Bacterial isolates were collected from two tertiary care centers in Kerala, South India. Isolate identity was confirmed by biochemical tests and ribotyping using Microbial Type Culture Collection (MTCC) E. coli strain 41 as reference. LPW57-5’ AGTTTGATCCTGGCTCAG3’ and LPW58-5’ AGGCCCGGGAACGTATTCAC3’ [16] were used as forward and reverse primers respectively for ribotyping. Isolates which were found to harbour plasmid DNA, detected by the alkaline lysis method, which also tested positive for ESBL production, were included in this study.

Antibiotic sensitivity against 10 antibiotics, belonging to five different classes, was tested by Kirby-Bauer disc diffusion [17] method according to Clinical and Laboratory Standards Institute (CLSI) manual [18] . The antibiotic discs (Hi Media laboratories, Mumbai, India) used in this study were Ampicillin (AMP)―10 mcg, Ceftazidime (CAZ)―30 mcg, Cefotaxime (CTX)―30 mcg, Piperacillin/Tazobactam (PIT)―100/10 mcg, Azithromycin (AZM)―15 mcg, Gentamicin (GEN)―10 mcg, Nalidixic acid (NA)―30 mcg, Ciprofloxacin (CIP)―5 mcg, Meropenem (MRP)―10 mcg and Chloramphenicol (C)―30 mcg.

Plasmids and genomic DNA were isolated by alkaline lysis method [19] and the procedure described by Keller and Manak (1989) [20] respectively. The plasmid DNA was electrophoresced at 100 V for 1 h and 30 min in 0.5× Tris-Borate-EDTA (TBE), using 0.8% (w/v) agarose to obtain the plasmid profiles of different isolates. Molecular weights of plasmid DNA was determined using AlphaView (AV) version 3.2.2.0 software.

Phenotypic screening and confirmation of ESBL production was performed as per CLSI manual. Disc diffusion technique was applied on Mueller-Hinton Agar (MHA) using ceftazidime (CAZ)―30 mcg, aztreonam (AT)― 30 mcg and cefotaxime (CTX)―30 mcg, discs for screening and ceftazidime, ceftazidime-clavulanic acid (CAC)―30/10 mcg, and cefotaxime, cefotaxime-clavulanic acid (CEC)―30/10 mcg, discs for confirmation. Lawn culture of isolates was prepared on MHA and the culture with appropriate antibiotic discs was incubated at 37˚C for 18 h. The diameter of zone of inhibition was measured and the results were interpreted as per CLSI recommendations. E. coli MTCC41 served as the negative control.

A PCR-based screening was conducted to detect the presence of blaNDM-1 gene on plasmid DNA from the isolates, using primers NDM-F―5’GGTTTGGCGATCTGGTTTTC3’, and NDM-R―5’CGGAATGGCTCAT- CACGATC 3’ [21] [22] . The PCR reactions were performed in a minicycler (MJ Research, USA) in a volume of 25 µl containing 1× PCR buffer, 1.5 mM MgCl₂, 200 µM each of dNTPs, 2 U of Taq DNA polymerase, 0.5 µM primer and 100 ng template DNA. All reagents were purchased from Bangalore Genei Pvt. Ltd. HPLC purified primers were purchased from Sigma Aldrich Chemicals Pvt. Ltd. (Bangalore).

The PCR products were sequenced at a commercial facility (Xcelris Labs Limited, Ahmedabad). The nucleotide sequences and deduced protein sequences were analyzed with Basic Local Alignment Search Tool (BLAST) programs of National Center for Biotechnology Information (NCBI) (www.ncbi.nlm.nih.gov). Presence of open reading frames (ORFs) and conserved regions were detected by ORF finder (www.ncbi.nlm.nih.gov/gorf/gorf.html).

The DNA sequences of blaNDM-1 amplicons obtained in the present study were compared with those of Klebsiella pnemoniae, Citrobacter freundii, E. coli, Serratia sp. and Acinetobacter soli strains retrieved from the NCBI GenBank database. Nucleotide BLAST (BLASTN) was used for the sequence searches with default parameters and those DNA sequences, which showed hits with the study sequence, with minimum “E value” and maximum “query coverage” were considered for phylogenetic analysis. To determine the nearest phylogenetic neighbours, each sequence was subjected to the nucleotide sequence homology searches using BLAST homology search tool [23] . All the sequences were aligned using default configuration of multiple sequence comparison by log-expectation (MUSCLE) embedded in MEGA 5 (Molecular Evolutionary Genetics Analysis) software [24] [25] . The phylogenetic tree has been constructed by neighbour-joining method with 1000 heuristic bootstrap replicates and substitution model as “p distance”.

Initial screening of genomic DNA samples was carried out with 10 different decameric oligonucleotide primers―RBaC 1 - 10 (Bangalore Genei, Pvt. Ltd.) to check for the reproducibility of the fingerprints. Of the few primers which produced consistently reproducible pattern of discrete bands, the primer, RBaC5 with the sequence AGGGGCGGCA (Accession. no. AM911680) was selected for generating fingerprints of the isolates. As described earlier, 25 µl reactions were subjected to thermal cycling according to manufacturer’s instructions. The photographs of RAPD gels were used to construct the dendrogram employing NTSYS pc2.0 (Numerical Taxonomy and Multivariate Analysis System) software by unweighed pair-group method arithmetic mean (UPG-MA).

Statistical analysis was carried out using SPSS (Statistical Package for Social Sciences) software version 20. Significance of difference between two independent proportions was analyzed by Z-test. A two-tailed P < 0.01 was considered significant.

A total of 44 E. coli isolates were collected all of which were found to produce an amplicon having same molecular weight as that of E. coli MTCC 41. This particular band was sequenced for confirmation of the reliability of identification. The sequence showed identity with E. coli 16S rRNA sequences.

All the isolates were found to be resistant to AMP, β-lactam/β-lactam inhibitor combination―PIT, 1st and 2nd generation quinolone―NA and CIP, 3rd generation cephalosporins―CTX and CAZ. Significantly high resistance was observed against AZM [(77%) (P < 0.01)]. However, comparatively decreased resistance was observed in isolates against GEN (57%), MRP (59%) and C (25%).

Plasmids could be isolated from 25 (57%) of the isolates which were designated as E1 to E25. All of the plasmid bearing isolates were found to be ESBL producers as they gave positive results during screening (zone of inhibition was ≤22, ≤27 and ≤27 around CAZ, AT, and CTX respectively) which were further confirmed by employing CAZ and CTX antibiotics alone and in combination with clavulanic acid [ceftazidime-clavulanic acid (CAC―30/10 mcg) and cefotaxime-clavulanic acid (CEC―30/10 mcg)]. The zone of inhibition around CAC disc was found to increase in diameter (>5 mm) than that around CAZ in all the isolates. CEC was found to be ineffective.

blaNDM-1 specific amplicons were observed in only four (16%) isolates (E7, E8, E10 and E23) which were found to vary in size from ~580 to 850 bp Figure 1. The DNA sequence identity was confirmed using BLASTN analysis. These four DNA sequences together with six similar sequences, retrieved from NCBI GenBank database, based on the criteria mentioned above, were used to construct the phylogenetic tree in order to understand the nearest neighbour of the study sequences. The genetic divergence and homogeneity of the sequences are apparent in the phylogenetic tree Figure 2. Among the DNA sequences obtained from our study, those from isolates E23 and E8 were found to form distinct lineages, whilst those from E7 and E10 shared similarity. Interestingly, these sequences were closely placed in the phylogenetic tree and their genetic similarity with sequences from other countries like Japan (Accession no: KP347609.1), Korea (Accession no: CP012754.1) and china (Accession no: KP987216.1) as well as with two sequences reported from India (Accession no: KR872634.1 and KR872624.1) was also clearly discernible in the tree.

All the isolates were found to exhibit some genotypic similarities, as evident from their plasmid profile Figure 3(a) and RAPD dendrogram. Three major plasmid profile types (a-c) could be noticed, with molecular weights ranging from 1.3 to >21 kb Table 1, on agarose gel electrophoresis of the isolated plasmids. The isolates which were found to share the plasmid profiles were grouped under type a, and those with similar profiles were included under subtypes of a (a1, a2, a3 and a4) Figure 3(b). The 2nd type of profile (b) included isolates showing unique profiles and the 3rd type (c) included those which exhibited a single band of >21 kb on agarose gel. Isolates which displayed the same plasmid profile also showed an apparent congruence in their resistance phenotypes as well. Minor similarities were also observed in the subtypes of profile a. Out of 25 isolates, 13 (52%) belonged to type a, 10 (40%) to type b and the remaining to type c profile. It is interesting to note that, all the blaNDM-1 positive isolates were found to be included under type a, except E23, with E7 and E10 showing identical profile (a4) and E8 with a1profile Table 1. The isolate E23, which exhibited a unique plasmid profile, was collected from Calicut area.

The RAPD profiles generated employing random decameric primer-RBaC 5 were analysed to construct a dendrogram using NTSYS pc2.0 software which also displayed a similar picture. The dendrogram showed two major clusters-A and B Figure 4. The major clusters could be further subdivided into sub-clusters-A1, A2 and B1, B2. All the isolates collected from Calicut area were found to be included in the same sub-cluster A1. Interestingly, the two isolates with similarity index 1.000, E21 and E22 (sub-cluster A1) were also from the same place of collection. Likewise, isolates E15, E18 and E19 (sub-cluster A2) with similarity index 1.000 also showed a similar antibiotic resistance phenotype. Notably, all isolates within this sub-cluster except E15 exhibited identical plasmid profile-a1 Table 1. Among the blaNDM-1 positive isolates, E10, however, failed to be amplified with the random primer, while the other three (E7, E8 and E23) were found to be included in a same distant subcluster of A1 with E7 and E8 showing greater similarity. This observation is line with the results of our plasmid profile analysis.