<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2016.64026</article-id><article-id pub-id-type="publisher-id">AiM-65443</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Studies on Enterotoxins and Antimicrobial Resistance in &lt;i&gt;Staphylococcus aureus&lt;/i&gt; Isolated from Various Sources
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>nas</surname><given-names>Yasser Mohammed</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Shaymaa</surname><given-names>Hassan Abdel-Rhman</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Rasha</surname><given-names>Barwa</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mohammed</surname><given-names>Adel El-Sokkary</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Microbiology and Immunology Department, Faculty of Pharmacy, Mansoura University, Mansoura, Egypt</addr-line></aff><pub-date pub-type="epub"><day>07</day><month>04</month><year>2016</year></pub-date><volume>06</volume><issue>04</issue><fpage>263</fpage><lpage>275</lpage><history><date date-type="received"><day>29</day>	<month>February</month>	<year>2016</year></date><date date-type="rev-recd"><day>accepted</day>	<month>10</month>	<year>April</year>	</date><date date-type="accepted"><day>13</day>	<month>April</month>	<year>2016</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Staphylococcus aureus represents a public health challenge all over the world. Therefore, this study aims to analyze the prevalence of five genes (
  sea, seb, sec, see and 
  seg) encoding the staphylococcal enterotoxins in 
  S. aureus isolated from different sources and to evaluate the association of these toxins in comparison to susceptibility towards 12 antimicrobials; antimicrobial susceptibility was conducted by disc diffusion method. Detection of staphylococcal enterotoxins was performed by PCR and the ability to express these genes was assessed among isolates by RT-PCR. The most common enterotoxin gene was 
  sea gene (66%), followed by 
  seb, sec, see and 
  seg (38%, 23%, 19% and 5%) respectively. Expression of 
  sea, seb and 
  seg genes was variable. However, sec and see genes were not expressed by any of the tested isolates. No statistically significant association exists between (
  seb, sec and 
  see) and isolation sources, while the sea was significantly associated with clinical isolates. High significant correlation was found between elevated sea expression and multidrug-resistance. Our findings indicate that the pathogenic potential of 
  S. aureus may be greater than previously thought. This emphasizes the utmost need to implement proactive measures and more emphasis will be placed on the application of hygiene practices in hospitals to control 
  S. aureus infection and enterotoxins production.
 
</p></abstract><kwd-group><kwd>&lt;i&gt;S. aureus&lt;/i&gt;</kwd><kwd> Antimicrobial Susceptibility</kwd><kwd> Enterotoxins</kwd><kwd> Expression</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Staphylococcus aureus (S. aureus) is a major pathogen of increasing importance due to the rise in antibiotic resistance [<xref ref-type="bibr" rid="scirp.65443-ref1">1</xref>] . It is often found as a commensal associated with skin, skin glands, and mucous membranes, mainly in the nose of healthy individuals [<xref ref-type="bibr" rid="scirp.65443-ref2">2</xref>] . Approximately 20% - 30% of the general populations are S. aureus carriers [<xref ref-type="bibr" rid="scirp.65443-ref3">3</xref>] .</p><p>S. aureus is associated with severe community and hospital acquired diseases and has for a long time been considered as a major problem of public health [<xref ref-type="bibr" rid="scirp.65443-ref4">4</xref>] . Many extracellular proteins and toxins are produced which probably contribute to the virulence of this organism [<xref ref-type="bibr" rid="scirp.65443-ref5">5</xref>] . S. aureus can produce exotoxins including exfoliative toxins, leukocidins, toxic shock syndrome toxin-1 (TSST-1) and staphylococcal enterotoxins (SEs) [<xref ref-type="bibr" rid="scirp.65443-ref6">6</xref>] . The spectrum of staphylococcal diseases ranges from pimples and furuncles to toxic shock syndrome and sepsis, most of which depend on many virulence factors. In contrast, some diseases, such as staphylococcal food poisoning, rely on only one type of virulence factors: the staphylococcal enterotoxins (SEs) [<xref ref-type="bibr" rid="scirp.65443-ref4">4</xref>] .</p><p>Staphylococcal food poisoning (SFP) is a very common, however, a rarely reported, type of food poisoning. Symptoms of SFP include rapid onset (within 1 - 6 h) of nausea, vomiting, diarrhea and abdominal cramps [<xref ref-type="bibr" rid="scirp.65443-ref7">7</xref>] . These symptoms subside within 24 - 48 h but the disease may remain for 7 - 10 days [<xref ref-type="bibr" rid="scirp.65443-ref8">8</xref>] . The staphylococcal enterotoxins (SEs), produced by S. aureus, are known as etiologic agents of food poisoning in man, and as potent immunologic superantigens [<xref ref-type="bibr" rid="scirp.65443-ref9">9</xref>] that stimulate non-specific T cell proliferation [<xref ref-type="bibr" rid="scirp.65443-ref4">4</xref>] . The staphylococcal enterotoxins are emetic toxins belonging to a large family of staphylococcal and streptococcal pyrogenic exotoxins (PT), having common structure, function phylogenetic relationships and sequence homology [<xref ref-type="bibr" rid="scirp.65443-ref10">10</xref>] .</p><p>Nowadays, there are 24 types of staphylococcal enterotoxins including staphylococcal enterotoxins (SEs) with demonstrated emetic activity in a primate model (SEA, SEB, SEC, SED, SEE, SEG, SEH, SEI, SEK, SEL, SEM, SEN, SEO, SEP, SEQ, SER, SES and SET) and staphylococcal-like (SEl) proteins, which are not emetic in a primate model or have yet to be tested (SElJ, SElU, SElU2, SElV, SElX and SElY) [<xref ref-type="bibr" rid="scirp.65443-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref12">12</xref>] , yet, SEA-SEE are the most common enterotoxins implicated in SFP [<xref ref-type="bibr" rid="scirp.65443-ref13">13</xref>] . SEA and SEB were found to be the most common staphylococcal enterotoxins. SEA is the most implicated toxin in staphylococcal food poisoning (SFP). For SEB, it has also been associated with food poisoning and was studied for the potential risk of being used as an inhaled bioweapon. SED is the second most common staphylococcal toxin associated with SFP in the world, and minute amounts of this toxin were found enough to induce illness. SEC was the most predominant enterotoxin detected in S. aureus strains isolated from mastitis milk in sheep, goats, and cattle. SEE has been reported in few cases of food poisoning [<xref ref-type="bibr" rid="scirp.65443-ref14">14</xref>] . SEG is an example of the non-classical enterotoxins which also show emetic properties [<xref ref-type="bibr" rid="scirp.65443-ref15">15</xref>] . The SEs are resistant to inactivation by gastrointestinal proteases such as pepsin and trypsin and these toxins also show thermal stability [<xref ref-type="bibr" rid="scirp.65443-ref10">10</xref>] making their elimination difficult to achieve [<xref ref-type="bibr" rid="scirp.65443-ref6">6</xref>] . Therefore, detection of SEs in foods is necessary for risk management and surveillance in food safety. Many reports have described the development of molecular methods for the detection of most of the SE genes [<xref ref-type="bibr" rid="scirp.65443-ref16">16</xref>] .</p><p>For classical staphylococcal enterotoxin detection, the reversed phase latex agglutination (SET-RPLA) and staphylococcal enterotoxin enzyme immuno-assay (SET-EIA) kits, were used to be employed. However, due to the unavailability of immunoassay kits for detecting new SEs, other methods as polymerase chain reaction (PCR) primers, DNA probes and reverse-transcription (RT)-PCR were used for the detection of these toxin genes and their activity in S. aureus strains [<xref ref-type="bibr" rid="scirp.65443-ref17">17</xref>] .</p><p>This study has been undertaken to detect enterotoxin genes in S. aureus by PCR, assess their distribution among various clinical and environmental sources and measure their expression levels by RT-PCR. Moreover, as the relationship between resistance and virulence is poorly understood, we tried to find any possible correlation between prevalence and expression of enterotoxins on one hand and antimicrobial susceptibility on the other hand.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Study Design</title><p>During the period from June 2013 and January 2014, 250 samples were collected from different hospitals. These isolates were obtained from different clinical and environmental sources. One hundred isolates were identified as S. aureus using standard microbiological techniques according to [<xref ref-type="bibr" rid="scirp.65443-ref18">18</xref>] . The experimental protocol conducted in the study was approved by the Ethical Committee of faculty of Pharmacy, Mansoura University, Egypt, with code (2013-28) in May 2013.</p></sec><sec id="s2_2"><title>2.2. Antimicrobial Susceptibility Testing</title><p>The antimicrobial susceptibility testing was carried out by disk diffusion method using Mueller-Hinton agar plates (oxoid) according to [<xref ref-type="bibr" rid="scirp.65443-ref19">19</xref>] where 12 antimicrobial agents belonging to different classes were selected including: ampicillin-sulbactam (SAM, 10/10 μg), amoxicillin-clavulanic acid (AMC, 20/10 μg), oxacillin (OX, 1 μg), imipenem (IPM, 10 μg), cephalothin (KF, 30 μg), cefoxitin (FOX, 30 μg), ceftazidime (CAZ, 30 μg), cefepime (FEB, 30 μg), amikacin (AK, 30 μg), tobramycin (TOB, 10 μg), erythromycin (E, 15 μg) and ciprofloxacin (CIP, 5 μg).</p><p>Cefoxitin (30 μg) disk was used for detection of methicillin resistant Staphylococcus aureus (MRSA), where strains with Inhibition zone diameter ≤21 were identified as MRSA [<xref ref-type="bibr" rid="scirp.65443-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref20">20</xref>] .</p></sec><sec id="s2_3"><title>2.3. PCR Detection of Staphylococcal Enterotoxins Genes</title><p>PCR amplification of staphylococcal enterotoxins (SE) genes, namely (sea, seb, sec, see and seg) was performed using a single plex PCR reaction (FPROGO2D, Tchne LTD, Oxford Cambridge, UK) and specific primers listed in <xref ref-type="table" rid="table1">Table 1</xref>. Genomic DNA was prepared by picking up one - two colonies grown overnight on nutrient agar medium and resuspended in 100 &#181;l of nuclease free water then heated to 95˚C for 10 mins. The toxin genes were detected and amplified using the following reaction: 12.5 μl DreamTaq Green PCR Master Mix (2X) (Thermo scientific), 3 μl of bacterial DNA, 1 μl of each primer (10 &#181;M), and 7.5 μl nuclease free water (Thermo scientific) for a total of 25 &#181;l per reaction.</p><p>The PCR program started with an initial denaturation of DNA at 95C for 5 mins, followed by 35 cycles of denaturation at 95˚C for 30 s, annealing at temperatures specified for each primer as listed in <xref ref-type="table" rid="table1">Table 1</xref> for 30 s and extension at 72˚C for 1 min. This was followed by a final extension step at 72˚C for 5 mins. The amplified genes were visualized on 2% agarose gel electrophoresis stained with ethidium bromide and compared with a 100 base pair (bp) DNA ladder (Thermo scientific).</p></sec><sec id="s2_4"><title>2.4. RNA Isolation</title><p>RNA was isolated from 20 isolates. We selected isolates that harbored 3 or more of the tested toxin genes as detected by PCR (11 isolates), and isolates shared the same resistance and toxin gene pattern (9 isolates). RNA isolation was done according to [<xref ref-type="bibr" rid="scirp.65443-ref22">22</xref>] using glass beads and TRI reagent (Sigma Aldrich).</p><p>The concentration and the purity of RNA for each isolate were determined spectrophotometrically using 260 and 260/280 nm ratio respectively, using NanoDrop (ND-1000 Spectrophotometer, NanoDrop Technologies, Wilmington, Delaware, USA). The purity of RNA was determined by calculating the ratio of A260/A280. Pure RNA has a ratio of 1.8:2.1.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Specific amplification primer sets of staphylococcal enterotoxin genes and reference gene (nuc)</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene name</th><th align="center" valign="middle" ></th><th align="center" valign="middle" >Sequence</th><th align="center" valign="middle" >Temp.</th><th align="center" valign="middle" >Amplicon Length (bp)</th><th align="center" valign="middle" >Reference</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >sea</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >TGCCGATCAATTTATGGCTAGA</td><td align="center" valign="middle" >62</td><td align="center" valign="middle"  rowspan="2"  >207</td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >R</td><td align="center" valign="middle" >CCGAAGGTTCTGTAGAAGTATGAA</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >seb</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >GGACACTAAGTTAGGGAATTATGA</td><td align="center" valign="middle" >60</td><td align="center" valign="middle"  rowspan="2"  >200</td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >R</td><td align="center" valign="middle" >GCTCAGTTACACCACCATAC</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >sec</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >GGTATGATATGATGCCTGCAC</td><td align="center" valign="middle" >61</td><td align="center" valign="middle"  rowspan="2"  >111</td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >R</td><td align="center" valign="middle" >GGTGGACTTCTATCTTCACACT</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >see</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >GATCTTCAGGCAAGGCATTATT</td><td align="center" valign="middle" >61</td><td align="center" valign="middle"  rowspan="2"  >122</td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >R</td><td align="center" valign="middle" >TAACTTACCGTGGACCCTTC</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >seg</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >TGTATGGTGGTGTAACTGAGCA</td><td align="center" valign="middle" >64</td><td align="center" valign="middle"  rowspan="2"  >272</td><td align="center" valign="middle" >This study</td></tr><tr><td align="center" valign="middle" >R</td><td align="center" valign="middle" >TGGTGCAGGCATCATGTCATA</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >nuc</td><td align="center" valign="middle" >F</td><td align="center" valign="middle" >GCGATTGATGGTGATACGGTI</td><td align="center" valign="middle" >55</td><td align="center" valign="middle"  rowspan="2"  >267</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.65443-ref21">21</xref>]</td></tr><tr><td align="center" valign="middle" >R</td><td align="center" valign="middle" >AGCCAAGCCTTGACGAACTAAAGC</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap><p>F: forward; R: reverse; Temp: annealing temperature; bp: base pair.</p></sec><sec id="s2_5"><title>2.5. Expression of SE Genes</title><p>Isolated RNA was used for preparation of complementary DNA using Quanti-Tect Reverse Transcription kit (QIAGEN, Germany). RT-PCR was done using 5&#215; FIREPol Eva Green, qPCR Mix, plus no ROX dye (Solis Bio-Dyne, Tartu, Estonia) using primers listed in <xref ref-type="table" rid="table1">Table 1</xref>.</p><p>RT-PCR was performed using a Rotor Gene Q thermocycler (QIAGEN, Hilden, Germany) programmed as follows: 95˚C for 15 min, followed by 35 cycles of denaturation at 95˚C for 15 s, annealing at temperatures specified for each primer as listed in <xref ref-type="table" rid="table1">Table 1</xref> for 30 s and extension at 72˚C for 1 min. Expression of the target genes was normalized to the expression of reference gene (nuc) encoding nuclease enzyme. The gene expression level in samples was calculated relative to the housekeeping gene (endogenous reference gene) using a calibrator sample by the comparative (∆∆ct) method [<xref ref-type="bibr" rid="scirp.65443-ref23">23</xref>] . All measurements were performed in triplicate.</p></sec><sec id="s2_6"><title>2.6. Statistical Analysis</title><p>Correlations between data were statistically analyzed using the Graphpad Instat 3. Fisher’s exact test was used to evaluate these correlations where P value &lt; 0.05 was considered statistically significant.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Bacterial Isolates</title><p>A total of 250 samples were collected from different hospitals. One hundred were identified as S. aureus. These isolates were obtained from various sources (93 clinical isolates and 7 environmental isolates).</p><p>Clinical sources included diabetic foot cases (D.F, 19 isolates), wound (W, 19 isolates), blood (Bl, 12 isolates), urine (U, 11 isolates), abscess (A, 9 isolates), burn (B, 10 isolates), sputum (Sp, 8 isolates) and throat swab (T.S, 5 isolates), where environmental (En, 7 isolates) were collected from hospital walls and floors to detect any abnormal increase in level of antimicrobial resistance or toxin prevalence in these hospitals environments.</p></sec><sec id="s3_2"><title>3.2. Antimicrobial Susceptibility Testing</title><p>As determined by disc-diffusion antimicrobial susceptibility testing, all isolates showed resistance to at least one antimicrobial agent. A high resistance percentage was observed for ceftazidime (100%), cefoxitin (88%) and amoxicillin-clavulanic (77%). A moderate activity was noticed for tobramycin, erythromycin, ampicillin-sulbac- tam, cefepime and oxacillin where (32% - 47%) of isolates were resistant. On the other hand a lower resistance was observed for imipenem, ciprofloxacin, cephalothin and amikacin (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p><p>Among isolates, 88 were identified as methicillin resistant Staph. aureus (MRSA) where they showed resistance to cefoxitin. In addition, 33 were considered multidrug-resistant (MDR) (resistant to at least three different antimicrobial classes).</p></sec><sec id="s3_3"><title>3.3. Polymerase Chain Reaction (PCR)</title><p>PCR analysis of the five toxin genes revealed that 88% of isolates harbored one or more of the tested</p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Percentage of resistant isolates to each antimicrobial agent. SAM: ampicillin- sulbactam, AMC: amoxicillin-clavulanic acid, OX: oxacillin, KF: cephalothin, FOX: cefoxitin, CAZ: ceftazidime, FEB: cefepime, IPM: imipenem, AK: amikacin, TOB: tobramycin, E: erythromycin, CIP: ciprofloxacin</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-2270731x7.png"/></fig><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Distribution of enterotoxin gene patterns among isolation sources and resistance categories of S. aureus isolates</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="4"  >Toxin pattern number</th><th align="center" valign="middle"  colspan="5"  >Pattern</th><th align="center" valign="middle"  rowspan="4"  >Percentage of isolates</th><th align="center" valign="middle"  colspan="2"   rowspan="2"  >Resistance category</th><th align="center" valign="middle"  colspan="9"   rowspan="2"  >Distribution among sources</th><th align="center" valign="middle" ></th></tr></thead><tr><td align="center" valign="middle"  rowspan="3"  >sea</td><td align="center" valign="middle"  rowspan="3"  >seb</td><td align="center" valign="middle"  rowspan="3"  >sec</td><td align="center" valign="middle"  rowspan="3"  >see</td><td align="center" valign="middle"  rowspan="3"  >seg</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle"  rowspan="2"  >MDR (n)</td><td align="center" valign="middle"  rowspan="2"  >NMDR (n)</td><td align="center" valign="middle"  colspan="8"  >Clinical</td><td align="center" valign="middle" >Non clinical</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >D.F</td><td align="center" valign="middle" >W</td><td align="center" valign="middle" >Bl</td><td align="center" valign="middle" >U</td><td align="center" valign="middle" >B</td><td align="center" valign="middle" >A</td><td align="center" valign="middle" >Sp</td><td align="center" valign="middle" >T.S</td><td align="center" valign="middle" >En</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T1</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >25%</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >18</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >5</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T2</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >9%</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T3</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >2%</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T4</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >3%</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T5</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >11%</td><td align="center" valign="middle" >7</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T6</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >10%</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >6</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T7</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >9%</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >6</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T8</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >2%</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T9</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >4%</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T10</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >2%</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T11</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >5%</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >4</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T12</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1%</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T13</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >1%</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T14</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1%</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T15</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >2%</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T16</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" >+</td><td align="center" valign="middle" ></td><td align="center" valign="middle" >1%</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >T17</td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" >12%</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >9</td><td align="center" valign="middle" >3</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >0</td><td align="center" valign="middle" >1</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" >2</td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap><p>D.F: Diabetic foot, W: Wound, Bl: Blood, U: Urine, B: Burn, A: Abscess, Sp: Sputum, T.S: Throat swab, En: Environmental, MDR: Multidrug-resistant, NMDR: Non-multidrug-resistant, n: number of isolates.</p><p>staphylococcal enterotoxin genes. The most frequent gene was sea (66% of isolates), followed by seb (38%), sec (23%), see (19%) and seg (5%).</p><p>The tested S. aureus isolates were distributed into 17 different patterns (T1-T17) according to <xref ref-type="table" rid="table2">Table 2</xref>. The most predominant pattern was T1 involving 25 isolates harboring sea gene only. The second most common pattern was T5 representing 11 isolates harboring both sea and seb genes. However, patterns T12, T13, T14 and T16 were the least common, where only one isolate represented each pattern.</p><p>In addition, 39% of isolates harbored only one toxin gene (sea, seb, sec, see), while 49% carried toxin gene combinations (38% harbored 2 genes, 8% harbored 3 genes and only 3% harbored 4 genes.</p><p>Among the 88 MRSA isolates, 76 harbored at least one enterotoxin gene and among them 56 isolates harbored the sea gene, 33 harbored seb gene, 17 harbored sec, 17 harbored see gene and seg gene was harbored by 4 isolates. The most common enterotoxin pattern in the MRSA toxigenic isolates was T1 coding for sea gene only (21 isolates) followed by T5 coding for sea and seb gene combination (11 isolates).</p></sec><sec id="s3_4"><title>3.4. Real-Time PCR Analysis of S. aureus Enterotoxins</title><p>In order to study the relative expression of the tested genes, RNA was isolated from the selected 20 S. aureus isolates. The isolated RNA had an A260/A280 ratio that ranged between 1.766 and 2.12, while the concentation range was (0.352 - 12.95) &#181;g/&#181;l. From each isolate 1 &#181;g of RNA was used in c-DNA synthesis. The standard curve of the housekeeping gene nuc and of all expressed enterotoxins genes showed R<sup>2</sup> values of 0.97 - 0.99. They showed the same melting profile and formation of pure amplicons indicated the specificity of the assay. The relative expression levels of SE were analyzed using the comparative method (2<sup>−ΔΔCt</sup>) method.</p><p>Among the tested twenty isolates, 20 harbored sea gene, 12 harbored seb gene, 12 harbored sec gene, 7 harbored see gene and 3 harbored seg gene as detected by PCR.</p><p>Sea gene expression was observed in all of the 20 isolates by variable degrees (<xref ref-type="fig" rid="fig2">Figure 2</xref>). Regarding seb gene, it was expressed in 11 out of 12 isolates (<xref ref-type="fig" rid="fig3">Figure 3</xref>). In contrast, sec and see genes were not expressed in any of the tested isolates, while the new (non-classical) enterotoxin gene (seg) was expressed in the 3 harboring isolates (<xref ref-type="fig" rid="fig4">Figure 4</xref>).</p><p>It was found that 70% of MDR isolates of the tested isolates expressed sea gene with high degree (P value = 0.0031) (<xref ref-type="fig" rid="fig2">Figure 2</xref>), seb and seg genes were highly expressed in 2 isolates that were non-multidrug-resistant (NMDR) and showed low sea gene expression (<xref ref-type="fig" rid="fig3">Figure 3</xref>, <xref ref-type="fig" rid="fig4">Figure 4</xref>) but no significant association was found.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>S. aureus is a major human pathogen found in hospitals and the community [<xref ref-type="bibr" rid="scirp.65443-ref24">24</xref>] . This bacterium is an opportunistic pathogen that can result in a variety of self-limiting and also life-threatening diseases in humans [<xref ref-type="bibr" rid="scirp.65443-ref25">25</xref>] .</p><p>The clinical importance of S. aureus is attributed to remarkable virulence factors, toxins and enzymes, surface proteins, as well as the rapid development of antimicrobial agents resistance [<xref ref-type="bibr" rid="scirp.65443-ref26">26</xref>] . Among the most associated virulence factors with this bacterium, are the heat-stable staphylococcal enterotoxins (SEs) [<xref ref-type="bibr" rid="scirp.65443-ref27">27</xref>] . These toxins are the causative agents of staphylococcal food poisoning syndrome in man and they may be involved in other types of infections [<xref ref-type="bibr" rid="scirp.65443-ref28">28</xref>] .</p><p>Emergence of antibiotic resistant strains of S. aureus is a major public health problem since the bacteria can be easily spread in the environment. During the last two decades, the rate of infections caused by methicillin-resistant Staphylococcus aureus (MRSA) has been notably increased world-wide [<xref ref-type="bibr" rid="scirp.65443-ref29">29</xref>] . Multidrug-resistant S. aureus have been frequently isolated from different origins, including food, water, human nasal mucosa and clinical cases [<xref ref-type="bibr" rid="scirp.65443-ref30">30</xref>] . Accordingly, it was extremely important in this study to detect the enterotoxigenicity as well as the antimicrobial susceptibility of S. aureus isolates belonging to various sources and try to find correlations between different variables.</p><p>In the present study, 100 S. aureus isolates were investigated for susceptibility against 12 antimicrobial agents belonging to four different classes (<xref ref-type="fig" rid="fig1">Figure 1</xref>). All of the isolates were resistant to ceftazidime. Also, 77% of isolates were resistant to amoxicillin/clavulanic acid. In a study of Manoharan et al. 2008, the percentage of resistance to this combination was 84.38% of isolates. These high levels of resistance may be attributed to misuse of antibiotics [<xref ref-type="bibr" rid="scirp.65443-ref31">31</xref>] .</p><p>Intermediate frequencies of resistance towards oxacillin, cefepime, ampicillin/sulbactam, erythromycin and tobramycin antibiotics (47%, 46%, 44%, 39% and 32% respectively) were recorded. The level of oxacillin resistance (47%) was higher than those reported by Sina et al. 2013 and Tokajian et al. 2011 (32%, 25%) respectively [<xref ref-type="bibr" rid="scirp.65443-ref32">32</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref33">33</xref>] . Perveen et al. 2013 demonstrated that 12% of isolates were resistant to cefepime [<xref ref-type="bibr" rid="scirp.65443-ref34">34</xref>] which come in contrast with our finding. Opere et al. 2013 reported that erythromycin level of resistance was 32%, which was consistent with our results [<xref ref-type="bibr" rid="scirp.65443-ref35">35</xref>] . Resistance towards tobramycin in this study was coherent with Schmitz et al. 1999 who demonstrated that 29% of S. aureus isolates were resistant to tobramycin [<xref ref-type="bibr" rid="scirp.65443-ref36">36</xref>] , while Elazhari et al. 2011 showed that only 1.43% of isolates were resistant [<xref ref-type="bibr" rid="scirp.65443-ref37">37</xref>] .</p><p>For ciprofloxacin, 22% of isolates are resistant antimicrobial agent, Shittu and Lin, 2006 showed a lower level of resistance to ciprofloxacin (&lt;10%) [<xref ref-type="bibr" rid="scirp.65443-ref38">38</xref>] , while Opere et al. 2013 showed higher level of ciprofloxacin resistance (39%) [<xref ref-type="bibr" rid="scirp.65443-ref35">35</xref>] .</p><p>The majority of our isolates were susceptible to amikacin and cephalothin (71%, 76%) respectively. This was also reported by Hauschild et al. 2008, Gade and Qazi, 2014 who demonstrated that 75.6% and 74% of S. aureus isolates were susceptible to amikacin respectively [<xref ref-type="bibr" rid="scirp.65443-ref39">39</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref40">40</xref>] . Since cephalothin is a first generation cephalosporin so, it has good activity against S. aureus infections [<xref ref-type="bibr" rid="scirp.65443-ref41">41</xref>] . Imipenem antibiotic showed the highest activity towards isolates, where 87% of them were susceptible. This result was in accordance with the study of Asadollahi et al. 2014, in which 98% of isolates were susceptible [<xref ref-type="bibr" rid="scirp.65443-ref42">42</xref>] .</p><p>In this study, 88% of isolates were identified as MRSA depending on cefoxitin (30 &#181;g) disk diffusion results [<xref ref-type="bibr" rid="scirp.65443-ref19">19</xref>] . Methicillin resistance was detected in S. aureus using cefoxitin with 100% specificity and sensitivity [<xref ref-type="bibr" rid="scirp.65443-ref43">43</xref>] . Also Alfatemi et al. 2014 demonstrated that cefoxitin had 100% sensitivity and 99% specificity for MRSA detection [<xref ref-type="bibr" rid="scirp.65443-ref20">20</xref>] . Our findings agree with the study of Yaseen et al. 2013, who reported that (88%) of isolates were MRSA [<xref ref-type="bibr" rid="scirp.65443-ref44">44</xref>] . Multidrug-resistance (MDR) was defined as resistance to at least 3 antimicrobial classes [<xref ref-type="bibr" rid="scirp.65443-ref45">45</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref46">46</xref>] . 33% of our isolates were MDR, Seas et al. 2006 demonstrated a lower percentage, where 25% of isolates were MDR [<xref ref-type="bibr" rid="scirp.65443-ref45">45</xref>] .</p><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Relative sea gene expression levels in 20 isolates calculated by the comparative method (∆∆ct) method</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-2270731x8.png"/></fig><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Relative seb gene expression levels in 12 isolates calculated by the comparative method (∆∆ct) method</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-2270731x9.png"/></fig><fig id="fig4"  position="float"><label><xref ref-type="fig" rid="fig4">Figure 4</xref></label><caption><title> The relative seg gene expression levels in 3 isolates calculated by the comparative method (∆∆ct) method</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-2270731x10.png"/></fig><p>The prevalence of five SEs encoding genes was investigated by PCR amplification. 88% of isolates harbored one or more enterotoxin genes. This result was to some extent in accordance with the studies of Elazhari et al. 2011 and Cao et al. 2012 who found toxigenicity levels of (76.4% and 93.5%) respectively [<xref ref-type="bibr" rid="scirp.65443-ref37">37</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref47">47</xref>] , however, Becker et al. 2003 and Naffa et al. 2006, reported a lower level of toxigenicity 43% and 23%, respectively [<xref ref-type="bibr" rid="scirp.65443-ref48">48</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref49">49</xref>] .</p><p>Among 88 SE genes positive isolates, only 16 different toxin patterns were detected (<xref ref-type="table" rid="table2">Table 2</xref>); this can be explained by the horizontal-gene transfer among strains [<xref ref-type="bibr" rid="scirp.65443-ref50">50</xref>] . Since all SE genes are carried on accessory genetic elements, including plasmids, genomic island vSa, S. aureus pathogenicity islands (SaPIs) and prophages, or next to the staphylococcal cassette chromosome (SCC) elements. Most of these are mobile genetic elements, which enable them to spread among S. aureus isolates increasing their ability to cause disease and contribute to the emergence of pathogenic strains [<xref ref-type="bibr" rid="scirp.65443-ref51">51</xref>] .</p><p>The sea gene was the most predominant toxin gene detected in 66% of isolates, this high percentage is in the line with other studies who reported sea gene prevalence rate of 55.1%, 65.22%, 60.6% [<xref ref-type="bibr" rid="scirp.65443-ref52">52</xref>] - [<xref ref-type="bibr" rid="scirp.65443-ref54">54</xref>] . However, a much lower frequency of sea gene was reported by other studies where sea gene prevalence was 25% and 18.86% [<xref ref-type="bibr" rid="scirp.65443-ref33">33</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref55">55</xref>] . The second most prevalent toxin gene detected in this study was seb, where (38%) of isolates harbored this gene, this was in accordance with the study performed by Sina et al. 2013 who reported that 44.3% of isolates were seb gene carriers [<xref ref-type="bibr" rid="scirp.65443-ref32">32</xref>] . It was found that only one isolate (8%) out of twelve isolates from blood carried the seb gene, similarly only 5% of S. aureus isolates collected from blood stream infections harbored this gene [<xref ref-type="bibr" rid="scirp.65443-ref56">56</xref>] .</p><p>Regarding the sec gene, it was detected in 23% of isolates. This was in accordance with the results of Lim et al, 2012 who reported that the prevalence rate of sec gene was 19% [<xref ref-type="bibr" rid="scirp.65443-ref57">57</xref>] . However, higher prevalence rates for sec gene (61.3% and 41.5%) were reported [<xref ref-type="bibr" rid="scirp.65443-ref47">47</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref55">55</xref>] . For see gene, only 19% of isolates harbored it. Likewise, see gene was harbored by 15.09% [<xref ref-type="bibr" rid="scirp.65443-ref55">55</xref>] . However, Asadollahi et al. 2014 reported a higher level of see gene (31%) [<xref ref-type="bibr" rid="scirp.65443-ref42">42</xref>] . In contrast, other studies did not detect see gene in any of the isolates [<xref ref-type="bibr" rid="scirp.65443-ref33">33</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref47">47</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref53">53</xref>] .</p><p>The prevalence of the non-classical (recently described) enterotoxin G encoding gene (seg) was also studied; it was the least prevalent gene in our study, where it was harbored by only 5% of isolates. Among S. aureus isolates collected from pediatric patients in Iran [<xref ref-type="bibr" rid="scirp.65443-ref55">55</xref>] , none of the isolates carried the seg gene. However, a higher level of seg gene was recorded in other studies, where the prevalence rate of this gene was 25% and 32.6% [<xref ref-type="bibr" rid="scirp.65443-ref33">33</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref53">53</xref>] . The coexistence of two or more toxins was observed with a prevalence of 49%, higher combination rates (67.2%, 76.9%, 94.57%) were found in previous studies [<xref ref-type="bibr" rid="scirp.65443-ref47">47</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref53">53</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref58">58</xref>] .</p><p>The tested S. aureus isolates were distributed into 17 different patterns (T1-T17) according to their toxins. Patterns T1:T4 represents only a single gene, patterns (T5:T16) represent two or more toxin genes. Pattern 17 was for isolates devoid from toxin genes. The most common combinations in this study were (sea and seb) represented by pattern T5 (11%), followed by pattern T6 (sea and sec) genes (10%) and pattern T7 (sea and see) (9%). In a study of Kamarehei et al. 2013, 18.8% of isolates combined sea and seb genes [<xref ref-type="bibr" rid="scirp.65443-ref54">54</xref>] . Our data show that the coexistence of three toxin genes was found only in 8 isolates. A lower frequency (3%) was noticed for isolates harboring four toxin genes. However, some of our findings differed from those reported in other countries. In a study carried out in the Bronx, New York up to 12 SE genes were detected per a given S. aureus strain [<xref ref-type="bibr" rid="scirp.65443-ref59">59</xref>] . In our study, we did not observe any isolate harbored more than 4 enterotoxin genes.</p><p>Variations in enterotoxin encoding genes prevalence among studies may be attributed to differences in many factors, including the origin of the isolates (food, clinical or environmental samples), study locations, levels of hygiene restrictions among countries and also assay methods.</p><p>One of the most important finding in our study is that no statistically significant association between prevalence of toxin genes (seb, sec and see) and isolates sources, except for sea gene, which was significantly associated with clinical isolates (P value = 0.0059), where the environmental isolates did not show a remarkable increase in the toxin gene prevalence.</p><p>The relationship between virulence and resistance remains unclear. Some studies suggested a negative correlation between methicillin resistance and virulence, as resistance to antibiotics is associated with loss of pathogenic fitness and decreased virulence potential [<xref ref-type="bibr" rid="scirp.65443-ref60">60</xref>] [<xref ref-type="bibr" rid="scirp.65443-ref61">61</xref>] . Others observed that, in general, there were no differences between MRSA and MSSA in SEs levels [<xref ref-type="bibr" rid="scirp.65443-ref62">62</xref>] . In agreement with the study of Indrawattana et al. 2013 who found that sec gene was more associated with MSSA [<xref ref-type="bibr" rid="scirp.65443-ref53">53</xref>] . Our study confirmed that sec gene was significantly associated with isolates susceptible to cefoxitin (MSSA) (P value = 0.0281). Moreover, sea gene was more prevalent in isolates resistant to imipenem and ciprofloxacin antimicrobials with (P value = 0.0038 and 0.0237), respectively which was in accordance with Pourmand et al. 2009 who found a significant association between sea gene prevalence and resistance to a number of antimicrobial agents including ciprofloxacin [<xref ref-type="bibr" rid="scirp.65443-ref63">63</xref>] .</p><p>It is well known that detection of toxin genes, does not necessarily mean the ability of toxin production [<xref ref-type="bibr" rid="scirp.65443-ref58">58</xref>] , this may be due to mutation in the gene regulatory region [<xref ref-type="bibr" rid="scirp.65443-ref64">64</xref>] , so it was important for us to demonstrate the ability to express the studied enterotoxin genes among selected 20 isolates by real-time PCR technique. Sea gene was expressed in all the tested 20 isolates by variable degrees (<xref ref-type="fig" rid="fig2">Figure 2</xref>). In addition, seb gene was expressed in 11 out of 12 isolates that harbored this gene. However, only two of these eleven isolates showed relatively very high expression levels (<xref ref-type="fig" rid="fig3">Figure 3</xref>). For seg gene, it was expressed in all of the 3 tested isolates with two of them showing very high relative expression levels (<xref ref-type="fig" rid="fig4">Figure 4</xref>). Regarding sec and see genes, they were not expressed in any of the isolates tested by RT-PCR. The same results were obtained by Vasconcelos et al. 2011, where no expression of see gene was observed for any isolate [<xref ref-type="bibr" rid="scirp.65443-ref65">65</xref>] . Also, our finding was in agreement with Zigo et al. 2014, where sec gene was not produced in any of the tested isolates [<xref ref-type="bibr" rid="scirp.65443-ref28">28</xref>] .</p><p>Analysis of toxin pattern distribution among multidrug-resistant and non multidrug-resistant isolates did not allow the determination of a clear correlation between the determined toxin pattern distribution among MDR and NMDR. This is because 64.7% of patterns were shared by both MDR and NMDR. Our results were consistent with Indrawattana et al. 2013 who reported that no data was available in the literature correlating the ability to produce toxins in S. aureus and antibiograms [<xref ref-type="bibr" rid="scirp.65443-ref53">53</xref>] . However, an interesting correlation was found between high sea gene expression and multi-drug resistance (MDR) (P value = 0.0031). In addition, the 2 isolates that showed high seb gene expression as well as high seg gene expression were NMDR strains, but no significant correlation was found.</p></sec><sec id="s5"><title>5. Conclusion</title><p>The present study highlights the high prevalence of enterotoxin genes, especially sea gene. The enterotoxin genes (seb, sec and see) were demonstrated to be strain dependent and not associated with the isolation source. However, sea gene was significantly associated with clinical isolates. Since detection of toxin genes does not necessarily mean the ability of toxin production, our results suggest that measurement of expression level of those toxins at the transcript level is necessary to evaluate the potential of S. aureus to cause severe disease. Although the genetic association between resistance and enterotoxins is poorly understood, evidence in our study indicates that there is a significant correlation between sea gene and both imipenem and ciprofloxacin resistance. Moreover, sec gene was significantly associated with MSSA isolates. An interesting correlation was also found between high sea gene expression and multidrug-resistance. Although isolates collected from hospitals environment did not show the expected antimicrobial resistance and toxin prevalence, more governed health restrictions are still needed to control the spread of S. aureus infections in our hospitals environment. Since these isolates may provide a source of fomite transmission, which may be associated with a high degree of antibiotic resistance and virulence.</p></sec><sec id="s6"><title>Acknowledgements</title><p>All appreciation to Mansoura University hospitals staff members and patients for providing isolates used in the study. Many thanks for workers in Seeds Unit faculty of agriculture, Mansoura University.</p></sec><sec id="s7"><title>Conflict of Interests</title><p>The authors declare that they have no competing interests.</p></sec><sec id="s8"><title>Authors’ Contributions</title><p>Shaymaa H. Abdel-Rhman, Rasha Barwa and Mohammed A. El-Sokkary conceived and designed the experiments; Enas Y. Mohammed performed the experiments; Shaymaa H. Abdel-Rhman, Rasha Barwa and Enas Y. Mohammed analyzed the data; Shaymaa H. Abdel-Rhman, Rasha Barwa and Enas Y. Mohammed contributed reagents/materials/analysis tools; all authors wrote the paper, read and approved the final manuscript.</p></sec><sec id="s9"><title>Authors’ Information</title><p>Microbiology and Immunology Department, Faculty of Pharmacy, Mansoura University, Mansoura 35516, Egypt.</p></sec><sec id="s10"><title>Cite this paper</title><p>Enas Yasser Mohammed,Shaymaa Hassan Abdel-Rhman,Rasha Barwa,Mohammed Adel El-Sokkary, (2016) Studies on Enterotoxins and Antimicrobial Resistance in Staphylococcus aureus Isolated from Various Sources. Advances in Microbiology,06,263-275. doi: 10.4236/aim.2016.64026</p></sec><sec id="s11"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.65443-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Harris, L.G., Foster, S.J. and Richards, R.G. (2002) An Introduction to Staphylococcus aureus, and Techniques for Identifying and Quantifying S. aureus Adhesins in Relation to Adhesion to Biomaterials: Review. European Cells and Materials Journal, 4, 39-60.</mixed-citation></ref><ref id="scirp.65443-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Plata, K., Rosato, A.E. and Wegrzyn, G. (2009) Staphylococcus aureus as an Infectious Agent: Overview of Biochemistry and Molecular Genetics of Its Pathogenicity. Acta Biochimica Polonica, 56, 597-612.</mixed-citation></ref><ref id="scirp.65443-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Heyman, D.L. (2004) Control of Communocable Diseases Manual. American Public Health Association, Washington DC.</mixed-citation></ref><ref id="scirp.65443-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Ortega, E., Abriouel, H., Lucas, R. and Galvez, A. (2010) Multiple Roles of Staphylococcus aureus Enterotoxins: Pathogenicity, Superantigenic Activity, and Correlation to Antibiotic Resistance. Toxins (Basel), 2, 2117-2131.http://dx.doi.org/10.3390/toxins2082117</mixed-citation></ref><ref id="scirp.65443-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">El-Jakee, J., Nagwa, A.S., Bakry, M., Zouelfakar, S.A., Elgabry, E. and El-Said, W.G. (2008) Characteristics of Staphylococcus aureus Strains Isolated from Human and Animal Sources. American-Eurasian Journal of Agricultural &amp; Environmental Sciences, 4, 221-229.</mixed-citation></ref><ref id="scirp.65443-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Jackranukul, C., Panvisavas, N. and Chaturongakul, S. (2013) Detection of Staphylococcus aureus Enterotoxin Type I Using qPCR. Chiang Mai Journal of Science, 40, 143-150.</mixed-citation></ref><ref id="scirp.65443-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Jorgensen, H.J., Mork, T., Hogasen, H.R. and Rorvik, L.M. (2005) Enterotoxigenic Staphylococcus aureus in Bulk Milk in Norway. Journal of Applied Microbiology, 99, 158-166. http://dx.doi.org/10.1111/j.1365-2672.2005.02569.x</mixed-citation></ref><ref id="scirp.65443-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Nema, V., Agrawal, R., Kamboj, D.V., Goel, A.K. and Singh, L. (2007) Isolation and Characterization of Heat Resistant Enterotoxigenic Staphylococcus aureus from a Food Poisoning Outbreak in Indian Subcontinent. International Journal of Food Microbiology, 117, 29-35. http://dx.doi.org/10.1016/j.ijfoodmicro.2007.01.015</mixed-citation></ref><ref id="scirp.65443-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Principato, M. and Qian, B.F. (2014) Staphylococcal Enterotoxins in the Etiopathogenesis of Mucosal Autoimmunity within the Gastrointestinal Tract. Toxins (Basel), 6, 1471-1489. http://dx.doi.org/10.3390/toxins6051471</mixed-citation></ref><ref id="scirp.65443-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Balaban, N. and Rasooly, A. (2000) Staphylococcal Enterotoxins. International Journal of Food Microbiology, 61, 1-10. http://dx.doi.org/10.1016/S0168-1605(00)00377-9</mixed-citation></ref><ref id="scirp.65443-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Omoe, K., Hu, D.-L., Ono, H.K., Shimizu, S., Takahashi-Omoe, H., Nakane, A., Uchiyama, T., Shinagawa, K. and Imanishi, K. (2013) Emetic Potentials of Newly Identified Staphylococcal Enterotoxin-Like Toxins. Infection and Immunity, 81, 3627-3631. http://dx.doi.org/10.1128/IAI.00550-13</mixed-citation></ref><ref id="scirp.65443-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Ono, H.K., Sato’o, Y., Narita, K., Naito, I., Hirose, S., Hisatsune, J., Asano, K., Hu, D.L., Omoe, K., Sugai, M. and Nakane, A. (2015) Identification and Characterization of a Novel Staphylococcal Emetic Toxin. Applied and Environmental Microbiology, 81, 7034-7040. http://dx.doi.org/10.1128/AEM.01873-15</mixed-citation></ref><ref id="scirp.65443-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Fernandez, M.M., De Marzi, M.C., Berguer, P., Burzyn, D., Langley, R.J., Piazzon, I., Mariuzza, R.A. and Malchiodi, E.L. (2006) Binding of Natural Variants of Staphylococcal Superantigens SEG and SEI to TCR and MHC Class II Molecule. Molecular Immunology, 43, 927-938. http://dx.doi.org/10.1016/j.molimm.2005.06.029</mixed-citation></ref><ref id="scirp.65443-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Pinchuk, I.V., Beswick, E.J. and Reyes, V.E. (2010) Staphylococcal Enterotoxins. Toxins (Basel), 2, 2177-2197. http://dx.doi.org/10.3390/toxins2082177</mixed-citation></ref><ref id="scirp.65443-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Munson, S.H., Tremaine, M.T., Betley, M.J. and Welch, R.A. (1998) Identification and Characterization of Staphylococcal Enterotoxin Types G and I from Staphylococcus aureus. Infection and Immunity, 66, 3337-3348.</mixed-citation></ref><ref id="scirp.65443-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Blaiotta, G., Ercolini, D., Pennacchia, C., Fusco, V., Casaburi, A., Pepe, O. and Villani, F. (2004) PCR Detection of Staphylococcal Enterotoxin Genes in Staphylococcus spp. Strains Isolated from Meat and Dairy Products. Evidence for New Variants of seG and seI in S. aureus AB-8802. Journal of Applied Microbiology, 97, 719-730. http://dx.doi.org/10.1111/j.1365-2672.2004.02349.x</mixed-citation></ref><ref id="scirp.65443-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Chiang, Y.C., Liao, W.W., Fan, C.M., Pai, W.Y., Chiou, C.S. and Tsen, H.Y. (2008) PCR Detection of Staphylococcal Enterotoxins (SEs) N, O, P, Q, R, U, and Survey of SE Types in Staphylococcus aureus Isolates from Food-Poisoning Cases in Taiwan. International Journal of Food Microbiology, 121, 66-73. http://dx.doi.org/10.1016/j.ijfoodmicro.2007.10.005</mixed-citation></ref><ref id="scirp.65443-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Collee, J.G., Miles, R.S. and Watt, B. (1996) Tests for the Identification of Bacteria. Mackie and Macartney Practical Medical Microbiology, Churchill Livingstone, New York, 413-424.</mixed-citation></ref><ref id="scirp.65443-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Clinical and Laboratory Standards Institute (2011) Performance Standards for Antimicrobial Susceptibility Testing; Twenty-First Informational Supplement. M100-S21. Clinical and Laboratory Standards Institute, Wayne.</mixed-citation></ref><ref id="scirp.65443-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Alfatemi, S.M., Motamedifar, M., Hadi, N. and Saraie, H.S. (2014) Analysis of Virulence Genes among Methicillin Resistant Staphylococcus aureus (MRSA) Strains. Jundishapur Journal of Microbiology, 7, e10741.</mixed-citation></ref><ref id="scirp.65443-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Brakstad, O.G., Aasbakk, K. and Maeland, J.A. (1992) Detection of Staphylococcus aureus by Polymerase Chain Reaction Amplification of the nuc Gene. Journal of Clinical Microbiology, 30, 1654-1660.</mixed-citation></ref><ref id="scirp.65443-ref22"><label>22</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Abdel-Rhman</surname><given-names> S.H. </given-names></name>,<etal>et al</etal>. (<year>2016</year>)<article-title>Evaluation of Total RNA Isolation Methods from Staphylococcus aureus</article-title><source> New Egyptian Journal of Microbiology</source><volume> 43</volume>,<fpage> 50</fpage>-<lpage>57</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.65443-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Schmittgen, T.D. and Livak, K.J. (2008) Analyzing Real-Time PCR Data by the Comparative CT Method. Nature Protocols, 3, 1101-1108. http://dx.doi.org/10.1038/nprot.2008.73</mixed-citation></ref><ref id="scirp.65443-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Verkaik, N.J., Dauwalder, O., Antri, K., Boubekri, I., de Vogel, C.P., Badiou, C., Bes, M., Vandenesch, F., Tazir, M., Hooijkaas, H., Verbrugh, H.A., van Belkum, A., Etienne, J., Lina, G., Ramdani-Bouguessa, N. and van Wamel, W.J. (2010) Immunogenicity of Toxins during Staphylococcus aureus Infection. Clinical Infectious Diseases, 50, 61-68. http://dx.doi.org/10.1086/648673</mixed-citation></ref><ref id="scirp.65443-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Murray, P.R., Baron, E.J., Jorgenson, J.H., Landry, M.L., Pfaller, M.A. and Yolken, R.H. (2003) Manual of Clinical Microbiology. American Society of Microbiology Press, Washington DC.</mixed-citation></ref><ref id="scirp.65443-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Arvidson, S. and Tegmark, K. (2001) Regulation of Virulence Determinants in Staphylococcus aureus. International Journal of Medical Microbiology, 291, 159-170. http://dx.doi.org/10.1078/1438-4221-00112</mixed-citation></ref><ref id="scirp.65443-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Sabouni, F., Mahmoudi, S., Bahador, A., Pourakbari, B., Sadeghi, R.H., Ashtiani, M.T., Nikmanesh, B. and Mamishi, S. (2014) Virulence Factors of Staphylococcus aureus Isolates in an Iranian Referral Children’s hospital. Osong Public Health and Research Perspectives, 5, 96-100. http://dx.doi.org/10.1016/j.phrp.2014.03.002</mixed-citation></ref><ref id="scirp.65443-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Zigo, F., Vasi, M., Elecko, J., Farkasová, Z. and Chripková, M. (2014) Antibiotic Resistance and Production of Enterotoxins of Staphylococcus spp. Isolated from Samples of Milk in Dairy Sheep. International Journal of Latest Research in Science and Technology, 3, 99-102.</mixed-citation></ref><ref id="scirp.65443-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Ippolito, G., Leone, S., Lauria, F.N., Nicastri, E. and Wenzel, R.P. (2010) Methicillin-Resistant Staphylococcus aureus: The Superbug. International Journal of Infectious Diseases, 14, S7-S11. http://dx.doi.org/10.1016/j.ijid.2010.05.003</mixed-citation></ref><ref id="scirp.65443-ref30"><label>30</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Abulreesh</surname><given-names> H.H. </given-names></name>,<etal>et al</etal>. (<year>2011</year>)<article-title>Multidrug-Resistant Staphylococci in the Environment</article-title><source> International Conference on Biotechnology and Environment Manual</source><volume> 18</volume>,<fpage> 1</fpage>-<lpage>6</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.65443-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Manoharan, M., Jayaraman, S., Illanchezian, S. and Jayasekar, J. (2008) Homologous Resistant Groups (HRGs) in Multidrug Resistant Staphylococcus aureus Isolated from Retail Foods in Vadapalani, Chennai. The Internet Journal of Microbiology, 7.</mixed-citation></ref><ref id="scirp.65443-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Sina, H., Ahoyo, T.A., Moussaoui, W., Keller, D., Bankole, H.S., Barogui, Y., Stienstra, Y., Kotchoni, S.O., Prevost, G. and Baba-Moussa, L. (2013) Variability of Antibiotic Susceptibility and Toxin Production of Staphylococcus aureus Strains Isolated from Skin, Soft Tissue, and Bone Related Infections. BMC Microbiology, 13, 188. http://dx.doi.org/10.1186/1471-2180-13-188</mixed-citation></ref><ref id="scirp.65443-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Tokajian, S., Haddad, D., Andraos, R., Hashwa, F. and Araj, G. (2011) Toxins and Antibiotic Resistance in Staphylococcus aureus Isolated from a Major Hospital in Lebanon. International Scholarly Research Network Microbiology, 2011, Article ID: 812049.</mixed-citation></ref><ref id="scirp.65443-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Perveen, S., Naqvi, S.B. and Fatima, A. (2013) Antimicrobial Susceptibility Pattern of Clinical Isolates from Cases of Ear Infection Using Amoxicillin and Cefepime. SpringerPlus, 2, 288. http://dx.doi.org/10.1186/2193-1801-2-288</mixed-citation></ref><ref id="scirp.65443-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Opere, B.O., Fashola, M.O., Adesida, S., Smith, S.I. and Adebiyi, O.A. (2013) Prevalence and Antibiotic Susceptibility Pattern of Staphylococcus aureus in Clinical Specimens. Advances in Life Science and Technology, 10, 1-5.</mixed-citation></ref><ref id="scirp.65443-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Schmitz, F.J., Fluit, A.C., Gondolf, M., Beyrau, R., Lindenlauf, E., Verhoef, J., Heinz, H.P. and Jones, M.E. (1999) The Prevalence of Aminoglycoside Resistance and Corresponding Resistance Genes in Clinical Isolates of Staphylococci from 19 European Hospitals. The Journal of Antimicrobial Chemotherapy, 43, 253-259. http://dx.doi.org/10.1093/jac/43.2.253</mixed-citation></ref><ref id="scirp.65443-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Elazhari, M., Elhabchi, D., Zerouali, K., Dersi, N., Elmalki, A., Hassar, M., Saile, R. and Timinouni, M. (2011) Prevalence and Distribution of Superantigen Toxin Genes in Clinical Community Isolates of Staphylococcus aureus. Journal of Bacteriology &amp; Parasitology, 2, 107. http://dx.doi.org/10.4172/2155-9597.1000107</mixed-citation></ref><ref id="scirp.65443-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Shittu, A.O. and Lin, J. (2006) Antimicrobial Susceptibility Patterns and Characterization of Clinical Isolates of Staphylococcus aureus in KwaZulu-Natal Province, South Africa. BMC Infectious Diseases, 6, 125. http://dx.doi.org/10.1186/1471-2334-6-125</mixed-citation></ref><ref id="scirp.65443-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Hauschild, T., Sacha, P., Wieczorek, P., Zalewska, M., Kaczynska, K. and Tryniszewska, E. (2008) Aminoglycosides Resistance in Clinical Isolates of Staphylococcus aureus from a University Hospital in Bialystok, Poland. Folia Histochemica et Cytobiologica, 46, 225-228. http://dx.doi.org/10.2478/v10042-008-0034-3</mixed-citation></ref><ref id="scirp.65443-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Gade, N.D. and Qazi, M.S. (2014) Recent Trend of Aminoglycoside Resistance among Staphylococcus aureus Isolates in Tertiary Care Hospital. Journal of Microbiology and Antimicrobials, 6, 94-96. http://dx.doi.org/10.5897/JMA2014.0315</mixed-citation></ref><ref id="scirp.65443-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Rayner, C. and Munckhof, W.J. (2005) Antibiotics Currently Used in the Treatment of Infections Caused by Staphylococcus aureus. Internal Medicine Journal, 35, S3-S16. http://dx.doi.org/10.1111/j.1444-0903.2005.00976.x</mixed-citation></ref><ref id="scirp.65443-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Asadollahi, P., Delpisheh, A., Maleki, M.H., Jalilian, F.A., Alikhani, M.Y., Asadollahi, K., Soroush, S., Hematian, A., Emaneini, M. and Taherikalani, M. (2014) Enterotoxin and Exfoliative Toxin Gtenes among Methicillin-Resistant Staphylococcus aureus Isolates Recovered from Ilam, Iran. Avicenna Journal of Clinical Microbiology and Infection, 1, e20208. http://dx.doi.org/10.17795/ajcmi-20208</mixed-citation></ref><ref id="scirp.65443-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Fernandes, C.J., Fernandes, L.A. and Collignon, P. (2005) Cefoxitin Resistance as a Surrogate Marker for the Detection of Methicillin-Resistant Staphylococcus aureus. The Journal of Antimicrobial Chemotherapy, 55, 506-510. http://dx.doi.org/10.1093/jac/dki052</mixed-citation></ref><ref id="scirp.65443-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Yaseen, I.H., Shareef, A.Y. and Daoud, A.S. (2013) High Prevalence of Multidrug-Resistance MRSA and VRSA of Different Infections from Al-Jumhuory Teaching Hospital Patients in Mosul. Journal of Life Sciences, 7, 1255-1259.</mixed-citation></ref><ref id="scirp.65443-ref45"><label>45</label><mixed-citation publication-type="other" xlink:type="simple">Seas, C., Hernandez, K., Ramos, R., Bazan, E., Rodriguez, I., Torres, A., Zamudio, C. and Gotuzzo, E. (2006) Oxacillin-Resistant and Multidrug-Resistant Staphylococcus aureus in Lima, Peru. Infection Control and Hospital Epidemiology, 27, 198-200. http://dx.doi.org/10.1086/500650</mixed-citation></ref><ref id="scirp.65443-ref46"><label>46</label><mixed-citation publication-type="other" xlink:type="simple">Pillar, C.M., Draghi, D.C., Sheehan, D.J. and Sahm, D.F. (2008) Prevalence of Multidrug-Resistant, Methicillin-Resistant Staphylococcus aureus in the United States: Findings of the Stratified Analysis of the 2004 to 2005 Leader Surveillance Programs. Diagnostic Microbiology and Infectious Disease, 60, 221-224. http://dx.doi.org/10.1016/j.diagmicrobio.2007.08.007</mixed-citation></ref><ref id="scirp.65443-ref47"><label>47</label><mixed-citation publication-type="other" xlink:type="simple">Cao, H., Wang, M., Zheng, R., Li, X., Wang, F., Jiang, Y. and Yang, Y. (2012) Investigation of Enterotoxin Gene in Clinical Isolates of Staphylococcus aureus. Journal of Southern Medical University, 32, 738-741.</mixed-citation></ref><ref id="scirp.65443-ref48"><label>48</label><mixed-citation publication-type="other" xlink:type="simple">Becker, K., Friedrich, A.W., Lubritz, G., Weilert, M., Peters, G. and Von Eiff, C. (2003) Prevalence of Genes Encoding Pyrogenic Toxin Superantigens and Exfoliative Toxins among Strains of Staphylococcus aureus Isolated from Blood and Nasal Specimens. Journal of Clinical Microbiology, 41, 1434-1439. http://dx.doi.org/10.1128/JCM.41.4.1434-1439.2003</mixed-citation></ref><ref id="scirp.65443-ref49"><label>49</label><mixed-citation publication-type="other" xlink:type="simple">Naffa, R.G., Bdour, S.M., Migdadi, H.M. and Shehabi, A.A. (2006) Enterotoxicity and Genetic Variation among Clinical Staphylococcus aureus Isolates in Jordan. Journal of Medical Microbiology, 55, 183-187. http://dx.doi.org/10.1099/jmm.0.46183-0</mixed-citation></ref><ref id="scirp.65443-ref50"><label>50</label><mixed-citation publication-type="other" xlink:type="simple">Kelly, B.G., Vespermann, A. and Bolton, D.J. (2009) Horizontal Gene Transfer of Virulence Determinants in Selected Bacterial Foodborne Pathogens. Food and Chemical Toxicology, 47, 969-977. http://dx.doi.org/10.1016/j.fct.2008.02.007</mixed-citation></ref><ref id="scirp.65443-ref51"><label>51</label><mixed-citation publication-type="other" xlink:type="simple">Argudin, M.A., Mendoza, M.C. and Rodicio, M.R. (2010) Food Poisoning and Staphylococcus aureus Enterotoxins. Toxins (Basel), 2, 1751-1773. http://dx.doi.org/10.3390/toxins2071751</mixed-citation></ref><ref id="scirp.65443-ref52"><label>52</label><mixed-citation publication-type="other" xlink:type="simple">Bhatty, M., Ray, P., Singh, R., Jain, S. and Sharma, M. (2013) Presence of Virulence Determinants amongst Staphylococcus aureus Isolates from Nasal Colonization, Superficial &amp; Invasive Infections. The Indian Journal of Medical Research, 138, 143-146.</mixed-citation></ref><ref id="scirp.65443-ref53"><label>53</label><mixed-citation publication-type="other" xlink:type="simple">Indrawattana, N., Sungkhachat, O., Sookrung, N., Chongsa-nguan, M., Tungtrongchitr, A., Voravuthikunchai, S.P., Kong-ngoen, T., Kurazono, H. and Chaicumpa, W. (2013) Staphylococcus aureus Clinical Isolates: Antibiotic Susceptibility, Molecular Characteristics, and Ability to form Biofilm. BioMed Research International, 2013, Article ID: 314654. http://dx.doi.org/10.1155/2013/314654</mixed-citation></ref><ref id="scirp.65443-ref54"><label>54</label><mixed-citation publication-type="other" xlink:type="simple">Kamarehei, F., Ghaemi, E.A. and Dadgar, T. (2013) Prevalence of Enterotoxin A and B Genes in Staphylococcus aureus Isolated from Clinical Samples and Healthy Carriers in Gorgan City, North of Iran. Indian Journal of Pathology &amp; Microbiology, 56, 265-268. http://dx.doi.org/10.4103/0377-4929.120388</mixed-citation></ref><ref id="scirp.65443-ref55"><label>55</label><mixed-citation publication-type="other" xlink:type="simple">Safaei, H.R., Pirasteh, H., Pournasiri, Z. and Dormanesh, B. (2015) Study the Enterotoxigenixity of Staphylococcus aureus Isolated from the Urine Samples of Pediatrics with UTIs. Biomedical and Pharmacology Journal, 8, 111-118. http://dx.doi.org/10.13005/bpj/566</mixed-citation></ref><ref id="scirp.65443-ref56"><label>56</label><mixed-citation publication-type="other" xlink:type="simple">Wang, L.X., Hu, Z.D., Hu, Y.M., Tian, B., Li, J., Wang, F.X., Yang, H., Xu, H.R. and Li, Y.C. (2013) Molecular Analysis and Frequency of Staphylococcus aureus Virulence Genes Isolated from Bloodstream Infections in a Teaching Hospital in Tianjin, China. Genetics and Molecular Research, 12, 646-654. http://dx.doi.org/10.4238/2013.March.11.12</mixed-citation></ref><ref id="scirp.65443-ref57"><label>57</label><mixed-citation publication-type="other" xlink:type="simple">Lim, K.T., Hanifah, Y.A., Mohd Yusof, M.Y. and Thong, K.L. (2012) Investigation of Toxin Genes among Methicillin-Resistant Staphylococcus aureus Strains Isolated from a Tertiary Hospital in Malaysia. Tropical Biomedicine, 29, 212-219.</mixed-citation></ref><ref id="scirp.65443-ref58"><label>58</label><mixed-citation publication-type="other" xlink:type="simple">Adwan, G., Adwan, K., Jarrar, N., Salama, Y. and Barakat, A. (2013) Prevalence of seg, seh and sei Genes among Clinical and Nasal Staphylococcus aureus Isolates in Palestine. British Microbiology Research Journal, 3, 139-149. http://dx.doi.org/10.9734/BMRJ/2013/2913</mixed-citation></ref><ref id="scirp.65443-ref59"><label>59</label><mixed-citation publication-type="other" xlink:type="simple">Varshney, A.K., Mediavilla, J.R., Robiou, N., Guh, A., Wang, X., Gialanella, P., Levi, M.H., Kreiswirth, B.N. and Fries, B.C. (2009) Diverse Enterotoxin Gene Profiles among Clonal Complexes of Staphylococcus aureus Isolates from the Bronx, New York. Applied and Environmental Microbiology, 75, 6839-6849. http://dx.doi.org/10.1128/AEM.00272-09</mixed-citation></ref><ref id="scirp.65443-ref60"><label>60</label><mixed-citation publication-type="other" xlink:type="simple">Sapri, H.F., Sani, N.A.M., Neoh, H.-M. and Hussin, S. (2013) Epidemiological Study on Staphylococcus aureus Isolates Reveals Inverse Relationship between Antibiotic Resistance and Virulence Repertoire. Indian Journal of Microbiology, 53, 321-322. http://dx.doi.org/10.1007/s12088-013-0357-4</mixed-citation></ref><ref id="scirp.65443-ref61"><label>61</label><mixed-citation publication-type="other" xlink:type="simple">Jimenez, J.N., Ocampo, A.M., Vanegas, J.M., Rodriguez, E.A., Garces, C.G., Patino, L.A., Ospina, S. and Correa, M.M. (2011) Characterisation of Virulence Genes in Methicillin Susceptible and Resistant Staphylococcus aureus Isolates from a Paediatric Population in a University Hospital of Medellin, Colombia. Memórias do Instituto Oswaldo Cruz, 106, 980-985. http://dx.doi.org/10.1590/S0074-02762011000800013</mixed-citation></ref><ref id="scirp.65443-ref62"><label>62</label><mixed-citation publication-type="other" xlink:type="simple">Cameron, D.R., Howden, B.P. and Peleg, A.Y. (2011) The Interface between Antibiotic Resistance and Virulence in Staphylococcus aureus and Its Impact upon Clinical Outcomes. Clinical Infectious Diseases, 53, 576-582. http://dx.doi.org/10.1093/cid/cir473</mixed-citation></ref><ref id="scirp.65443-ref63"><label>63</label><mixed-citation publication-type="other" xlink:type="simple">Pourmand, M.R., Memariani, M., Hoseini, M. and Yazdchi, S.B. (2009) High Prevalence of SEA Gene among Clinical Isolates of Staphylococcus aureus in Tehran. Acta Medica Iranica, 47, 357-361.</mixed-citation></ref><ref id="scirp.65443-ref64"><label>64</label><mixed-citation publication-type="other" xlink:type="simple">Sharma, N.K., Rees, C.E. and Dodd, C.E. (2000) Development of a Single-Reaction Multiplex PCR Toxin Typing Assay for Staphylococcus aureus Strains. Applied and Environmental Microbiology, 66, 1347-1353. http://dx.doi.org/10.1128/AEM.66.4.1347-1353.2000</mixed-citation></ref><ref id="scirp.65443-ref65"><label>65</label><mixed-citation publication-type="other" xlink:type="simple">Vasconcelos, N.G., Pereira, V.C., Araujo Jr., J.P. and da Cunha, M.L. (2011) Molecular Detection of Enterotoxins E, G, H and I in Staphylococcus aureus and Coagulase-Negative Staphylococci Isolated from Clinical Samples of Newborns in Brazil. Journal of Applied Microbiology, 111, 749-762. http://dx.doi.org/10.1111/j.1365-2672.2011.05076.x</mixed-citation></ref></ref-list></back></article>