly decreased after stem cells administration. Least expression was in GI. Nevertheless, there was significant difference between GIII and GIV where GIII showed higher expression than GIV. As regard to gene expressions of MMP-2 and MMP-9; they were highly expressed in spinal cord tissues in the GII, while significant decrease in their expression in both GIII &amp;GIV compared to GII. MMP-9 and MMP-2 genes in GIV were significantly highly expressed compared to control group GI (<xref ref-type="table" rid="table2">Table 2</xref>).</p></sec><sec id="s6"><title>6. Immunohistochemistry Results</title><p>Anti-GFAP stained spinal cord sections: spinal cord sections of GI exposed brown immunostaining in the cytoplasm and processes of astrocytes in all regions in white and grey matter. The immunoreactive cells were detected mainly in a regular form in both regions (<xref ref-type="fig" rid="fig8">Figure 8</xref>(a), <xref ref-type="fig" rid="fig8">Figure 8</xref>(b)). GII showed highly significant immunoreactivity as compared to GI and all other groups; the immunoreactive astrocytes were detected mainly in all spinal tissues closely related to site of the lesion The dense packing of intensely GFAP-positive astroglial processes between the spaces made it extremely difficult to comment on changes in astrocytic cell body density (<xref ref-type="fig" rid="fig9">Figure 9</xref>(a), <xref ref-type="fig" rid="fig9">Figure 9</xref>(b)). Comparing both GIII intravenous and GIV intra lesion treated groups to the untreated group, Anti-GFAP stained spinal cord sections showed moderate reactivity which was restricted to the place of lesion as going further away from the lesion site, no significant astrocytic reaction could be detected. There was no indication of increased GFAP immunoreactivity, and the astrocytic processes and cell bodies appeared normal in both grey matter and white matter tracts (<xref ref-type="fig" rid="fig1">Figure 1</xref>0(a), <xref ref-type="fig" rid="fig1">Figure 1</xref>0(b)). Still GIV showed better results rather than GIII. <xref ref-type="table" rid="table3">Table 3</xref> showed the mean area percent of GFAP and mylien basic protein immunopositive cells in control and all experimental groups.</p><fig id="fig6"  position="float"><label><xref ref-type="fig" rid="fig6">Figure 6</xref></label><caption><title> (a) photomicrograph of spinal cord tissue section of group III (intravenously treated with BMSCs) showing apparently more glia cells and less dark neurons (arrow) and degenerated areas (D) (H&amp;E &#215;100). (b) photomicrograph of spinal cord tissue section of group III intravenously treated with BMSCs showing some areas inflammatory infiltrates (arrow), pyknotic cells surrounded by diffused glial cells (G) &amp;with mild vacuolation (V) (H&amp;E &#215;100)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-7301173x12.png"/></fig><fig id="fig7"  position="float"><label><xref ref-type="fig" rid="fig7">Figure 7</xref></label><caption><title> ((a), (b)) Photomicrograph of GIV: (intra lesion injection BMSCs treated group) spinal cord tissue sections showing normal structure the neurons are clearly visible, the outer limits of the grey &amp; white matters are marked and there were no cystic spaces (H&amp;E &#215;100 (a), H&amp;E &#215;200 (b)). (c) Photomicrograph of spinal cord tissue section of group IV showing a small amount of tissue hemorrhage (H) a slight gathering of gliocytes (arrow) (H&amp;E &#215;200)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-7301173x13.png"/></fig><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Showing quantitative expression of all studied genes</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene symbol</th><th align="center" valign="middle" >Mean &#177; SD</th><th align="center" valign="middle" >95% CI</th><th align="center" valign="middle" >F test</th><th align="center" valign="middle" >p value</th></tr></thead><tr><td align="center" valign="middle" >TGF-β Group I Group II Group III Group IV</td><td align="center" valign="middle" >0.56 &#177; 0.17 1.83 &#177; 1.28 0.97 &#177; 0.55 0.71 &#177; 0.33</td><td align="center" valign="middle" >0.45 - 0.66 1.02 - 2.65 0.61 - 1.32 0.5 - 0.92</td><td align="center" valign="middle" >7.54</td><td align="center" valign="middle" >0.001**</td></tr><tr><td align="center" valign="middle" >MMP2 Group I Group II Group III Group IV</td><td align="center" valign="middle" >0.69 &#177; 0.25 1.51 &#177; 0.72 1.14 &#177; 0.50 0.99 &#177; 0.52</td><td align="center" valign="middle" >0.53 - 0.85 1.05 - 1.97 0.82 - 1.46 0.66 - 1.32</td><td align="center" valign="middle" >5.01</td><td align="center" valign="middle" >0.004**</td></tr><tr><td align="center" valign="middle" >MMP9 Group I Group II Group III Group IV</td><td align="center" valign="middle" >0.78 &#177; 0.25 1.55 &#177; 0.60 1.13 &#177; 0.45 1.03 &#177; 0.36</td><td align="center" valign="middle" >0.62 - 0.94 1.17 - 1.94 0.84 - 1.41 0.80 - 1.26</td><td align="center" valign="middle" >6.64</td><td align="center" valign="middle" >0.001**</td></tr></tbody></table></table-wrap><p>p value highly significant (p &lt; 0.001) -: p value significant (p &lt; 0.05).</p><fig id="fig8"  position="float"><label><xref ref-type="fig" rid="fig8">Figure 8</xref></label><caption><title> Arrows showing brown immunopositivestaining in the cytoplasm and processes of astrocytes in all regions in white (a) and (b) grey matter (Anti-GFAP &#215;200)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-7301173x14.png"/></fig><fig id="fig9"  position="float"><label><xref ref-type="fig" rid="fig9">Figure 9</xref></label><caption><title> ((a), (b)) Photomicrograph of spinal cord transverse sections group II (untreated group) revealed apparently strong immunopositive staining detected mainly at the sight of lesion (Anti-GFAP &#215;200)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-7301173x15.png"/></fig><fig id="fig10"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref>0</label><caption><title> (a) Photomicrograph of spinal cord transverse sections of group III spinal cord sections showed moderate GFAP immunopositive staining in astrocytes (Anti-GFAP &#215;200). (b) Photomicrograph of spinal cord transverse sections of group IV spinal cord sections showed less significant GFAP immunopositive staining (arrows) in astrocytes compared to group III (Anti- GFAP &#215;200)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-7301173x16.png"/></fig><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Showed mean area percent of immunopositive cells in all studied groups</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" >GFAP stain mean &#177; SD</th><th align="center" valign="middle" >Mylein basic protein stain mean &#177; SD</th></tr></thead><tr><td align="center" valign="middle" >Intra-lesional group</td><td align="center" valign="middle" >113.2 &#177; 26.32</td><td align="center" valign="middle" >146.74 &#177; 4.87</td></tr><tr><td align="center" valign="middle" >Intra-venous group</td><td align="center" valign="middle" >148.45 &#177; 18.3</td><td align="center" valign="middle" >128.74 &#177; 10.18</td></tr><tr><td align="center" valign="middle" >Control group</td><td align="center" valign="middle" >195.44 &#177; 18.23</td><td align="center" valign="middle" >103.05 &#177; 10.7</td></tr><tr><td align="center" valign="middle" >F test</td><td align="center" valign="middle" >44.68</td><td align="center" valign="middle" >49.26</td></tr><tr><td align="center" valign="middle" >p value</td><td align="center" valign="middle" >0.001<sup>**</sup></td><td align="center" valign="middle" >0.001<sup>**</sup></td></tr></tbody></table></table-wrap><p>p value highly significant (p &lt; 0.001) -: p value significant (p &lt; 0.05).</p><p>Anti-MBP staining established a decrease in density of myelin rings in the degenerating white matter in group II compared to normal control and both treated groups (<xref ref-type="fig" rid="fig1">Figure 1</xref>1(a), <xref ref-type="fig" rid="fig1">Figure 1</xref>1(b)). GII overall showed a heterogeneous and shapeless structure, which most likely represented degenerated myelin sheath.</p><p>On the other hand number of apparently intact MBP-positive myelin rings visible in GIII shown in (<xref ref-type="fig" rid="fig1">Figure 1</xref>2(a), <xref ref-type="fig" rid="fig1">Figure 1</xref>2(b)) with lots of myelin degenerated areas. Group IV showed deep positive MBP staining indicating the good sign of tissue healing to somehow approaching normal spinal cord tissue (<xref ref-type="fig" rid="fig1">Figure 1</xref>3).</p><fig id="fig11"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref>1</label><caption><title> (a) Photomicrograph of spinal cord transverse sections of GI: showing positive myline basic protein staining with normal appearance of white and grey matter. Myline basic protein (&#215;200). (b) Photomicrograph of spinal cord transverse sections of GII: showing negative myline basic stain and degeneration in white matter (arrows). Myline basic (&#215;200)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-7301173x17.png"/></fig><fig id="fig12"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref>2</label><caption><title> ((a), (b)) Photomicrograph of spinal cord transverse sections GIII: showing moderate reactivity of myelin basic indicating the reformation of myelin sheath. Myelin basic (&#215;200)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-7301173x18.png"/></fig><fig id="fig13"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref>3</label><caption><title> Photomicrograph of spinal cord transverse sections of intra Lesion treated group IV showing strong myelin basic reaction with some Weilerrings (arrows) were observed indicating the reformation of myelin sheath. Myelin basic (&#215;200)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-7301173x19.png"/></fig></sec><sec id="s7"><title>7. Discussion</title><p>Spinal cord injuries (SCI) result in everlasting incapacities. They persist throughout the person’s life, with no chance of recovery. Spinal cord injury is not simply a significance of the initial mechanical destruction of tissue, but also accredited to the evolution of complex secondary events that contribute to early, along with, delayed cell injury. In our study, we aimed at focusing on the role of TGF-β, MMP-9 and MMP-2 involvement in increasing or decreasing tissue repair after induced SCI. Previous studies showed that TGF-β is a major mediator influencing collagen turnover, thus increasing the potential of scar formation in SCI [<xref ref-type="bibr" rid="scirp.67646-ref33">33</xref>] .</p><p>TGF-β has already been known to possess receptors for alpha granules of platelets and macrophages, which in turn increase their accumulation at the sight of injury leading to scar formation [<xref ref-type="bibr" rid="scirp.67646-ref10">10</xref>] . This illustrates its highly expressed potential in untreated group II and its diminished expression in both treated groups III and IV in the present study.</p><p>Proteinases like matrix metalloproteinases (MMPs) is a family of extracellular zinc- and calcium-dependent endopeptidases [<xref ref-type="bibr" rid="scirp.67646-ref34">34</xref>] , essential for remodeling of the extracellular matrix, tissue morphogenesis, and wound healing. In our study, MMPs are shown to be highly expressed in GII rather than other treated and control groups. However, some investigators perceived that excessive proteolytic activity of MMPs can lead to numerous pathologic conditions, including disruption of the blood-brain barrier [<xref ref-type="bibr" rid="scirp.67646-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.67646-ref35">35</xref>] , and inflammation [<xref ref-type="bibr" rid="scirp.67646-ref36">36</xref>] [<xref ref-type="bibr" rid="scirp.67646-ref37">37</xref>] . MMP-9 reduces collagens, elastin, vitronectin, myelin basic protein and other substrates [<xref ref-type="bibr" rid="scirp.67646-ref38">38</xref>] . This protease is predominantly expressed by inflammatory cells, including macrophages, lymphocytes, and neutrophils, as well as endothelial cells [<xref ref-type="bibr" rid="scirp.67646-ref39">39</xref>] [<xref ref-type="bibr" rid="scirp.67646-ref40">40</xref>] . MMP-9 is expressed in microglia, astrocytes, and hippocampal neurons, and can be induced in astrocytes [<xref ref-type="bibr" rid="scirp.67646-ref41">41</xref>] .</p><p>We have focused on the role of MMP-9 and MMP-2 because of their beneficial effects in glial scarring [<xref ref-type="bibr" rid="scirp.67646-ref43">43</xref>] . Moreover, the increased migration capacity of white matter astrocytes on laminin is mediated by MMP-9 and MMP-2, thus increasing the reformation of tissue scar [<xref ref-type="bibr" rid="scirp.67646-ref42">42</xref>] .</p><p>Through our study, we find that in the injured spinal cord untreated GII there is an increase in the level of MMP-9, MMP-2 and GFPA while there is a decrease in the level of MBP. But in GIII and GIV, treated with stem cells, there is a decrease in the level of MMP-9, MMP-2 and GFPA while there is an increase in MBP.</p><p>Our findings are concurrent with previous studies were astrogliosis observed in the untreated tissues was attributed primarily to increased migration of astrocytes toward the site of a lesion [<xref ref-type="bibr" rid="scirp.67646-ref43">43</xref>] [<xref ref-type="bibr" rid="scirp.67646-ref44">44</xref>] . Astrocytes-derived from ependymal cells-migrate into the lesion to participate in glial scar formation after spinal cord injury in the adult [<xref ref-type="bibr" rid="scirp.67646-ref45">45</xref>] . Thus, proliferation of migratory astrocytes was involved in astrogliosis; considered to be non-suitable media for tissue regeneration.</p><p>The increase in GFAP in GII is due to the alterations in the intermediate filament cytoskeleton which have been occupied in astrocyte motility. Investigators had stated that astrocytes express GFAP as intermediate filament re-expressed in reactive astrocytes, which display abnormal morphology and severely compromised motile behavior [<xref ref-type="bibr" rid="scirp.67646-ref46">46</xref>] .</p><p>The increase in MBP in our study was attributed to the repairing effect of stem cells which affect how MMPs facilitate the migration of bipotential oligodendrocyte-type 2 astrocyte progenitors on CNS myelin―a strongly inhibitory substrate that can be inactivated by proteolytic degradation mediated by metalloproteases [<xref ref-type="bibr" rid="scirp.67646-ref47">47</xref>] . Hence, decreased Weilerring and reformation of myelin sheath were well observed in group III and group IV in the present study.</p><p>Also we found that injection of BM-derived MSC improved the outcome of spinal cord injury as documented clinically by the BBB scoring system for spinal cord injured rats.</p><p>Our study results coincided with how other researchers stated that BMSC subpopulations, namely mesenchymal-stem cells (MSCs), accelerate motor recovery when grafted intraspinally in mice with moderate SCI [<xref ref-type="bibr" rid="scirp.67646-ref47">47</xref>] . Additionally, peripheral blood monocytes are required for tissue repair after SCI, likely after being primed into an anti-inflammatory phenotype in the choroid plexus. This hypothesis would then confirm recent data showing that BMSCs have beneficial effects in spinal cord injured mice by modulating the recruitment or the activity of alternatively activated macrophages, therefore, enhancing tissue repair and motor behavior [<xref ref-type="bibr" rid="scirp.67646-ref48">48</xref>] .</p><p>A previous study conveyed that BMSCs can migrate into the injured part of spinal cord tissue and replace damaged and lost cells, resulting in improved motor function [<xref ref-type="bibr" rid="scirp.67646-ref49">49</xref>] . Another study reported that BMSCs can promote axonal regeneration throughout SCI lesions and improve functional recovery by restoring circuitry motor control [<xref ref-type="bibr" rid="scirp.67646-ref50">50</xref>] . Our results indicate that the immunoreactivity of MBP was stronger in the intralesional GIV compared to the intravenous GIII and GII. These data suggest that BMSCs may provide a supportive matrix for intraspinal axonal growth, which is essential for functional recovery from SCI [<xref ref-type="bibr" rid="scirp.67646-ref51">51</xref>] [<xref ref-type="bibr" rid="scirp.67646-ref52">52</xref>] .</p><p>Further supporting of this finding was the BBB score elevation in GIV compared to that of GIII and GII. It indicated that the presence of BMSCs in the site of the lesion can increase BBB scores and improve functional recovery after SCI [<xref ref-type="bibr" rid="scirp.67646-ref53">53</xref>] .</p><p>Transplantation of BMSCs has shown great promise in the treatment of SCI [<xref ref-type="bibr" rid="scirp.67646-ref52">52</xref>] . The identification of an optimal method of cell transplantation is essential for the successful treatment of SCI. Local injection [<xref ref-type="bibr" rid="scirp.67646-ref53">53</xref>] or intravenous injection [<xref ref-type="bibr" rid="scirp.67646-ref54">54</xref>] [<xref ref-type="bibr" rid="scirp.67646-ref55">55</xref>] are currently the most common methods of cell transplantation in animal models of SCI. Although direct injection can deliver a large number of BMSCs into the spinal cord tissue, the entry of the needle itself causes further injury. Intravenous injection and lumbar puncture methods are far less invasive, but have a low efficiency, as few transplanted cells ultimately migrate to the SCI lesion [<xref ref-type="bibr" rid="scirp.67646-ref56">56</xref>] . Therefore, increasing the number of cells delivered to the lesion after transplantation is the key to improving functional recovery after SCI [<xref ref-type="bibr" rid="scirp.67646-ref57">57</xref>] . In this study the injected MSCs may create an auspicious environment for functional recovery through modulating the post-SCI inflammatory response and by having neurotrophic activity [<xref ref-type="bibr" rid="scirp.67646-ref58">58</xref>] [<xref ref-type="bibr" rid="scirp.67646-ref59">59</xref>] .</p><p>BM-MSC transplantation on the animal SCI models have been evidently confirmed by a large number of studies which employedseveral strategies including: pre-neural replacement, neural differentiation, neurotrophic gene transduction, glial cell co-transplantation, and tissue engineering [<xref ref-type="bibr" rid="scirp.67646-ref60">60</xref>]</p><p>The above mentioned results were interpreted by the observed movement in the treated rats hind limbs at the end of the experimental duration. Our surveillance was similar to how Song et al. [<xref ref-type="bibr" rid="scirp.67646-ref61">61</xref>] have demonstrated improvement of hind limbs’ motor function after allograft of bone MSCs in rats with acute injury to their spinal nerve.</p><p>Yin et al. [<xref ref-type="bibr" rid="scirp.67646-ref62">62</xref>] have reported the antiapoptotic effect of MSC transplantation in adult rats after spinal cord ischemia-reperfusion injury. This suggests that MSCs may affect cell regeneration and repair, through control of apoptosis following SCI [<xref ref-type="bibr" rid="scirp.67646-ref63">63</xref>] .</p><p>Gelatin sponge scaffold used has also been reported to support rat BM-MSC adherence, survival, and proliferation in the rat SCI model. The seeded scaffolds were shown to decrease inflammation, promote angiogenesis, and reduce cavity formation [<xref ref-type="bibr" rid="scirp.67646-ref64">64</xref>] [<xref ref-type="bibr" rid="scirp.67646-ref65">65</xref>] .</p></sec><sec id="s8"><title>8. Conclusions</title><p>BM-MSCs transplantation has a promising role in functional restoration of the spinal cord in rats after chronic spinal cord injury especially with the intralesional route of injection.</p><p>Sources of MSCs other than BM have also been known by researchers, such as adipose tissue amniotic fluid, placenta, umbilical cord blood, and in several fetal tissues including liver, lung, and spleen. These sources could be established in SCI</p><p>Also combination of anti-matrix metalloprotenases with stem cells will improve the result of MSC transplantation.</p></sec><sec id="s9"><title>Cite this paper</title><p>Moataz A. Elawady,Mohammed M. Elmaghrabi,Nesrine Ebrahim,Mona A. Elawady,Dina Sabry,Ashraf Shamaa,Alyaa Ragaei, (2016) Therapeutic Potential of Bone Marrow Derived Mesenchymal Stem Cells in Modulating Astroglyosis of Surgical Induced Experimental Spinal Cord Injury. Advances in Bioscience and Biotechnology,07,251-265. doi: 10.4236/abb.2016.76024</p></sec><sec id="s10"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.67646-ref1"><label>1</label><mixed-citation publication-type="book" xlink:type="simple">Liverman, C.T., Altevogt, B.M., Joy, J.E., Eds. (2005) Spinal Cord Injury: Progress, Promise and Priorities. National Academies Press, Washington DC.</mixed-citation></ref><ref id="scirp.67646-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Priebe, M.M., Chiodo, A.E., Scelza, W.M., Kirshblum, S.C., Wuermser, L.A. and Ho, C.H. (2007) Spinal Cord Injury Medicine 6. Economisc and Societal Issues in Spinal Cord Injury. Archives of Physical Medicine and Rehabilitation, 88, S84-S88. http://dx.doi.org/10.1016/j.apmr.2006.12.005</mixed-citation></ref><ref id="scirp.67646-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Chhabra, H.S. and Arora, M. (2012) Demographic Profile of Traumatic Spinal Cord Injuries Admitted at Indian Spinal Injuries Centre with Special Emphasis on Mode of Injury: A Retrospective Study. Spinal Cord, 50, 745-754. http://dx.doi.org/10.1038/sc.2012.45</mixed-citation></ref><ref id="scirp.67646-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Yip, P.K. and Malaspina, A. (2012) Spinal Cord Trauma and the Molecular Point of No Return. Molecular Neurodegeneration, 7, 6. http://dx.doi.org/10.1186/1750-1326-7-6</mixed-citation></ref><ref id="scirp.67646-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Hausmann, O.N. (2003) Post-Traumatic Inflammation Following Spinal Cord Injury. Spinal Cord, 41, 369-378. http://dx.doi.org/10.1038/sj.sc.3101483</mixed-citation></ref><ref id="scirp.67646-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Schwab, M.E. and Bartholdi, D. (1996) Degeneration and Regeneration of Axons in the Lesioned Spinal Cord. Physiological Reviews, 76, 319-370</mixed-citation></ref><ref id="scirp.67646-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Faulkner, J.R., Herrmann, J.E., Woo, M.J., Tansey, K.E., Doan, N.B. and Sofroniew, M.V. (2004) Reactive Astrocytes Protect Tissue and Preserve Function after Spinal Cord Injury. The Journal of Neuroscience, 24, 2143-2155. http://dx.doi.org/10.1523/JNEUROSCI.3547-03.2004</mixed-citation></ref><ref id="scirp.67646-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Ashcroft, G.S. (1999) Bidirectional Regulation of Macrophage Function by TGF-Beta. Microbes and Infection, 1, 1275-1282. http://dx.doi.org/10.1016/S1286-4579(99)00257-9</mixed-citation></ref><ref id="scirp.67646-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">De Groot, C.J., Montagne, L., Barten, A.D., Sminia, P. and Van Der Valk, P. (1999) Expression of Transforming Growth Factor (TGF)-Beta1, -Beta2, and -Beta3 Isoforms and TGF-Beta Type I and Type II Receptors in Multiple Sclerosis Lesions and Human Adult Astrocyte Cultures. Journal of Neuropathology &amp; Experimental Neurology, 58, 174-187. http://dx.doi.org/10.1097/00005072-199902000-00007</mixed-citation></ref><ref id="scirp.67646-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Lagord, C., Berry, M. and Logan, A. (2002) Expression of TGF-β2 but Not TGF-β1 Correlates with the Deposition of Scar Tissue in the Lesioned Spinal Cord. Molecular and Cellular Neuroscience, 20, 69-82. http://dx.doi.org/10.1006/mcne.2002.1121</mixed-citation></ref><ref id="scirp.67646-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Yong, V.W. (2005) Metalloproteinases: Mediators of Pathology and Regeneration in the CNS. Nature Reviews Neuroscience, 6, 931-944. http://dx.doi.org/10.1038/nrn1807</mixed-citation></ref><ref id="scirp.67646-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Abdel Aziz, M.T., Atta, H.M., Mahfouz, S., Fouad, H.H., Roshdy, N.K., Ahmed, H.H., Rashed, L.A., Sabry, D., Hassouna, A.A. and Hasan, N.M. (2007) Therapeutic Potential of Bone Marrow-Derived Mesenchymal Stem Cells on Experimental Liver Fibrosis. Clinical Biochemistry, 40, 893-899. http://dx.doi.org/10.1016/j.clinbiochem.2007.04.017</mixed-citation></ref><ref id="scirp.67646-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Vu, T.H. and Werb, Z. (1998) Gelatinase B: Structure, Regulation, and Function. Academic Press, San Diego.</mixed-citation></ref><ref id="scirp.67646-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Silver, J. and Miller, J.H. (2004) Regeneration beyond the Glial Scar. Nature Reviews Neuroscience, 5, 146-156. http://dx.doi.org/10.1038/nrn1326</mixed-citation></ref><ref id="scirp.67646-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">McGraw, J., Hiebert, G.W. and Steeves, J.D. (2001) Modulating Astrogliosis after Neurotrauma. Journal of Neuroscience Research, 63, 109-115. http://dx.doi.org/10.1002/1097-4547(20010115)63:2&lt;109::AID-JNR1002&gt;3.0.CO;2-J</mixed-citation></ref><ref id="scirp.67646-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Matyash, M., Matyash, V., Nolte, C., Sorrentino, V. and Kettenmann, H. (2002) Requirement of Functional Ryanodine Receptor Type 3 for Astrocyte Migration. FASEB Journal, 16, 84-86.</mixed-citation></ref><ref id="scirp.67646-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Etienne-Manneville, S. and Hall, A. (2002) Rho GTPases in Cell Biology. Nature, 420, 629-635.http://dx.doi.org/10.1038/nature01148</mixed-citation></ref><ref id="scirp.67646-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Bourguignon, L.Y., Gilad, E., Peyrollier, K., Brightman, A. and Swanson, R.A. (2007) Hyaluronan-CD44 Interaction Stimulates Rac1 Signaling and PKN Gamma Kinase Activation Leading to Cytoskeleton Function and Cell Migration in Astrocytes. Journal of Neurochemistry, 101, 1002-1017. http://dx.doi.org/10.1111/j.1471-4159.2007.04485.x</mixed-citation></ref><ref id="scirp.67646-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Menet, V., Prieto, M., Privat, A., Gimenez, Y. and Ribotta, M. (2003) Axonal Plasticity and Functional Recovery after Spinal Cord Injury in Mice Deficient in Both Glial Fibrillary Acidic Protein and Vimentin Genes. Proceedings of the National Academy of Sciences of the United States of America, 100, 8999-9004. http://dx.doi.org/10.1073/pnas.1533187100</mixed-citation></ref><ref id="scirp.67646-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Okada, S., Nakamura, M., Katoh, H., Miyao, T., Shimazaki, T., Ishii, K., Yamane, J., Yoshimura, A., Iwamoto, Y., Toyama, Y. and Okano, V. (2006) Conditional Ablation of Stat3 or Socs3 Discloses. Nature Medicine, 12, 829-834.http://dx.doi.org/10.1038/nm1425</mixed-citation></ref><ref id="scirp.67646-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Saadoun, S., Papadopoulos, M.C., Watanabe, H., Yan, D., Manley, G.T. and Verkman, A.S. (2005) Involvement of Aquaporin-4 in Astroglial Cell Migration and Glial Scar Formation. Journal of Cell Science, 118, 5691-5698.http://dx.doi.org/10.1242/jcs.02680</mixed-citation></ref><ref id="scirp.67646-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Sternlicht, M.D. and Werb, Z. (2001) How Matrix Metalloproteinases Regulate Cell Behavior. Annual Review of Cell and Developmental Biology, 17, 463-516. http://dx.doi.org/10.1146/annurev.cellbio.17.1.463</mixed-citation></ref><ref id="scirp.67646-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Yong, V.W. (2005) Metalloproteinases: Mediators of Pathology and Regeneration in the CNS. Nature Reviews Neuroscience, 6, 931-944.http://dx.doi.org/10.1038/nrn1807</mixed-citation></ref><ref id="scirp.67646-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Duchossoy, Y., Horvat, J.C. and Stettler, O. (2001) MMP-Related Gelatinase Activity Is Strongly Induced in Scar Tissue of Injured Adult Spinal Cord and Forms Pathways for Ingrowing Neurites. Molecular and Cellular Neuroscience, 17, 945-956. http://dx.doi.org/10.1006/mcne.2001.0986</mixed-citation></ref><ref id="scirp.67646-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Wells, J.E., Rice, T.K., Nuttall, R.K., Edwards, D.R., Zekki, H., Rivest, S. and Yong, V.W. (2003) An Adverse Role for Matrix Metalloproteinase 12 after Spinal Cord Injury in Mice. Journal of Neuroscience, 23, 10107-10115.</mixed-citation></ref><ref id="scirp.67646-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Hsu, J.Y., McKeon, R., Goussev, S., Werb, Z., Lee, J.U., Trivedi, A. and Noble-Haeusslein, L.J. (2006) Matrix Metalloproteinase-2 Facilitates Wound Healing Events That Promote Functional Recovery after Spinal Cord Injury. The Journal of Neuroscience, 26, 9841-9850. http://dx.doi.org/10.1523/JNEUROSCI.1993-06.2006</mixed-citation></ref><ref id="scirp.67646-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Ogier, C., Bernard, A., Chollet, A.M., LED, T., Hanessian, S., Charton, G., Khrestchatisky, M. and Rivera, S. (2006) Matrix Metalloproteinase-2 (MMP-2) Regulates Astrocyte Motility in Connection with the Actin Cytoskeleton and Integrins. Glia, 54, 272-284. http://dx.doi.org/10.1002/glia.20349</mixed-citation></ref><ref id="scirp.67646-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Abdel Aziz, M.T., El-Asmar, M.F., Haidara, M., Atta, H.M., Roshdy, N.K., Rashed, L.A., Sabry, D., Youssef, M.A., Abdel Aziz, A.T. and Moustafa, M. (2008) Effect of Bone Marrow-Derived Mesenchymal Stem Cells on Cardiovascular Complications in Diabetic Rats. Medical Science Monitor, 14, BR249-BR255.</mixed-citation></ref><ref id="scirp.67646-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Erbayraktar, Z., Gokmen, N., Yilmaz, O. and Erbayraktar, S. (2013) Experimental Traumatic Spinal Cord Injury. Methods in Molecular Biology, 982, 103-112.http://dx.doi.org/10.1007/978-1-62703-308-4_6</mixed-citation></ref><ref id="scirp.67646-ref30"><label>30</label><mixed-citation publication-type="book" xlink:type="simple">Gamble, M. (2008) The Hematoxyline and Eosin. In: Bancroft, A.D. and Gamble, M., Eds., Theory &amp; Practice of Histological Techniques, 6th Edition, Chapter 9, Churchill Livingstone of El Sevier, Philadelphia, 121-135.</mixed-citation></ref><ref id="scirp.67646-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Taras, D., Blanc, J.F., Rullier, A., Dugot-Senant, N., Laurendeau, I., Vidaud, M. and Rosenbaum, J. (2007) Pravastatin Reduces Lung Metastasis of Rat Hepatocellular Carcinoma via a Coordinated Decrease of MMP Expression and Activity. Journal of Hepatology, 46, 69-76. http://dx.doi.org/10.1016/j.jhep.2006.06.015</mixed-citation></ref><ref id="scirp.67646-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Basso, D.M., Beattie, M.S. and Bresnahan, J.C. (1995) A Sensitive and Reliable Locomotor Rating Scale for Open Field Testing in Rats. Journal of Neurotrauma, 12, 1-21. http://dx.doi.org/10.1089/neu.1995.12.1</mixed-citation></ref><ref id="scirp.67646-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Branton, M.H. and Kopp, J.B. (1999) TGF-Beta and Fibrosis. Microbes and Infection, 1, 1349-1365.http://dx.doi.org/10.1016/S1286-4579(99)00250-6</mixed-citation></ref><ref id="scirp.67646-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Birkedal-Hansen, H., Moore, W.G., Bodden, M.K., Windsor, L.J., Birkedal-Hansen, B., DeCarlo, A. and Engler, J.A. (1993) Matrix Metalloproteinases: A Review. Critical Reviews in Oral Biology and Medicine, 4, 197-250.</mixed-citation></ref><ref id="scirp.67646-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Rosenberg, G.A., Dencoff, J.E., McGuire, P.G., Liotta, L.A. and Stetler-Stevenson, W.G. (1994) Injury-Induced 92-Kilodalton Gelatinase and Urokinase Expression in Rat Brain. Laboratory Investigation, 71, 417-422.</mixed-citation></ref><ref id="scirp.67646-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Rosenberg, G.A., Estrada, E.Y., Dencoff, J.E. and Stetler-Stevenson, W.G. (1995) Tumor Necrosis Factor-Alpha-Induced Gelatinase B Causes Delayed Opening of the Blood-Brain Barrier: An Expanded Therapeutic Window. Brain Research, 703, 151-155. http://dx.doi.org/10.1016/0006-8993(95)01089-0</mixed-citation></ref><ref id="scirp.67646-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Mun-Bryce, S., Rosenberg, G.A. and Gelatinase, B. (1998) Modulates Selective Opening of the Blood-Brain Barrier during Inflammation. American Journal of Physiology, 274, R1203-R1211.</mixed-citation></ref><ref id="scirp.67646-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Vu, T.H. and Werb, Z. (1998) Gelatinase B: Structure, Regulation, and Function. Academic Press, San Diego.</mixed-citation></ref><ref id="scirp.67646-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Mainardi, C.L., Hibbs, M.S., Hasty, K.A. and Seyer, J.M. (1984) Purification of a Type V Collagen Degrading Metalloproteinase from Rabbit Alveolar Macrophages. Collagen and Related Research, 4, 479-492.http://dx.doi.org/10.1016/S0174-173X(84)80014-X</mixed-citation></ref><ref id="scirp.67646-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Hibbs, M.S., Hoidal, J.R. and Kang, A.H. (1987) Expression of a Metalloproteinase That Degrades Native Type V Collagen and Denatured Collagens by Cultured Human Alveolar Macrophages. Journal of Clinical Investigation, 80, 1644-1650. http://dx.doi.org/10.1172/JCI113253</mixed-citation></ref><ref id="scirp.67646-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Cuzner, M.L., Gveric, D., Strand, C., Loughlin, A.J., Paemen, L., Opdenakker, G. and Newcombe, J. (1996) The Expression of Tissue-Type Plasminogen Activator, Matrix Metalloproteases and Endogenous Inhibitors in the Central Nervous System in Multiple Sclerosis: Comparison of Stages in Lesion Evolution. Journal of Neuropathology and Experimental Neurology, 55, 1194-1204. http://dx.doi.org/10.1097/00005072-199612000-00002</mixed-citation></ref><ref id="scirp.67646-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Takenaga, K. and Kozlova, E.N. (2006) Role of Intracellular S100A4 for Migration of Rat Astrocytes. Glia, 53, 313-321. http://dx.doi.org/10.1002/glia.20284</mixed-citation></ref><ref id="scirp.67646-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Rhodes, K.E., Moon, L.D. and Fawcett, J.W. (2003) Inhibiting Cell Proliferation during Formation of the Glial Scar: Effects on Axon Regeneration in the CNS. Neuroscience, 120, 41-56.http://dx.doi.org/10.1016/S0306-4522(03)00285-9</mixed-citation></ref><ref id="scirp.67646-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Hampton, D.W., Rhodes, K.E., Zhao, C., Franklin, R.J. and Fawcett, J.W. (2004) The Responses of Oligodendrocyte Precursor Cells, Astrocytes and Microglia to a Cortical Stab Injury, in the Brain. Neuroscience, 127, 813-820.http://dx.doi.org/10.1016/j.neuroscience.2004.05.028</mixed-citation></ref><ref id="scirp.67646-ref45"><label>45</label><mixed-citation publication-type="other" xlink:type="simple">Johansson, C.B., Momma, S., Clarke, D.L., Risling, M., Lendahl, U. and Frisen, J. (1999) Identification of a Neural Stem Cell in the Adult Mammalian Central Nervous System. Cell, 96, 25-34. http://dx.doi.org/10.1016/s0092-8674(00)80956-3</mixed-citation></ref><ref id="scirp.67646-ref46"><label>46</label><mixed-citation publication-type="other" xlink:type="simple">Lepekhin, E.A., Eliasson, C., Berthold, C.H., Berezin, V., Bock, E. and Pekny, M. (2001) Intermediate Filaments Regulate Astrocyte Motility. Journal of Neurochemistry, 79, 617-625. http://dx.doi.org/10.1046/j.1471-4159.2001.00595.x</mixed-citation></ref><ref id="scirp.67646-ref47"><label>47</label><mixed-citation publication-type="other" xlink:type="simple">Amberger, V.R., Avellana-Adalid, V., Hensel, T., Baron-van Evercooren, A. and Schwab, M.E. (1997) Oligodendrocyte-Type 2 Astrocyte Progenitors Use a Metalloendoprotease to Spread and Migrate on CNS Myelin. European Journal of Neuroscience, 9, 151-162. http://dx.doi.org/10.1111/j.1460-9568.1997.tb01363.x</mixed-citation></ref><ref id="scirp.67646-ref48"><label>48</label><mixed-citation publication-type="other" xlink:type="simple">Neirinckx, V., Agirman, G., Coste, C., Marquet, A., Dion, V., Rogister, B., Franzen, R. and Wislet, S. (2015) Adult Bone Marrow Mesenchymal and Neural Crest Stem Cells Are Chemoattractive and Accelerate Motor Recovery in a Mouse Model of Spinal Cord Injury. Stem Cell Research &amp; Therapy, 6, 211.http://dx.doi.org/10.1186/s13287-015-0202-2</mixed-citation></ref><ref id="scirp.67646-ref49"><label>49</label><mixed-citation publication-type="other" xlink:type="simple">Syková, E., Jendelová, P., Urdzíková, L., Lesny, P. and Hejcl, A. (2006) Bone Marrow Stem Cells and Polymer Hydrogels—Two Strategies for Spinal Cord Injury Repair. Cellular and Molecular Neurobiology, 26, 1111-1127.http://dx.doi.org/10.1007/s10571-006-9007-2</mixed-citation></ref><ref id="scirp.67646-ref50"><label>50</label><mixed-citation publication-type="other" xlink:type="simple">Ankeny, D.P., McTigue, D.M. and Jakeman, L.B. (2004) Bone Marrow Transplants Provide Tissue Protection and Directional Guidance for Axons after Contusive Spinal Cord Injury in Rats. Experimental Neurology, 190, 17-31.http://dx.doi.org/10.1016/j.expneurol.2004.05.045</mixed-citation></ref><ref id="scirp.67646-ref51"><label>51</label><mixed-citation publication-type="other" xlink:type="simple">Houweling, D.A., Lankhorst, A.J., Gispen, W.H., Bar, P.R. and Joosten, E.A. (1998) Collagen Containing Neurotrophin-3 (NT-3) Attracts Regrowing Injured Corticospinal Axons in the Adult Rat Spinal Cord and Promotes Partial Functional Recovery. Experimental Neurology, 153, 49-59. http://dx.doi.org/10.1006/exnr.1998.6867</mixed-citation></ref><ref id="scirp.67646-ref52"><label>52</label><mixed-citation publication-type="other" xlink:type="simple">Himes, B.T., Neuhuber, B., Coleman, C., Kushner, R., Swanger, S.A., Kopen, G.C., Wagner, J., Shumsky, J.S. and Fischer, I. (2006) Recovery of Function Following Grafting of Human Bone Marrow-Derived Stromal Cells into the Injured Spinal Cord. Neurorehabilitation and Neural Repair, 20, 278-296. http://dx.doi.org/10.1177/1545968306286976</mixed-citation></ref><ref id="scirp.67646-ref53"><label>53</label><mixed-citation publication-type="other" xlink:type="simple">Bakshi, A., Hunter, C., Swanger, S., Lepore, A. and Fischer, I. (2004) Minimally Invasive Delivery of Stem Cells for Spinal Cord Injury: Advantages of the Lumbar Puncture Technique. Journal of Neurosurgery—Spine, 1, 330-337. http://dx.doi.org/10.3171/spi.2004.1.3.0330</mixed-citation></ref><ref id="scirp.67646-ref54"><label>54</label><mixed-citation publication-type="other" xlink:type="simple">Fujiwara, Y., Tanaka, N., Ishida, O., Fujimoto, Y., Murakami, T., Kajihara, H., Yasunaga, Y. and Ochi, M. (2004) Intravenously Injected Neural Progenitor Cells of Transgenic Rats Can Migrate to the Injured Spinal Cord and Differentiate into Neurons, Astrocytes and Oligodendrocytes. Neuroscience Letters, 366, 287-291. http://dx.doi.org/10.1016/j.neulet.2004.05.080</mixed-citation></ref><ref id="scirp.67646-ref55"><label>55</label><mixed-citation publication-type="other" xlink:type="simple">Hu, S.L., Lu, P.G., Zhang, L.J., Li, F., Chen, Z., Wu, N., Meng, H., Lin, J.K. and Feng, H. (2012) In Vivo Magnetic Resonance Imaging Tracking of SPIO-Labeled Human Umbilical Cord Mesenchymal Stem Cells. Journal of Cellular Biochemistry, 113, 1005-1012. http://dx.doi.org/10.1002/jcb.23432</mixed-citation></ref><ref id="scirp.67646-ref56"><label>56</label><mixed-citation publication-type="other" xlink:type="simple">Bakshi, A., Barshinger, A.L., Swanger, S.A., Madhvani, V., Shumsky, J.S., Neuhuber, B. and Fischer, I. (2006) Lumbar Puncture Delivery of Bone Marrow Stromal Cells in Spinal Cord Contusion: A Novel Method for Minimally Invasive Cell Transplantation. Journal of Neurotrauma, 23, 55-65. http://dx.doi.org/10.1089/neu.2006.23.55</mixed-citation></ref><ref id="scirp.67646-ref57"><label>57</label><mixed-citation publication-type="other" xlink:type="simple">Paul, C., Samdani, A.F., Betz, R.R., Fischer, I. and Neuhuber, B. (2009) Grafting of Human Bone Marrow Stromal Cells into Spinal Cord Injury: A Comparison of Delivery Methods. Spine (Phila Pa 1976), 34, 328-334. http://dx.doi.org/10.1097/BRS.0b013e31819403ce</mixed-citation></ref><ref id="scirp.67646-ref58"><label>58</label><mixed-citation publication-type="other" xlink:type="simple">Garbossa, D., Fontanella, M., Ducati, A. and Vercelli, A. (2014) Mesenchymal Stem Cell Transplantation Reduces Glial Cyst and Improves Functional Outcome after Spinal Cord Compression. World Neurosurgery, 81, 183-190. http://dx.doi.org/10.1016/j.wneu.2012.08.014</mixed-citation></ref><ref id="scirp.67646-ref59"><label>59</label><mixed-citation publication-type="other" xlink:type="simple">Gu, W., Zhang, F., Xue, Q., Ma, Z., Lu, P. and Yu, B. (2010) Transplantation of Bone Marrow Mesenchymal Stem Cells Reduces Lesion Volume and Induces Axonal Regrowth of Injured Spinal Cord. Neuropathology, 30, 205-217.http://dx.doi.org/10.1111/j.1440-1789.2009.01063.x</mixed-citation></ref><ref id="scirp.67646-ref60"><label>60</label><mixed-citation publication-type="other" xlink:type="simple">Osaka, M., Honmou, O., Murakami, T., Nonaka, T., Houkin, K., Hamada, H., et al. (2010) Intravenous Administration of Mesenchymal Stem Cells Derived from Bone Marrow after Contusive Spinal Cord Injury Improves Functional Outcome. Brain Research, 1343, 226-235. http://dx.doi.org/10.1016/j.brainres.2010.05.011</mixed-citation></ref><ref id="scirp.67646-ref61"><label>61</label><mixed-citation publication-type="other" xlink:type="simple">Song, Q., Xu, R., Zhang, Q., Ma, M. and Zhao, X. (2014) Therapeutic Effect of Transplanting Bone Mesenchymal Stem Cells on the Hind Limbs’ Motor Function of Rats with Acute Spinal Cord Injury. Int J Clin Exp Med., 7, 262-267.</mixed-citation></ref><ref id="scirp.67646-ref62"><label>62</label><mixed-citation publication-type="other" xlink:type="simple">Yin, F., Guo, L., Meng, C.Y., Liu, Y.J., Lu, R.F., Li, P., et al. (2014) Transplantation of Mesenchymal Stem Cells Exerts Anti-Apoptotic Effects in Adult Rats after Spinal Cord Ischemia-Reperfusion Injury. Brain Research, 1561, 1-10.http://dx.doi.org/10.1016/j.brainres.2014.02.047</mixed-citation></ref><ref id="scirp.67646-ref63"><label>63</label><mixed-citation publication-type="other" xlink:type="simple">Kang, K.N., Kim da, Y., Yoon, S.M., Lee, J.Y., Lee, B.N., Kwon, J.S., et al. (2012) Tissue Engineered Regeneration of Completely Transected Spinal Cord Using Human Mesenchymal Stem Cells. Biomaterials, 33, 4828-4835.http://dx.doi.org/10.1016/j.biomaterials.2012.03.043</mixed-citation></ref><ref id="scirp.67646-ref64"><label>64</label><mixed-citation publication-type="other" xlink:type="simple">Zurita, M., Otero, L., Aguayo, C., Bonilla, C., Ferreira, E., Parajón, A., et al. (2010) Cell Therapy for Spinal Cord Repair: Optimization of Biologic Scaffolds for Survival and Neural Differentiation of Human Bone Marrow Stromal Cells. Cytotherapy, 12, 522-537. http://dx.doi.org/10.3109/14653241003615164</mixed-citation></ref><ref id="scirp.67646-ref65"><label>65</label><mixed-citation publication-type="other" xlink:type="simple">Zeng, X., Zeng, Y.S., Ma, Y.H., Lu, L.Y., Du, B.L., Zhang, W., et al. (2011) Bone Marrow Mesenchymal Stem Cells in a Three-Dimensional Gelatin Sponge Scaffold Attenuate Inflammation, Promote Angiogenesis, and Reduce Cavity Formation in Experimental Spinal Cord Injury. Cell Transplantation, 20, 1881-1899.http://dx.doi.org/10.3727/096368911X566181</mixed-citation></ref></ref-list></back></article>