Row cattle feces (R), which would be converted into cattle feces manure, was collected from a cow barn for daily cattle in National Agricultural Research Center for Kyushu-Okinawa Region, where daily cattle were breeding in Japanese standard method [28] . Cattle feces manure (M) was provided from farmer around National Agricultural Research Center for Kyushu-Okinawa Region. Shochu lee (S), residual aqueous solution of sweet potato after fermentation and distillation of shochu, was obtained from Akashi Shuzo Co. Ltd. (Miyazaki, Japan), which would be converted into compost. Compost originated from leftover food (L) was collected in composting facility in Kumamoto prefecture (Kumamoto, Japan).

The number of resistant bacteria was estimated by MPN using lactose broth (LB medium Difco, Sparks MD) by adding colistin (25 mg∙L⁻¹) (P; polymyxin E), which was not used as therapeutic agent in human nor as animal growth promoter (AGP) in Japan, or chlortetracycline (T) (25 mg∙L⁻¹), which was used widely as therapeutic agent in human and veterinary medicine but also used as AGP. For multi drug resistant bacteria (X) the following antimicrobial compounds were co-applied; ciprofloxacin (25 mg∙L⁻¹), streptomycin (25 mg∙L⁻¹), chloramphenicol (25 mg∙L⁻¹), and ampicillin (25 mg∙L⁻¹). Serial 10-fold dilutions (10⁻² to 10⁻⁵) prepared from samples (1g fresh wt.) were inoculated to test vials (5 replicates) including LB medium and the antibiotics. After 5 days incubation at 30˚C, bacterial DNA in each vial was extracted as described previously and purified by conventional methods [26] [27] .

Using the V2 forward primer (41f; 5 ‘GCTCAGATTGAACGCTGGCG3’), and the V6 reverse primer (1066r; 3 ‘GTCGAGCACAACACTTTACA5’) [29] , 16S rDNA of about 1070 bp length was amplified as described previously [30] [31] . Their restriction fragment lengths were measured by microchip electrophoresis systems (Cosmo-i SV1200; Hitachi Electronics Engineering Co., Ltd. Tokyo Japan, or MCE-202 MultiNA; Shimadzu Co., Ltd. Kyoto Japan) after digestion of the PCR product (10 μl) using each restriction enzyme, HaeIII or HhaI or Rsa I (10 units, Takara Bio Co. Ltd. Shiga Japan) in buffer solution (10× Low salt buffer, Takara Bio Co. Ltd.) and 5 folds dilution by de-ionized water as described previously [30] [31] .

The reference database used for this research included 30,844 post-amplification sequence files for the 41f/ 1066r primers, which were mainly re-edited from small subunit rRNA files in RDP II release 9_61 [32] under 5 - bases mismatches in the both in primer annealing sites and were consisted from 1379 bacterial genera, including uncultured and unidentified bacteria.

As each MPN vials included multi-template DNAs originated from heterogeneous bacteria, the measured MERFL digested from the homogeneous 16S rDNA was selected among the mixed MERFLs digested from the heterogeneous 16S rDNA as described previously [26] . Because all the reference MERFLs were originated from the homogeneous 16S rDNA sequence. The major RFs (represented as H in Tables 1-3) were those with the highest relative mole concentration (ratio of fluorescent intensity to fragment size). After subtraction of the major RFs from the mixed heterogeneous RFs, the 2nd major RFs were similarly selected (represented as M in Tables 1-3). After subtraction of the 2nd major RFs from the remained heterogeneous RFs, the 3rd major RFs were similarly selected (represented as L in Tables 1-3). The similarity between the measured RFLP (A) and the reference RFLP (B) was calculated as described previously [30] [31] based on the pairwise distance (D_AB) according to Nei and Li [33] . The pairwise distance of the MERFLPs (D_ABME) was an average of all the D_ABs for used restriction enzymes. Similarity (%) was (1-D_ABME) × 100 (Tables 1-3). In the phylogenetic estimation, combinations of the 2 restriction enzymes was used when the identical reference MERFL (100% similarity) was not found using all of the measured MERFL for the 3 restriction enzymes. When the identical reference MERFL to the measured MERFL for 2 restriction enzymes was not found, the reference MERFL having the highest similarity (over 80% ) to the measured MERFL was indicated in most cases (Tables 1-3) [30] [31] .

By five-tube, three-decimal-dilution experiment, MPNs of each antibiotic resistant bacterial groups (A~K) were estimated (Tables 4-6). Using FDA’s Bacterial Analytical Manual [34] , confidence limits were obtained and shown in the Tables.

Affiliations of 67 MERFLs of colistin resistant bacteria (P) in each MPN vials were summarized in Table 1. All of the 67 MERFLs were divided into 67 OTUs, then ratio of total number of the OTUs to the total number of MERFLs was 100% (diversity of MERFLs), which was the highest among all the samples analyzed until now [26] [27] . Affiliations of 112 MERFLs of chlortetracycline resistant bacteria (T) in each MPN vials were summarized in Table 2. All of the 112 MERFLs were divided into 88 OTUs, then ratio of total number of the OTUs to the total number of MERFLs was 78.6 %, which was lower than that of P. Some Pseudomonas sp. (E) in shochu lee (S) (7 MERFLs) and compost originated from leftover food (L) (8 MERFLs) were placed in the same OUT (Table 2) and some Enterobacteriacea (F) in row cattle feces (R) (8 MERFLs) were placed in the same

^aGrouping was based on affiliation by MERFL; Actinobacteria (A), Bacillus spp. (B), the other Firmicutes (C), α, β-Proteobacteria (D), Pseudomonas sp. (E), Enterobacteriacea (F), the other γ-Proteobacteria (GG), δ, ε-Proteobacteria (H), Cytophaga (I), the other bacteria (J), and unidentified or uncultured bacterial group (K). ^bThe 1^st letter in vial indicates used antibiotics; “P” stands for colistin (polymyxin E). The 2nd letter in vial indicates samples; “R” stands for row cattle feces, “M” stands for cattle feces manure, “S” stands for shochu lee, and “L” stands for compost originated from leftover food. Exponential of vial number represents the decimal dilution of the vial. The 2nd number of vial number (1 - 5) represents number in 5 replicates for the each decimal dilution. “H” of last letter represents MERFL originating from the major 16S rDNA, “M” represents from the 2nd major 16S rDNA, and “L” represents from the 3rd major 16S rDNA. ^c Restriction enzymes used for similarity search; “Ha”, “R”, and “Hh” stand for Hae III, Rsa I, and Hha I. For the measured MERFLP which had no completely identical theoretical MERFLP, the theoretical MERFLP having the highest similarity using all the RFLPs was presented with the similarity as described in the materials and method. ^dThe similarity between the measured RFLP (A) and the reference RFLP (B) was calculated based on the pairwise distance (D_AB) according to Nei and Li [33] . ^eSpecies name (accession number) of the theoretical MERFL having the highest similarity with the measured MERFL. ^fThe theoretical MERFL (accession number) having the same MERFL belonged to different group in parenthesis. ^gThe MERFL falling into different groups by using the different restriction enzymes.

^aGrouping was based on affiliation by MERFL; Actinobacteria (A), Bacillus spp. (B), the other Firmicutes (C), α, β-Proteobacteria (D), Pseudomonas sp. (E), Enterobacteriacea (F), the other γ-Proteobacteria (GG), δ, ε-Proteobacteria (H), Cytophaga (I), the other bacteria (J), and unidentified or uncultured bacterial group (K). ^bThe 1^st letter in vial indicates used antibiotics; “T” stands for chlortetracycline. The 2nd letter in vial indicates samples; “R” stands for row cattle feces, “M” stands for cattle feces manure, “S” stands for shochu lee, and “L” stands for compost originated from leftover food. Exponential of vial number represents the decimal dilution of the vial. The 2nd number of vial number (1 - 5) represents number in 5 replicates for the each decimal dilution. “H” of last letter represents MERFL originating from the major 16S rDNA, “M” represents from the 2nd major 16S rDNA, and “L” represents from the 3rd major 16S rDNA. ^cRestriction enzymes used for similarity search; “Ha”, “R”, and “Hh” stand for Hae III, Rsa I, and Hha I. For the measured MERFLP which had no completely identical theoretical MERFLP, the theoretical MERFLP having the highest similarity using all the RFLPs was presented with the similarity as described in the materials and method. ^dThe similarity between the measured RFLP (A) and the reference RFLP (B) was calculated based on the pairwise distance (D_AB) according to Nei and Li [33] . ^eSpecies name (accession number) of the theoretical MERFL having the highest similarity with the measured MERFL. ^fThe theoretical MERFL (accession number) having the same MERFL belonged to different group in parenthesis. ^gThe MERFL falling into different groups by using the different restriction enzymes.

^aGrouping was based on affiliation by MERFL; Actinobacteria (A), Bacillus spp. (B), the other Firmicutes (C), α, β-Proteobacteria (D), Pseudomonas sp. (E), Enterobacteriacea (F), the other γ-Proteobacteria (GG), δ, ε-Proteobacteria (H), Cytophaga (I), the other bacteria (J), and unidentified or uncultured bacterial group (K). ^bThe 1^st letter in vial indicates used antibiotics; “X” stands for multi drugs, ciprofloxacin, streptomycin, chloramphenicol, and ampicillin. The 2nd letter in vial indicates samples; “R” stands for row cattle feces, “M” stands for cattle feces manure, “S” stands for shochu lee, and “L” stands for compost originated from leftover food. Exponential of vial number represents the decimal dilution of the vial. The 2nd number of vial number (1 - 5) represents number in 5 replicates for the each decimal dilution. “H” of last letter represents MERFL originating from the major 16S rDNA, “M” represents from the 2nd major 16S rDNA, and “L” represents from the 3rd major 16S rDNA. ^cRestriction enzymes used for similarity search; “Ha”, “R”, and “Hh” stand for Hae III, Rsa I, and Hha I. For the measured MERFLP which had no completely identical theoretical MERFLP, the theoretical MERFLP having the highest similarity using all the RFLPs was presented with the similarity as described in the materials and method. ^dThe similarity between the measured RFLP (A) and the reference RFLP (B) was calculated based on the pairwise distance (D_AB) according to Nei and Li [33] . ^eSpecies name (accession number) of the theoretical MERFL having the highest similarity with the measured MERFL. ^fThe theoretical MERFL (accession number) having the same MERFL belonged to different group in parenthesis. ^gThe MERFL falling into different groups by using the different restriction enzyme.