<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2016.66039</article-id><article-id pub-id-type="publisher-id">AiM-66346</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Incidence of Methicillin-Resistant Staphylococci in Fresh Seafood
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>ekshmi</surname><given-names>R. G. Kumar</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Anas</surname><given-names>K. Kasim</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Manjusha</surname><given-names>Lekshmi</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Binaya</surname><given-names>Bhusan Nayak</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Sanath</surname><given-names>Kumar</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>QC Laboratory, Post Harvest Technology Department, ICAR-Central Institute of Fisheries Education (CIFE), Mumbai, India</addr-line></aff><pub-date pub-type="epub"><day>11</day><month>05</month><year>2016</year></pub-date><volume>06</volume><issue>06</issue><fpage>399</fpage><lpage>406</lpage><history><date date-type="received"><day>6</day>	<month>February</month>	<year>2016</year></date><date date-type="rev-recd"><day>accepted</day>	<month>7</month>	<year>May</year>	</date><date date-type="accepted"><day>11</day>	<month>May</month>	<year>2016</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  The occurrence of methicillin-resistant staphylococci was investigated in fresh seafood, seafood products and related samples. Staphylococci were isolated from 13 (68.42%) fresh seafood samples, while 3 (15.78%) samples harbored coagulase-positive 
  S. aureus.
   Resistance to methicillin was observed in 16 isolates of 
  Staphylococcus
   spp., 15 of which were coagulase-negative 
  S. aureus
   (MR-CoNS) and one was a coagulase-positive 
  S. aureus 
  (MRSA). The 
  mecA
   gene is detected by PCR in 10 MR-CoNS and one MRSA strain. The 
  lmrS 
  gene, which codes for a multidrug efflux pump LmrS, is detected only in coagulase-positive isolates.
 
</p></abstract><kwd-group><kwd>Seafood</kwd><kwd> MRSA</kwd><kwd> CoNS</kwd><kwd> &lt;i&gt;mecA</kwd><kwd> Staphylococcus&lt;/i&gt;</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Staphylococcus aureus, an opportunistic bacterial pathogen commonly associated with asymptomatic colonization of skin and the mucosal surfaces of humans and animals, is one of the leading causes of food-borne illnesses in humans [<xref ref-type="bibr" rid="scirp.66346-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.66346-ref2">2</xref>] . Food poisonings due to S. aureus occur when foods containing one or more preformed staphylococcal enterotoxins (SEs) are ingested. S. aureus is also responsible for many of the nosocomial infections and community acquired diseases [<xref ref-type="bibr" rid="scirp.66346-ref3">3</xref>] . Emergence of S. aureus as a serious pathogen is attributed to its intrinsic virulence and the capacity to adapt to different environmental conditions and also by virtue of its ability to develop or acquire resistance to almost any new antimicrobials [<xref ref-type="bibr" rid="scirp.66346-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.66346-ref5">5</xref>] . The antibiotic resistance of S. aureus has become a major concern following the emergence of MRSA (methicillin-resistant S. aureus) and CA-MRSA (community-acquired MRSA) [<xref ref-type="bibr" rid="scirp.66346-ref6">6</xref>] . In addition to MRSA, methicillin-resistant coagulase-negative staphylococci (MR-CoNS) are increasingly being recognized as causative agents of nosocomial infections [<xref ref-type="bibr" rid="scirp.66346-ref7">7</xref>] . MRSA have been found in farms and food animals [<xref ref-type="bibr" rid="scirp.66346-ref8">8</xref>] , meat [<xref ref-type="bibr" rid="scirp.66346-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.66346-ref10">10</xref>] , milk [<xref ref-type="bibr" rid="scirp.66346-ref11">11</xref>] and poultry [<xref ref-type="bibr" rid="scirp.66346-ref12">12</xref>] . Livestock workers and meat handlers are at particular risk of being colonized by livestock-associated MRSA (LA-MRSA) [<xref ref-type="bibr" rid="scirp.66346-ref13">13</xref>] . Certain lineages of MRSA, such as the type (ST) 398, spa type t108, are capable of human to human transmission or animal to human transmission [<xref ref-type="bibr" rid="scirp.66346-ref14">14</xref>] . Freshly caught seafood is free from S. aureus [<xref ref-type="bibr" rid="scirp.66346-ref15">15</xref>] , hence their presence on fish is a clear indication of secondary contamination during transport and handling [<xref ref-type="bibr" rid="scirp.66346-ref16">16</xref>] . MRSA is introduced into foods by food handlers who are carriers of this bacterium or contamination by other foods which harbor MRSA. Past studies have reported the occurrence of antibiotic-resistant S. aureus in fresh seafood [<xref ref-type="bibr" rid="scirp.66346-ref17">17</xref>] , ready-to-eat fish [<xref ref-type="bibr" rid="scirp.66346-ref18">18</xref>] , seafood products [<xref ref-type="bibr" rid="scirp.66346-ref19">19</xref>] and also in cultured fish [<xref ref-type="bibr" rid="scirp.66346-ref20">20</xref>] . In this study, we sought to determine the prevalence of methicillin-resistant staphylococci in fresh seafood, fish products, seafood processing equipment and the sea salt used in fish fermentation. The results of this study show that MR-CoNS are more dominant than the MRSA in fresh seafood. This is the first report on the incidence of methicillin-resistant staphylococci in fresh seafood in India.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Sampling</title><p>Thirty-five samples were processed for the isolation of Staphylococcus spp. which included seafood samples from retail markets and landing centers in North Mumbai, fish products, salt, seawater and surface swabs. Sterile swabs were used to collect duplicate swab samples from the surfaces of processing equipment such as the silent cutter, mixer, extruder as well as the pre-processing table in the fish processing unit of the institute where this study was conducted. Moistened swabs were rolled multiple times on the surfaces and rinsed in sterile saline followed by spread plating of 0.4, 0.3 and 0.3 ml of suspension on Baird Parker agar.</p></sec><sec id="s2_2"><title>2.2. Isolation and Identification of S. aureus</title><p>Twenty-five grams of the sample (fresh fish or fish products) was aseptically weighed and mixed with 225 mL tryptone water and homogenized for 60 seconds in a stomacher (Seward Stomacher 80, Lab system, London, UK). The homogenate was serially diluted with sterile saline (1:10 dilution). From each dilution, aliquots of 0.4, 0.3 and 0.3 ml each were spread plated on Baird-Parker agar (BPA) supplemented with 3.5% egg yolk-tellurite emulsion [<xref ref-type="bibr" rid="scirp.66346-ref21">21</xref>] . Colonies typical of Staphylococcus spp. picked from BPA plates were Gram stained and identified by biochemical tests, which included catalase test, glucose and mannitol fermentation tests and sensitivity to novobiocin. The coagulase production was determined by coagulase test using rabbit serum (Hi-Media, Mumbai, India).</p></sec><sec id="s2_3"><title>2.3. Antibiotic Resistance Tests</title><p>The methicillin-resistance phenotype of staphylococci was determined by standard disc diffusion method on Mueller-Hinton agar (Hi-Media, Mumbai, India) using oxacillin (1 &#181;g) andcefoxitin (30 &#181;g). The plates were incubated at 35˚C for 24 h. A total of 199 isolates, comprising of 4 coagulase-positive S. aureus and 195 CoNS, were included in the test. The results of antibiotic susceptibility test were interpreted as per guidelines of CLSI for S. aureus and CoNS [<xref ref-type="bibr" rid="scirp.66346-ref22">22</xref>] .</p></sec><sec id="s2_4"><title>2.4. Oligonucleotide Primers and PCR</title><p>Oligonucleotide primers specific for Staphylococcus genus-specific 16S rDNA gene, S. aureus species specific femA gene (encoding a factor responsible for methicillin resistance) and the nucA gene (encoding a thermonuclease), methicillin-resistance gene mecA and the lincomycin efflux gene lmrS were used to in the PCR assays (<xref ref-type="table" rid="table1">Table 1</xref>). DNA of Staphylococcus aureus ATCC BAA-976) was used as the positive control in all PCR reactions. The thermocycling conditions for the amplifications of 16S rDNA, femA, nuc and mecA genes were same as previously described [<xref ref-type="bibr" rid="scirp.66346-ref23">23</xref>] - [<xref ref-type="bibr" rid="scirp.66346-ref25">25</xref>] . For the amplification of lmrS gene using the primers designed in this study, the thermocycling conditions consisted of 1 min denaturation at 94˚C, 1 min annealing at 55˚C and 1 min extension at 72˚C. The products of PCR were electrophoresed on 1.6% agarose gel, stained with ethidium bromide and photographed using a gel documentation system (Bio-Rad, Hercules, USA)</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Oligonucleotide primers used</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer</th><th align="center" valign="middle" >Nucleotide sequence (5’-3’)</th><th align="center" valign="middle" >Product size (bp)</th><th align="center" valign="middle" >Reference</th></tr></thead><tr><td align="center" valign="middle" >16S rDNA</td><td align="center" valign="middle" >gcaagcgttatccggattt cttaatgatggcaactaagc</td><td align="center" valign="middle" >599</td><td align="center" valign="middle" >25</td></tr><tr><td align="center" valign="middle" >femA</td><td align="center" valign="middle" >cgatccatatttaccatatca atcacgctcttcgtttagtt</td><td align="center" valign="middle" >454</td><td align="center" valign="middle" >25</td></tr><tr><td align="center" valign="middle" >nuc</td><td align="center" valign="middle" >gcgattgatggtgatacggtt agccaagccttgacgaactaaagc</td><td align="center" valign="middle" >270</td><td align="center" valign="middle" >23</td></tr><tr><td align="center" valign="middle" >mecA</td><td align="center" valign="middle" >actgctatccaccctcaaac ctggtgaagttgtaatctgg</td><td align="center" valign="middle" >163</td><td align="center" valign="middle" >24</td></tr><tr><td align="center" valign="middle" >lmrS</td><td align="center" valign="middle" >aaatggtactcgccaactcg tggcgtcatgatacctctga</td><td align="center" valign="middle" >241</td><td align="center" valign="middle" >This study</td></tr></tbody></table></table-wrap></sec></sec><sec id="s3"><title>3. Results</title><p>Different sample types analyzed in this study yielded Staphylococcus spp. (<xref ref-type="table" rid="table2">Table 2</xref>). Among seafood samples, staphylococci were isolated from 10 of 14 fish samples and 3 of 5 shellfish samples, for an overall prevalence rate of 68.42%. Of various seafood products, 3 of the 10 products yielded staphylococci. These products included breaded and battered tuna, fish sausage and fish pickle. A total of 199 isolates were confirmed to be Staphylococcus spp. by biochemical tests as well as by the genus-specific 16S rDNA PCR. When different samples were compared, the highest incidence of Staphylococcus spp. was found in fish samples followed by fish products and shellfish (<xref ref-type="table" rid="table2">Table 2</xref>). Of the 4 swab samples collected from the fish processing unit, 3 samples yielded Staphylococcus spp. The coagulase-positive S. aureus were found in 4 samples of which 3 were fish samples and one was a sample of sea salt used in fish fermentation. These isolates were identified by S. aureus-specific PCRs amplifying nucA and femA genes. The coagulase-positive S. aureus were isolated from fresh Tenulosailisha, Coilia dussumieri and dried Harpadon nehereus (Bombay duck).</p><p>Both coagulase-positive S. aureus and coagulase-negative Staphylococcus spp. were tested for methicillin resistance phenotype. The different sample types that yielded methicillin-resistant staphylococci are shown in <xref ref-type="table" rid="table3">Table 3</xref>. Of the 199 isolates of Staphylococcus spp. tested, 16 isolates from 9 samples were resistant to oxacillin/ cefoxitin, of which 1 was a coagulase-positive S. aureus. This particular S. aureus was isolated from the salt. The remaining 3 S. aureus isolates were sensitive to methicillin. The mecA gene, which encodes penicillin- binding protein PBP2a, was detected by PCR in 10 methicillin-resistant coagulase-negative staphylococci (MR- CoNS) and one MRSA isolate. Five MR-CoNS isolates were negative for mecA gene. The lmrS gene was detectable in 4 coagulase-positive S. aureus isolates, one of which was a MRSA. None of the MR-CoNS carried the lmrS gene (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p></sec><sec id="s4"><title>4. Discussion</title><p>Several factors such as poor hygiene and sanitation during seafood handling and transportation, cross-contamin- ation during storage and contamination by workers who are asymptomatic carriers of coagulase-positive S. aureus contribute to the introduction of S. aureus into the seafood. Many studies have shown that S. aureus could be present in fresh seafood, ready-to-cook and ready-to-eat seafood products, seafood processing environments and the hands of seafood handlers [<xref ref-type="bibr" rid="scirp.66346-ref26">26</xref>] - [<xref ref-type="bibr" rid="scirp.66346-ref32">32</xref>] . In our study, a total of 35 random samples were analyzed for the presence of Staphylococcus spp. and the bacterium was isolated from 20 samples. Coagulase-positive S. aureus were found in 4 samples, of which 3 were fresh fish samples and one was a sample of salt used in fish fermentation (<xref ref-type="table" rid="table2">Table 2</xref>). The occurrence of coagulase-positive S. aureus in fresh seafood is 15.78% (3 of 19 samples). Different studies have recorded varying rates of S. aureus isolation from seafood. Normanno et al. [<xref ref-type="bibr" rid="scirp.66346-ref33">33</xref>] reported a low isolation rate of 2.3% from fish products, whereas a higher incidence of 20% was reported in fresh seafood harvested in the southern region of Brazil [<xref ref-type="bibr" rid="scirp.66346-ref27">27</xref>] . A recent study by Zarei et al. [<xref ref-type="bibr" rid="scirp.66346-ref34">34</xref>] detected S. aureus in 5% of the raw/fresh samples of fish and shrimp, 17.5% of the frozen, and 12.3% of the RTE samples marketed in Iran. A relatively high incidence of S. aureus has also been reported from Spain in which S. aureus was found in 43% of fresh fish and 30% of frozen products [<xref ref-type="bibr" rid="scirp.66346-ref28">28</xref>] . A pervious study from India has reported that 17% of the fishery products and 62% of the samples from the factory workers were positive for enterotoxigenic S. aureus [<xref ref-type="bibr" rid="scirp.66346-ref32">32</xref>] . However, this high prevalence rate was found in frozen peeled shrimps and cuttlefish which were subjected</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Occurrence of Staphylococcus spp. in different sample types</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Sample type</th><th align="center" valign="middle" >No. of samples analyzed</th><th align="center" valign="middle" >No. positive for staphylococci</th><th align="center" valign="middle" >No. positive for S. aureus</th></tr></thead><tr><td align="center" valign="middle" >Fish</td><td align="center" valign="middle" >14</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >3</td></tr><tr><td align="center" valign="middle" >Shellfish</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Fishery products</td><td align="center" valign="middle" >10</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Fish processing environment</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Salt</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td></tr><tr><td align="center" valign="middle" >Seawater</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >-</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >35</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >4</td></tr></tbody></table></table-wrap><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Distribution of methicillin-resistant staphylococci in samples analyzed in this study. The methicillin resistance was determined using oxacillin (1 &#181;g) and cefoxitin (30 &#181;g) disks</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Samples</th><th align="center" valign="middle" >No. of isolates tested</th><th align="center" valign="middle" >No. resistant to methicillin</th></tr></thead><tr><td align="center" valign="middle" >Coilia dussumieri</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Tenulosa ilisha</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Epinephelus diacanthus</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Nemipterus japonicus</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Muraenoscox cinereus</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Harpadon nehereus</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Pampus argenteus</td><td align="center" valign="middle" >31</td><td align="center" valign="middle" >5</td></tr><tr><td align="center" valign="middle" >Trichiurus lepturus</td><td align="center" valign="middle" >14</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Tachysaurus dussumieri</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >1</td></tr><tr><td align="center" valign="middle" >Dried Harpadon nehereus (Bombay duck)</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Metapenaeus dobsoni</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >2</td></tr><tr><td align="center" valign="middle" >Meretrix meretrix</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >1</td></tr><tr><td align="center" valign="middle" >Loligo duvacelli</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Fish sausage</td><td align="center" valign="middle" >15</td><td align="center" valign="middle" >1</td></tr><tr><td align="center" valign="middle" >Battered and breaded tuna</td><td align="center" valign="middle" >24</td><td align="center" valign="middle" >3</td></tr><tr><td align="center" valign="middle" >Fermented Indian mackerel (Rastrelliger kanagurta)</td><td align="center" valign="middle" >34</td><td align="center" valign="middle" >1</td></tr><tr><td align="center" valign="middle" >Salt</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1<sup>a</sup></td></tr><tr><td align="center" valign="middle" >Swabs from silent cutter</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >1</td></tr><tr><td align="center" valign="middle" >Swabs from extruder</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Swabs from pre-processing table</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td></tr><tr><td align="center" valign="middle" >Total</td><td align="center" valign="middle" >199</td><td align="center" valign="middle" >16</td></tr></tbody></table></table-wrap><p>to extensive handling at various stages of processing leading to higher levels of contamination.</p><p>In our study, coagulase-positive S. aureus was isolated from a sample of salt used in fish fermentation and preparation of fish products in our institutional facility. S. aureus is a common contaminant of salt since it can tolerate low water activity. When such salt is used in the preparation of salted fish or other fish products, S. aureus is introduced into the products [<xref ref-type="bibr" rid="scirp.66346-ref35">35</xref>] . Isolation of S. arlettae in large numbers from salted cod has been reported and this species was found to be extremely halotolerant, being able to grow from 0.06 M - 4.5 M NaCl [<xref ref-type="bibr" rid="scirp.66346-ref36">36</xref>] . High prevalence of S. aureus has been reported in salted fish, smoked and salted fish, and salted and cold smoked fish [<xref ref-type="bibr" rid="scirp.66346-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.66346-ref37">37</xref>] [<xref ref-type="bibr" rid="scirp.66346-ref38">38</xref>] . S. aureus is a known halotolerant organism, being able to grow at salt concentrations</p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Detection of lmrS gene in seafood isolates of coagulase-positive S. aureus. Lane M, Gene Ruler 1 kb DNA ladder (Fermentas); Lane 1, Positive control S. aureus BAA-976; Lane 2, isolate from salt; Lanes 3 &amp; 4, isolates from fish; Lane 5, negative control</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/1-2270616x7.png"/></fig><p>of 7% - 10%, with some strains being able to withstand a NaCl concentration as high as 20% [<xref ref-type="bibr" rid="scirp.66346-ref39">39</xref>] . In salted sardines, S. aureus was reportedly able to survive for up to 90 days [<xref ref-type="bibr" rid="scirp.66346-ref40">40</xref>] . However, a literature search did not yield any information on the isolation of S. aureus directly from the salt. Nevertheless, the isolation of toxigenic S. aureus from an additive used in the preparation of fish products assumes significance. It is important to ensure that good quality raw materials and additives are used in the preparation of fishery products to prevent the spread of toxigenic S. aureus in general, and methicillin-resistant S. aureus in particular, since the isolate from salt in this study was found to be a MRSA.</p><p>A total of 199 isolates were identified as Staphylococcus spp. by 16S rDNA PCR. Of these, 4 coagulase-posi- tive isolates were confirmed to be S. aureus by thermonuclease gene (nucA)-specific PCR. We also used a previously described PCR method amplifying femA gene to discriminate coagulase-positive S. aureus from CoNS [<xref ref-type="bibr" rid="scirp.66346-ref41">41</xref>] . The product of femA gene is essential for the expression of methicillin resistance in S. aureus and this gene has been reported to be a marker for S. aureus. All coagulase-negative staphylococci (CoNS) of this study were negative for femA.</p><p>Both MRSA and MR-CoNS are recognized worldwide as zoonotic agents capable of causing serious human infections and their presence in foods is a serious human health concern [<xref ref-type="bibr" rid="scirp.66346-ref42">42</xref>] - [<xref ref-type="bibr" rid="scirp.66346-ref44">44</xref>] . The focus of this study was also to understand the prevalence of MRSA and MR-CoNS in seafood. Based on cefoxitin and oxacillin resistance, a total of 16 isolates were found to be resistant to methicillin, of which one was a coagulase-positive S. aureus (<xref ref-type="table" rid="table3">Table 3</xref>). A PCR assay for mecA gene amplified the gene in 11 out of 16 isolates. Five MR-CoNS isolates were negative by mecA PCR. It is possible that the mecA-negative MR-CoNS may have a different mecA gene or a different mechanism of methicillin resistance altogether [<xref ref-type="bibr" rid="scirp.66346-ref45">45</xref>] - [<xref ref-type="bibr" rid="scirp.66346-ref47">47</xref>] . Some MR-CoNS isolated from sashimi were reported to be mecA negative [<xref ref-type="bibr" rid="scirp.66346-ref18">18</xref>] . Further, only 27.9% of the methicillin-resistant staphylococci were found to carry mecA gene by PCR [<xref ref-type="bibr" rid="scirp.66346-ref48">48</xref>] . Nevertheless, the presence of MRSA in seafood and seafood products is increasingly being reported creating health concern. MRSA have been isolated from fresh fish [<xref ref-type="bibr" rid="scirp.66346-ref49">49</xref>] , cage cultured Tilapia [<xref ref-type="bibr" rid="scirp.66346-ref20">20</xref>] and the Japanese retail ready-to-eat raw fish (sashimi) [<xref ref-type="bibr" rid="scirp.66346-ref18">18</xref>] and other fishery products [<xref ref-type="bibr" rid="scirp.66346-ref17">17</xref>] .</p><p>Efflux pumps are employed by bacteria to expel antimicrobial compounds including antibiotics out of the cell and protect themselves from their lethal effects [<xref ref-type="bibr" rid="scirp.66346-ref50">50</xref>] [<xref ref-type="bibr" rid="scirp.66346-ref51">51</xref>] . Such multidrug transporters can contribute significantly to bacterial multiple drug resistance (MDR), thus reducing the efficacy of chemotherapy. The genome of S. aureus contains more than 20 efflux pumps, majority of which are of the Major Facilitator Superfamily (MFS) type. MFS includes highly related secondary active and passive solute transporters, widely recognized as responsible for intrinsic and acquired antibiotic resistance in bacteria. Recently, Floyd et al. [<xref ref-type="bibr" rid="scirp.66346-ref52">52</xref>] described a multidrug efflux pump LmrS in an isolate of MRSA. LmrS can confer high antibiotic resistance to several antibiotics, the most prominent of them being lincomycin, fusidic acid, linezolid and erythromycin. However, not much is known about the distribution of this gene in Staphylococcus spp. We therefore wanted to determine whether lmrS is present in all S. aureus and CoNS and if it could be used as a genetic marker to detect S. aureus by PCR. The primers designed in this study detected lmrS in all 4 isolates of S. aureus, one of which was a MRSA (<xref ref-type="fig" rid="fig1">Figure 1</xref>). None of the CoNS was positive for the lmrS gene. These results are interesting and suggest that lmrS is limited to S. aureus, but is not a marker for methicillin resistance. Further studies are needed to understand if the isolates harboring lmrS are clonal and also if lmrS has any role in the physiology of survival of S. aureus in seafood, biofilm formation and even resistance to biocides used in fish processing plants.</p></sec><sec id="s5"><title>Acknowledgements</title><p>The authors thank Director, CIFE, Mumbai for helpful suggestions.</p></sec><sec id="s6"><title>Cite this paper</title><p>Lekshmi R. G. Kumar,Anas K. Kasim,Manjusha Lekshmi,Binaya Bhusan Nayak,Sanath Kumar, (2016) Incidence of Methicillin-Resistant Staphylococci in Fresh Seafood. Advances in Microbiology,06,399-406. doi: 10.4236/aim.2016.66039</p></sec><sec id="s7"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.66346-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Genigeorgis, C.A. (1989) Present State of Knowledge on Staphylococcal Intoxication. International Journal of Food Microbiology, 9, 327-360. http://dx.doi.org/10.1016/0168-1605(89)90100-1</mixed-citation></ref><ref id="scirp.66346-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, S., Landolo, J. and Stewart, C. (1998) The Enterotoxin D Plasmid of Staphylococcus aureus Encodes a Second Enterotoxin Determinant (sej). FEMS Microbiology Letters, 168, 227-233. http://dx.doi.org/10.1111/j.1574-6968.1998.tb13278.x</mixed-citation></ref><ref id="scirp.66346-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Holden, M.T., Feil, E.J., Lindsay, J.A., Peacock, S.J., Day, N.P.J., Enright, M.C., Foster, T.J., et al. (2004) Complete Genomes of Two Clinical Staphylococcus aureus Strains: Evidence for the Rapid Evolution of Virulence and Drug Resistance. Proceedings of the National Academy of Sciences of the United States of America, 101, 9786-9791. http://dx.doi.org/10.1073/pnas.0402521101</mixed-citation></ref><ref id="scirp.66346-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Lowy, F.D. (1998) Staphylococcus aureus Infections. The New England Journal of Medicine, 339, 520-532. http://dx.doi.org/10.1056/NEJM199808203390806</mixed-citation></ref><ref id="scirp.66346-ref5"><label>5</label><mixed-citation publication-type="book" xlink:type="simple">Waldvogel, F.A. (2000) Staphylococcus aureus (Including Staphylococcal Toxic Shock). In: Mandell, G.L., Bennett, J. E. and Dolin, R., Eds., Principles and Practice of Infectious Diseases, Churchill Livingstone, Philadelphia, 2069-2092.</mixed-citation></ref><ref id="scirp.66346-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Chambers, H.F. (2005) Community-Associated MRSA—Resistance and Virulence Converge. The New England Journal of Medicine, 352, 1485-1487. http://dx.doi.org/10.1056/NEJMe058023</mixed-citation></ref><ref id="scirp.66346-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Farrell, D.J. (1997) The Reliability of MicroscanTM Conventional and Rapid Panels to Identify Staphylococcus aureus and Detect Methicillin Resistance: An Evaluation Using the Tube Coagulase Test and mecA PCR. Pathology, 29, 406-410. http://dx.doi.org/10.1080/00313029700169405</mixed-citation></ref><ref id="scirp.66346-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Lee, J.H. (2003) Methicillin (Oxacillin)-Resistant Staphylococcus aureus Strains Isolated from Major Food Animals and Their Potential Transmission to Humans. Applied and Environmental Microbiology, 69, 6489-6494. http://dx.doi.org/10.1128/AEM.69.11.6489-6494.2003</mixed-citation></ref><ref id="scirp.66346-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Boost, M.V., Wong, A., Ho, J. and O’Donoghue, M. (2013) Isolation of Methicillin-Resistant Staphylococcus aureus (MRSA) from Retail Meats in Hong Kong. Foodborne Pathogens and Disease, 10, 705-710. http://dx.doi.org/10.1089/fpd.2012.1415</mixed-citation></ref><ref id="scirp.66346-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">O’Brien, A.M., Hanson, B.M., Farina, S.A., Wu, J.Y., Simmering, J.E., Wardyn, S.E., Forshey, B.M., Kulick, M.E., Wallinga, D.B. and Smith, T.C. (2012) MRSA in Conventional and Alternative Retail Pork Products. PLoS ONE, 7, e30092. http://dx.doi.org/10.1371/journal.pone.0030092</mixed-citation></ref><ref id="scirp.66346-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Haran, K.P., Godden, S.M., Boxrud, D., Jawahir, S., Bender, J.B. and Sreevatsan, S. (2012) Prevalence and Characterization of Staphylococcus aureus, including Methicillin-Resistant Staphylococcus aureus, Isolated from Bulk Tank Milk from Minnesota Dairy Farms. Journal of Clinical Microbiology, 50, 688-695. http://dx.doi.org/10.1128/JCM.05214-11</mixed-citation></ref><ref id="scirp.66346-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Wendlandt, S., Kadlec, K., FeBler, A.T., Monecke, S., Ehricht, R., van de Giessen, A.W., Hengeveld, P.D., Huijsdens, X., Schwarz, S. and van Duijkeren, E. (2013) Resistance Phenotypes and Genotypes of Methicillin-Resistant Staphylococcus aureus Isolates from Broiler Chickens at Slaughter and Abattoir Workers. Journal of Antimicrobial Chemotherapy, 68, 2458-2463. http://dx.doi.org/10.1093/jac/dkt239</mixed-citation></ref><ref id="scirp.66346-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Kock, R., Schaumburg, F., Mellmann, A., Koksal, M., Jurke, A., Becker, K. and Friedrich, A.W. (2013) Livestock Associated Methicillin-Resistant Staphylococcus aureus (MRSA) as Causes of Human Infection and Colonization in Germany. PLoS ONE, 8, e55040. http://dx.doi.org/10.1371/journal.pone.0055040</mixed-citation></ref><ref id="scirp.66346-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Voss, A., Loeffen, F., Bakker, J., Klaassen, C. and Wulf, M. (2005) Methicillin-Resistant Staphylococcus aureus in Pig Farming. Emerging Infectious Diseases, 11, 1965-1966. http://dx.doi.org/10.3201/eid1112.050428</mixed-citation></ref><ref id="scirp.66346-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Huss, H.H. (1988) Fresh Fish Quality and Quality Changes. FAO Fisheries Series, No. 29, FAO, Rome.</mixed-citation></ref><ref id="scirp.66346-ref16"><label>16</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Bryan</surname><given-names> F.L. </given-names></name>,<etal>et al</etal>. (<year>1980</year>)<article-title>Foodborne Diseases in the United States Associated with Meat and Poultry</article-title><source> Journal of Food Protection</source><volume> 43</volume>,<fpage> 140</fpage>-<lpage>150</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.66346-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Beleneva, I.A. (2011) Incidence and Characteristics of Staphylococcus aureus and Listeria monocytogenes from the Japan and South China Seas. Marine Pollution Bulletin, 62, 382-387. http://dx.doi.org/10.1016/j.marpolbul.2010.09.024</mixed-citation></ref><ref id="scirp.66346-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Hammad, A.M., Watanbe, W., Fujii, T. and Shimamoto, T. (2012) Occurrence and Characteristics of Methicillin Resistant and -Susceptible Staphylococcus aureus and Methicillin-Resistant Coagulase-Negative Staphylococci from Japanese Retail Ready-to-Eat Raw Fish. International Journal of Food Microbiology, 156, 286-289. http://dx.doi.org/10.1016/j.ijfoodmicro.2012.03.022</mixed-citation></ref><ref id="scirp.66346-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Vázquez-Sánchez, D., López-Cabo, M., Saá-Ibusquiza, P. and Rodríguez-Herrera, J.J. (2012) Incidence and Characterization of Staphylococcus aureus in Fishery Products Marketed in Galicia Northwest Spain. International Journal of Food Microbiology, 157, 286-296. http://dx.doi.org/10.1016/j.ijfoodmicro.2012.05.021</mixed-citation></ref><ref id="scirp.66346-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Atyah, M.A., Zamri-Saad, M. and Siti-Zahrah, A. (2010) First Report of Methicillin-Resistant Staphylococcus aureus from Cage-Cultured Tilapia (Oreochromis niloticus). Veterinary Microbiology, 144, 502-504. http://dx.doi.org/10.1016/j.vetmic.2010.02.004</mixed-citation></ref><ref id="scirp.66346-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">FDA (Food and Drug Administration) (2004) Bacteriological Analytical Manual on Line. 8th Edition, Revision A, 1998 (Online). AOAC International, Arlington.</mixed-citation></ref><ref id="scirp.66346-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">CLSI (2008) Performance Standards for Antimicrobial Susceptibility Testing. 15th Informational Supplement, M100-S15, Clinical and Laboratory Standards Institute, Wayne.</mixed-citation></ref><ref id="scirp.66346-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Brakstad, O.G., Aasbakk, K. and Macland, J.A. (1992) Detection of Staphylococcus aureus by Polymerase Chain Reaction Amplification of nuc Gene. Journal of Clinical Microbiology, 30, 1654-1660.</mixed-citation></ref><ref id="scirp.66346-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Oliveira, D.C. and de Lencastre, H. (2002) Multiplex PCR Strategy for Rapid Identification of Structural Types and Variants of the mec Element in Methicillin-Resistant Staphylococcus aureus. Antimicrobial Agents and Chemotherapy, 46, 2155-2161. http://dx.doi.org/10.1128/AAC.46.7.2155-2161.2002</mixed-citation></ref><ref id="scirp.66346-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Xu, B., Liu, L. Liu, L., Li, X.P., Li, X.F. and Wang, X. (2012) A Multiplex PCR Assay for the Rapid and Sensitive Detection of Methicillin-Resistant Staphylococcus aureus and Simultaneous Discrimination of Staphylococcus aureus from Coagulase-Negative Staphylococci. Journal of Food Science, 77, 638-642. http://dx.doi.org/10.1111/j.1750-3841.2012.02959.x</mixed-citation></ref><ref id="scirp.66346-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Abrahim, A., Sergelidis, D., Kirkoudis, I., Anagnostou, V., Kaitsa-Tsiopoulou, E., Kazila, P. and Papa, A. (2010) Isolation and Antimicrobial Resistance of Staphylococcus spp. in Freshwater Fish and Greek Marketplaces. Journal of Aquatic Food Product Technology, 19, 93-102. http://dx.doi.org/10.1080/10498850.2010.491597</mixed-citation></ref><ref id="scirp.66346-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Ayulo, A.M.R., Machado, R.A. and Scussel, V.M. (1994) Enterotoxigenic Escherichia coli and Staphylococcus aureus in Fish and Seafood from the Southern Region of Brazil. International Journal of Food Microbiology, 24, 171-178. http://dx.doi.org/10.1016/0168-1605(94)90116-3</mixed-citation></ref><ref id="scirp.66346-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Herrera, F.C., Santos, J.A., Otero, A. and García-López, M.-L. (2006) Occurrence of Foodborne Pathogenic Bacteria in Retail Prepackaged portions of Marine Fish in Spain. Journal of Applied Microbiology, 100, 527-536. http://dx.doi.org/10.1111/j.1365-2672.2005.02848.x</mixed-citation></ref><ref id="scirp.66346-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Oh, S.K., Lee, N., Cho, Y.S., Shin, D.B., Choi, S.Y. and Koo, M. (2007) Occurrence of Toxigenic Staphylococcus aureus in Ready-to-Eat Food in Korea. Journal of Food Protection, 70, 1153-1158</mixed-citation></ref><ref id="scirp.66346-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Rodma, P., Satjapala, T. and Suwanvitaya, P. (1991) Staphylococcus aureus Occurrence in Frozen Foods. Food, 21, 197-204.</mixed-citation></ref><ref id="scirp.66346-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Sokari, T. (1991) Distribution of Enterotoxigenic Staphylococcus aureus in Ready-to-Eat Foods in Eastern Nigeria. International Journal of Food Microbiology, 12, 275-279. http://dx.doi.org/10.1016/0168-1605(91)90079-5</mixed-citation></ref><ref id="scirp.66346-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Simon, S.S. and Sanjeev, S. (2007) Prevalence of Enterotoxigenic Staphylococcus aureus in Fishery Products and Fish Processing Factory Workers. Food Control, 18, 1565-1568. http://dx.doi.org/10.1016/j.foodcont.2006.12.007</mixed-citation></ref><ref id="scirp.66346-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Normanno, G., Firinu, A., Virgilio, S., Mula, G., Dambrosio, A., Poggiu, A., Decastelli, L., Mioni, R., Sucuota, S., Bolzoni, G., Di Giannatale, E., Salinetti, A.P., La Salandra, G., Bartoli, M., Zuccon, F., Pirino, T., Sias, S., Parisi, A., Quaglia, N.C. and Celano, G.V. (2005) Coagulase-Positive Staphylococci and Staphylococcus aureus in Foods Products Marketed in Italy. International Journal of Food Microbiology, 98, 73-79. http://dx.doi.org/10.1016/j.ijfoodmicro.2004.05.008</mixed-citation></ref><ref id="scirp.66346-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Zarei, M., Maktabi, S. and Ghorbanpour, M. (2012) Prevalence of Listeria monocytogenes, Vibrio parahaemolyticus, Staphylococcus aureus, and Salmonella spp. in Seafood Products Using Multiplex Polymerase Chain Reaction. Foodborne Pathogens and Disease, 9, 108-112. http://dx.doi.org/10.1089/fpd.2011.0989</mixed-citation></ref><ref id="scirp.66346-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Hansen, L., Gill, T., Truelstrup, T. and Hussa, H.H. (1995) Effects of Salt and Storage Temperature on Chemical, Microbiological and Sensory Changes in Cold-Smoked Salmon. Food Research International, 28, 123-130. http://dx.doi.org/10.1016/0963-9969(95)90795-C</mixed-citation></ref><ref id="scirp.66346-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Vilhelmsson, O., Hafsteinsson, H. and Kristjansson, J.K. (1997) Extremely Halotolerant Bacteria Characteristic of Fully Cured and Dried Cod. International Journal of Food Microbiology, 36, 163-170. http://dx.doi.org/10.1016/S0168-1605(97)01256-7</mixed-citation></ref><ref id="scirp.66346-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Siriken, B., Yildirim, T., Erol, I., Durupinar, B., Ciftci, A. and Onuk, E.E. (2013) Prevalence and Characterization of Coagulase Positive Staphylococci Isolated from Salted Anchovy. Journal of Aquatic Food Product Technology, 22, 339-352. http://dx.doi.org/10.1080/10498850.2011.651773</mixed-citation></ref><ref id="scirp.66346-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Basti, A.A., Misaghi, A., Salehi, T.Z. and Kamkar, A. (2006) Bacterial Pathogens in Fresh, Smoked and Salted Iranian Fish. Food Control, 17, 183-188. http://dx.doi.org/10.1016/j.foodcont.2004.10.001</mixed-citation></ref><ref id="scirp.66346-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Jay, J.M., Loessner, M.J. and Golden, D.A. (2005) Modern Food Microbiology. 7th Edition, Springer, New York.</mixed-citation></ref><ref id="scirp.66346-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Arkoudelos, J.S., Samaras, F.J. and Tassou, C.C. (2003) Survival of Staphylococcus aureus and Salmonella enteritidis on Salted Sardines (Sardinapilchardus) during Ripening. Journal of Food Protection, 66, 1479-1481</mixed-citation></ref><ref id="scirp.66346-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Vannuffel, P., Gigi, J., Ezzedine, H., Vandercam, B., Delmee, M., Wauters, G. and Gala, J.L. (1995) Specific Detection of Methicillin-Resistant Staphylococcus Species by Multiplex PCR. Journal of Clinical Microbiology, 33, 2864-2867.</mixed-citation></ref><ref id="scirp.66346-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Barbier, F., Ruppé, E., Hernandez, D., Lebeaux, D., Francois, P., Felix, B., Desprez, A., Maiga, A., Woerther, P.L., Gaillard, K., Jeanrot, C., Wolff, M., Schrenzel, J., Andremont, A. and Ruimy, R. (2010) Methicillin-Resistant Coagulase-Negative Staphylococci in the Community: High Homology of SCCmecIVa between Staphylococcus epidermidis and Major Clones of Methicillin-Resistant Staphylococcus aureus. The Journal of Infectious Diseases, 202, 270-281. http://dx.doi.org/10.1086/653483</mixed-citation></ref><ref id="scirp.66346-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Karchmer, A.W. (2000) Nosocomial Bloodstream Infections: Organisms, Risk Factors, and Implications. Clinical Infectious Diseases, 31, S139-S143. http://dx.doi.org/10.1086/314078</mixed-citation></ref><ref id="scirp.66346-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Morgan, M. (2008) Methicillin-Resistant Staphylococcus aureus and Animals: Zoonosis or Humanosis? Journal of Antimicrobial Chemotherapy, 62, 1181-1187. http://dx.doi.org/10.1093/jac/dkn405</mixed-citation></ref><ref id="scirp.66346-ref45"><label>45</label><mixed-citation publication-type="other" xlink:type="simple">García-álvarez, L., Holden, M.T., Lindsay, H., Webb, C.R., Brown, D.F., Curran, M.D., Walpole, E., Brooks, K., Pickard, D.J., Teale, C., Parkhill, J., Bentley, S.D., Edwards, G.F., Girvan, E.K., Kearns, A.M., Pichon, B., Hill, R.L., Larsen, A.R., Skov, R.L., Peacock, S.J., Maskell, D.J. and Holmes, M.A. (2011) Methicillin-Resistant Staphylococcus aureus with a Novel mecA Homologue in Human and Bovine Populations in the UK and Denmark: A Descriptive Study. The Lancet Infectious Diseases, 11, 595-603. http://dx.doi.org/10.1016/S1473-3099(11)70126-8</mixed-citation></ref><ref id="scirp.66346-ref46"><label>46</label><mixed-citation publication-type="other" xlink:type="simple">Suzuki, E., Hiramatsu, K. and Yokota, T. (1992) Survey of Methicillin-Resistant Clinical Strains of Coagulase Negative Staphylococci for mecA Gene Distribution. Antimicrobial Agents and Chemotherapy, 36, 429-434. http://dx.doi.org/10.1128/AAC.36.2.429</mixed-citation></ref><ref id="scirp.66346-ref47"><label>47</label><mixed-citation publication-type="other" xlink:type="simple">Banerjee, R., Gretes, M., Harlem, C., Basuino, L. and Chambers, H.F. (2010) AmecA-Negative Strain of Methicillin-Resistant Staphylococcus aureus with High-Level β-Lactam Resistance Contains Mutations in Three Genes. Antimicrobial Agents and Chemotherapy, 54, 4900-4902. http://dx.doi.org/10.1128/AAC.00594-10</mixed-citation></ref><ref id="scirp.66346-ref48"><label>48</label><mixed-citation publication-type="other" xlink:type="simple">Duran, N., Ozer, B., Duran, G.G., Onlen, Y. and Demir, C. (2012) Antibiotic Resistance Genes and Susceptibility Patterns in Staphylococci. Indian Journal of Medical Research, 135, 389-396</mixed-citation></ref><ref id="scirp.66346-ref49"><label>49</label><mixed-citation publication-type="other" xlink:type="simple">Rhee, C.H. and Woo, G.J. (2010) Emergence and Characterization of Foodborne Methicillin-Resistant Staphylococcus aureus in Korea. Journal of Food Protection, 73, 2285-2290.</mixed-citation></ref><ref id="scirp.66346-ref50"><label>50</label><mixed-citation publication-type="other" xlink:type="simple">Kumar, S. and Varela, M.F. (2012) Biochemistry of Bacterial Multidrug Efflux Pumps. International Journal of Molecular Sciences, 13, 4484-4495. http://dx.doi.org/10.3390/ijms13044484</mixed-citation></ref><ref id="scirp.66346-ref51"><label>51</label><mixed-citation publication-type="other" xlink:type="simple">Piddock, L.J. (2006) Multidrug-Resistance Efflux Pumps? Not Just for Resistance. Nature Reviews Microbiology, 4, 629-636. http://dx.doi.org/10.1038/nrmicro1464</mixed-citation></ref><ref id="scirp.66346-ref52"><label>52</label><mixed-citation publication-type="other" xlink:type="simple">Floyd, J.L., Smith, K.P., Floyd, J.T., Kumar, S. and Manuel, F.V. (2010) LmrS Is a Multidrug Efflux Pump of the Major Facilitator Superfamily from Staphylococcus aureus. Antimicrobial Agents and Chemotherapy, 54, 5406-5412. http://dx.doi.org/10.1128/AAC.00580-10</mixed-citation></ref></ref-list></back></article>