<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">ABB</journal-id><journal-title-group><journal-title>Advances in Bioscience and Biotechnology</journal-title></journal-title-group><issn pub-type="epub">2156-8456</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/abb.2016.71005</article-id><article-id pub-id-type="publisher-id">ABB-63276</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Molecular Cloning of a Chitinase Gene from the Ovotestis of Kuroda’s Sea Hare &lt;i&gt;Aplysia kurodai&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>aku</surname><given-names>Matsunaga</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Syuuji</surname><given-names>Karasuda</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ryo</surname><given-names>Nishino</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hideto</surname><given-names>Fukushima</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Masahiro</surname><given-names>Matsumiya</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Marine Science and Resources, College of Bioresource Sciences, Nihon University, Kanagawa, Japan</addr-line></aff><pub-date pub-type="epub"><day>14</day><month>01</month><year>2016</year></pub-date><volume>07</volume><issue>01</issue><fpage>38</fpage><lpage>46</lpage><history><date date-type="received"><day>26</day>	<month>December</month>	<year>2015</year></date><date date-type="rev-recd"><day>accepted</day>	<month>25</month>	<year>January</year>	</date><date date-type="accepted"><day>29</day>	<month>January</month>	<year>2016</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  In this study, we report that we successfully cloned and sequenced a chitinase gene from the ovotestis of Kuroda’s sea hare 
  Aplysia kurodai. By using reverse transcription-polymerase chain reaction (RT-PCR) and a system for the 5’ and 3’ rapid amplification of cDNA ends, we obtained a 1352 bp chitinase gene (
  AkChi) from the ovotestis of 
  A. kurodai. AkChi contains a 1263 bp open reading frame that encodes 421 amino acids. The domain structure predicted from the deduced amino acid sequence was an N-terminal signal peptide and a catalytic domain of glycoside hydrolase (GH) family 18 chitinase. A comparative analysis of the deduced amino acid sequences of 
  AkChi with those of the acidic mammalian chitinase of the California sea hare 
  Aplysia californica revealed the highest homology at 83%. The purified chitinase from the ovotestis was digested by trypsin, and 119 residues of digested peptides were consistent with the deduced amino acid sequence of 
  AkChi. We used RT-PCR to evaluate the expression of 
  AkChi in various tissues of 
  A. kurodai, and we observed that AkChi was expressed only in the ovotestis. A phylogenetic tree analysis, performed using the amino acid sequences of 
  AkChi and known GH family 18 chitinases, showed that 
  AkChi was separated from the molluscan chitinases with a chitin binding domain. To our knowledge, this is the first study demonstrating the cDNA cloning of an ovotestis chitinase from a sea hare.
 
</p></abstract><kwd-group><kwd>Chitinase</kwd><kwd> Molecular Cloning</kwd><kwd> Kuroda’s Sea Hare &lt;i&gt;Aplysia kurodai&lt;/i&gt;</kwd><kwd> Mollusc</kwd><kwd> Ovotestis</kwd><kwd> Phylogenetic Tree Analysis</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Chitin, a major molecular constituent of the exoskeleton of insects and crustaceans, is a straight-chain homopolymer of β-1,4-linked N-acetyl-D-glucosamine units [<xref ref-type="bibr" rid="scirp.63276-ref1">1</xref>] -[<xref ref-type="bibr" rid="scirp.63276-ref3">3</xref>] . Chitinases (EC 3.2.1.14) are enzymes that randomly hydrolyze the β-1,4 glycosidic bonds of chitin [<xref ref-type="bibr" rid="scirp.63276-ref4">4</xref>] . They have been found in various organisms, and they play important physiological roles in functions such as attack, defense, morphological changes, and digestion [<xref ref-type="bibr" rid="scirp.63276-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.63276-ref6">6</xref>] .</p><p>The characterization and cDNA cloning of chitinases from several fishes have been reported [<xref ref-type="bibr" rid="scirp.63276-ref7">7</xref>] -[<xref ref-type="bibr" rid="scirp.63276-ref9">9</xref>] . The stomach chitinases of fish have been identified and are classified into two groups, acidic fish chitinase-1 (AFCase-1) and acidic fish chitinase-2 (AFCase-2) based on the differences in their primary structure and the activity toward short substrates [<xref ref-type="bibr" rid="scirp.63276-ref8">8</xref>] . Chitinases from molluscs play important physiological roles in the digestion of food [<xref ref-type="bibr" rid="scirp.63276-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.63276-ref11">11</xref>] , attacking crustaceans [<xref ref-type="bibr" rid="scirp.63276-ref12">12</xref>] , and shell formation [<xref ref-type="bibr" rid="scirp.63276-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.63276-ref14">14</xref>] . However, reports on the distribution, characterization, and cDNA cloning of molluscan chitinases are limited [<xref ref-type="bibr" rid="scirp.63276-ref10">10</xref>] -[<xref ref-type="bibr" rid="scirp.63276-ref16">16</xref>] . In this study, we were using the Kuroda’s sea hare, Aplysia kurodai. A. kurodai is a kind of herbivorous gastropoda seen in the vicinity of the coast from April to June. In addition, this creature was allowed to degenerate shells despite the shellfish. In a previous study, we detected chitinase activity in the ovotestis and egg of A. kurodai [<xref ref-type="bibr" rid="scirp.63276-ref16">16</xref>] , whereas lysozyme activity (antibacterial enzyme activity) was not detected in all of the organs [<xref ref-type="bibr" rid="scirp.63276-ref16">16</xref>] . We also reported the purification and properties of a chitinase from the ovotestis of A. kurodai [<xref ref-type="bibr" rid="scirp.63276-ref16">16</xref>] . Together the results indicated that the physiological role of this chitinase was as a defense against nematodes and fungus which had chitin in the body wall as a structural component [<xref ref-type="bibr" rid="scirp.63276-ref16">16</xref>] .</p><p>In the present study, we cloned the cDNA encoding chitinase from the ovotestis of A. kurodai and determined the primary structure of the chitinase.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Materials</title><p>Kuroda’s sea hare Aplysia kurodai and laid egg were captured from the tide pools of Shimoda Bay (Shizuoka, Japan) in June.</p></sec><sec id="s2_2"><title>2.2. Cloning of the Chitinase cDNA from A. Kurodai</title><p>The sequences of all primers are presented in <xref ref-type="table" rid="table1">Table 1</xref>. Total RNA was extracted from the ovotestis of A. kurodai using ISOGEN II reagent (Nippon Gene, Tokyo) according to the manufacturer’s instructions. First-strand cDNA was synthesized using 500 ng of total RNA and oligo dT primers with Prime Script Reverse Transcriptase (Takara Bio, Shiga, Japan) according to the manufacturer’s instructions. Six degenerate primers were designed for the reverse transcriptase-polymerase chain reaction (RT-PCR) from conserved sequences of molluscan chitinase, including those from California sea hare (Aplysia californica; GenBank: XM_005112601), triangle sail mussel (Hyriopsis cumingii; GenBank: JN582038), Pacific oyster (Crassostrea gigas; GenBank: AJ971239), Hawaiian bobtail squid (Euprymna scolopes; GenBank: KF015222), and golden cuttlefish (Sepia esculenta; GenBank: AB986212).</p><p>The first PCR was performed using A. kurodai cDNA as a template and P1 and P2 as primers (<xref ref-type="fig" rid="fig1">Figure 1</xref>). The PCR parameters were as follows: 94˚C for 2 min, followed by 30 cycles of 94˚C for 30 s, 55˚C for 30 s, and 72˚C for 30 s. Nested PCR was performed using the products of the first PCR as templates and P3, P4, P5, and P6 as primers, with the same PCR parameters as described above. The nucleotide sequence analysis of the RT-PCR amplified chitinase cDNA fragments from the ovotestis of A. kurodai detected one nucleotide sequence (AkChi).</p><p>For the 3’ rapid amplification of cDNA ends (RACE), we designed primers specific to AkChi (i.e., P7, P8, and P9, respectively; <xref ref-type="table" rid="table1">Table 1</xref>) based on the detected sequences. We amplified cDNA fragments encoding the 3’ region of AkChi using A. kurodai cDNA as the template and the primer pairs P7 and 3R, P8 and 3R, and P9 and 3R (<xref ref-type="fig" rid="fig1">Figure 1</xref>). The PCR parameters were as follows: 94˚C for 2 min, followed by 30 cycles of 94˚C for 30 s, 56˚C for 30 s, and 72˚C for 30 s. For 5’ RACE, specific primers (P10, P11, and P12 for AkChi; <xref ref-type="table" rid="table1">Table 1</xref>) were designed based on the nucleotide sequences obtained from RT-PCR. cDNA fragments encoding the 5’ regions of AkChi were amplified using PCR. The first PCR was performed using the newly synthesized first-strand cDNA as a template and the primer pairs P10 and P11 for AkChi. Nested PCR was performed using the first PCR products as templates and the primer pairs P10 and P12 for AkChi. The PCR parameters were as follows:</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used for PCR, RACE, and tissue-specific expression</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer</th><th align="center" valign="middle" >Sequence (5’ → 3’)</th><th align="center" valign="middle" >Purpose</th></tr></thead><tr><td align="center" valign="middle" >P1<sup>*</sup></td><td align="center" valign="middle" >TNGCNGCNTTYGARTGGAAYGA</td><td align="center" valign="middle" >Primary PCR</td></tr><tr><td align="center" valign="middle" >P2<sup>*</sup></td><td align="center" valign="middle" >CATNCCNSWRAARTCRTCRTTRTC</td><td align="center" valign="middle" >Primary PCR</td></tr><tr><td align="center" valign="middle" >P3<sup>*</sup></td><td align="center" valign="middle" >GGNGGNTGGAAYATGGG</td><td align="center" valign="middle" >Primary PCR</td></tr><tr><td align="center" valign="middle" >P4<sup>*</sup></td><td align="center" valign="middle" >ACCCAYTGRTTNCCNARNACNA</td><td align="center" valign="middle" >Primary PCR</td></tr><tr><td align="center" valign="middle" >P5<sup>*</sup></td><td align="center" valign="middle" >GNAAYTTYGAYGGNYTNGA</td><td align="center" valign="middle" >Primary PCR</td></tr><tr><td align="center" valign="middle" >P6<sup>*</sup></td><td align="center" valign="middle" >TTDATCATYTCRCANACYTCRTARTA</td><td align="center" valign="middle" >Primary PCR</td></tr><tr><td align="center" valign="middle" >P7</td><td align="center" valign="middle" >GCCGGATACGAAGTGGAC</td><td align="center" valign="middle" >3’ RACE</td></tr><tr><td align="center" valign="middle" >P8</td><td align="center" valign="middle" >GGAACTTAACGAGTACTT</td><td align="center" valign="middle" >3’ RACE</td></tr><tr><td align="center" valign="middle" >P9</td><td align="center" valign="middle" >GACAGACGAGAGCGACTCTGGTCG</td><td align="center" valign="middle" >3’ RACE</td></tr><tr><td align="center" valign="middle" >3R</td><td align="center" valign="middle" >CTGTGAATGCTGCGACTACGAT</td><td align="center" valign="middle" >3’ RACE</td></tr><tr><td align="center" valign="middle" >P10</td><td align="center" valign="middle" >CACAATGACGTTGCAAG</td><td align="center" valign="middle" >5’ RACE, Full-length PCR</td></tr><tr><td align="center" valign="middle" >P11</td><td align="center" valign="middle" >ATGGCCTGGGCTCATTTT</td><td align="center" valign="middle" >5’ RACE</td></tr><tr><td align="center" valign="middle" >P12</td><td align="center" valign="middle" >TTATCCTCTGGAGGGCT</td><td align="center" valign="middle" >5’ RACE</td></tr><tr><td align="center" valign="middle" >P13</td><td align="center" valign="middle" >CACGTTATGATTGCGAC</td><td align="center" valign="middle" >Full-length PCR</td></tr><tr><td align="center" valign="middle" >P14</td><td align="center" valign="middle" >TCTGCTGCTGTGAGTGCTGGCAAGG</td><td align="center" valign="middle" >tissue-specific expression</td></tr><tr><td align="center" valign="middle" >P15</td><td align="center" valign="middle" >GCATTTCGCACACCTCGTAGTAAGA</td><td align="center" valign="middle" >tissue-specific expression</td></tr><tr><td align="center" valign="middle" >β-actin-a<sup>*</sup></td><td align="center" valign="middle" >GAYAAYGGNWSNGGNATGTG</td><td align="center" valign="middle" >tissue-specific expression</td></tr><tr><td align="center" valign="middle" >β-actin-b<sup>*</sup></td><td align="center" valign="middle" >TCRAACATDATYTGNGTCAT</td><td align="center" valign="middle" >tissue-specific expression</td></tr></tbody></table></table-wrap><p>Note: <sup>*</sup>Degenerate primers.</p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Schematic representation of the cDNA structure of AkChi and location of the primers. Arrowheads indicate the primers, and lines between the arrowheads indicate the amplified cDNA fragments</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/5-7301168x6.png"/></fig><p>94˚C for 1 min, followed by 30 cycles of 94˚C for 30 s, 49˚C for 30 s, and 72˚C for 30 s.</p><p>The nucleotide sequences of cDNA fragments containing a full-length open reading frame (ORF) were confirmed by PCR using specific primers (P10 and P13 for AkChi; <xref ref-type="table" rid="table1">Table 1</xref>) and Platinum Pfx DNA Polymerase (Invitrogen, Carlsbad, CA).</p></sec><sec id="s2_3"><title>2.3. Nucleotide Sequence Analysis</title><p>The RT-PCR, 3’ RACE, and 5’ RACE amplification products, and the full-length amplification products were subcloned into pGEM-T Easy Vector (Promega, Madison, WI), according to the manufacturer’s instructions. Sequences were determined on an ABI PRISM 3130 genetic analyzer (Applied Biosystems, Foster City, CA) using a Big Dye Terminator v3.1 cycle sequencing kit (Applied Biosystems).</p></sec><sec id="s2_4"><title>2.4. Amino Acid Sequence of the Peptide of the Purified Chitinase from the Ovotestis of A. kurodai</title><p>A chitinase from the ovotestis of A. kurodai was purified as described [<xref ref-type="bibr" rid="scirp.63276-ref16">16</xref>] . The purified chitinase was subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and stained with AE-1360 EzStain Silver (ATTO, Tokyo). A gel slice was cut into small pieces and destained by destaining solution (15 mM K<sub>3</sub>[Fe(CN)<sub>6</sub>], 50 mM Na<sub>2</sub>S<sub>2</sub>O<sub>3</sub>). Destained gel pieces were trypsinized as described in the manual of In-Gel Tryptic Digestion Kit manual (Thermo Scientific, Waltham, MA). The peptide mixtures thus obtained were subjected to a nano-scale liquid chromatography-electrospray ionization-tandem mass spectrometry (nanoLC- ESI-MS/MS) analysis using a Q Exactive mass spectrometer (Thermo Scientific) equipped with a captive spray ionization source (Michrom Bioresources, Auburn, CA) and an Advance UHPLC System (Michrom Bioresources).</p></sec><sec id="s2_5"><title>2.5. Tissue-Specific Expression of AkChi</title><p>Total RNA was prepared from the ovotestis, egg, skin, gill, crop, anterior gizzard, and posterior gizzard as described in the cloning methods section (2.2) above. First-strand cDNA was pre-cloned from the RNA isolated from each tissue and egg as described in the RT-PCR section (2.2) above. For tissue-specific expression, we designed primers specific to AkChi (P14 and P15, respectively; <xref ref-type="table" rid="table1">Table 1</xref>) based on the detected sequences. AkChi was amplified using the first-strand cDNA as template and the primer pairs P14 and P15 (<xref ref-type="table" rid="table1">Table 1</xref>). The PCR parameters were as follows: 94˚C for 1 min, followed by 35 cycles of 94˚C for 30 s, 62˚C for 30 s, and 72˚C for 30 s. To determine the amount of total RNA in each tissue, we amplified β-actin mRNA fragments using specific primer pairs (<xref ref-type="table" rid="table1">Table 1</xref>).</p></sec><sec id="s2_6"><title>2.6. Phylogenetic Tree Analysis of AkChi</title><p>In order to classify the chitinase from the ovotestis of A. kurodai among the GH family 18 chitinases, we constructed a phylogenetic tree based on the enzyme precursor sequences by the neighbor-joining method, using the ClustalW program (http://www.genome.jp/tools/clustalw/). A bacterial chitinase (GenBank: X03657) was used as the out group.</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><sec id="s3_1"><title>3.1. Cloning of A. kurodai Chitinase cDNA</title><p>The structure of AkChi and the location of primer sequences are schematically represented in <xref ref-type="fig" rid="fig1">Figure 1</xref>. The internal sequence of the cDNA of A. kurodai ovotestis chitinase was amplified by RT-PCR using degenerate primers (from P1 to P6, respectively; <xref ref-type="table" rid="table1">Table 1</xref>); an amplified product of approx. 400 bp was obtained. The product was sequenced, and 86% homology with the acidic mammalian chitinase of A. californica was confirmed (accession no. XM_005112601). Because the sequence was part of ovotestis chitinase cDNA from A. kurodai, we used it to design gene-specific primers for 3’ and 5’ RACE (from P7 to P12; <xref ref-type="table" rid="table1">Table 1</xref>). An amplified product of approx. 430 bp was obtained by 3’ RACE, and its sequence contained a stop codon. An amplified product of approx. 520 bp was also obtained by 5’ RACE; its sequence contained a start codon. Based on these results, we designed full-length primers (P10 and P13; <xref ref-type="table" rid="table1">Table 1</xref>) to incorporate these start and stop codons. cDNA was amplified using the primers and the amplified product was sequenced.</p><p>The full-length cDNA of A. kurodai ovotestis chitinase (AkChi) was 1352 bp in length and contained an ORF of 1263 bp encoding 421 amino acids (<xref ref-type="fig" rid="fig2">Figure 2</xref>). The size of ORF of AkChi was smaller than it from H. cumingii [<xref ref-type="bibr" rid="scirp.63276-ref14">14</xref>] , 1962 bp encoding 653 amino acids. A poly-A sequence in eukaryotes was detected at the 3’ end of AkChi. AkChi, which encodes A. kurodai ovotestis chitinase, has been registered in the database of the DNA Data Bank of Japan (DDBJ) (accession no. LC085435). We compared the deduced amino acid sequence of AkChi with that of other organisms using BLAST, and the highest homology, 83%, was confirmed with the acidic mammalian chitinase of A. californica (accession no. XM_005112601). <xref ref-type="fig" rid="fig3">Figure 3</xref> compares amino acid</p><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> cDNA and deduced amino acid sequences of AkChi. Underlined sequences show matching with the peptide fragments of the purified and tripsinized enzyme (coverage: 35.39%, 119 residues)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/5-7301168x7.png"/></fig><p>sequences from AkChi and some other known molluscan chitinases (A. californica, H. cumingii, C. gigas, E. scolopes, and S. esculenta). The deduced amino acid sequence of AkChi was shown to have a structure of the GH family 18 chitinase, with an N-terminal signal peptide and a GH 18 catalytic domain. The catalytic domain also contained an active site that is a conserved sequence of GH family 18 chitinases (<xref ref-type="fig" rid="fig3">Figure 3</xref>). Though the chitinase of H. cumingii [<xref ref-type="bibr" rid="scirp.63276-ref14">14</xref>] and E. scolopes [<xref ref-type="bibr" rid="scirp.63276-ref15">15</xref>] had two chitin binding domains (CBDs) and the chitinase of S. esculenta had one CBD, AkChi lacked a CBD. It was reported that fish chitinases have one CBD [<xref ref-type="bibr" rid="scirp.63276-ref8">8</xref>] . This result suggests that the structure of molluscan chitinase is diverse compared to the fish chitinases.</p></sec><sec id="s3_2"><title>3.2. Amino Acid Sequence of the Chitinase</title><p>We analyzed the sequences of the peptide fragments obtained by the tryptic treatment of the purified chitinase from the ovotestis of A. kurodai [<xref ref-type="bibr" rid="scirp.63276-ref16">16</xref>] were analyzed and compared them to the deduced amino acid sequence of AkChi. The obtained sequences from peptide fragments were consistent with the deduced amino acid sequence of AkChi (coverage: 35.39%, 119 residues) (<xref ref-type="fig" rid="fig2">Figure 2</xref>). This result suggests that AkChi is a gene coding the purified enzyme. In addition, trypsin is cut the C-terminal side of lysine and arginine. In this result, it was confirmed that the trypsin is working properly in the all of cleavage site.</p></sec><sec id="s3_3"><title>3.3. Tissue-Specific Expression of AkChi</title><p>We investigated the tissue-specific expression of AkChi in A. kurodai by RT-PCR using the housekeeping β-ac- tin gene as a control (<xref ref-type="fig" rid="fig4">Figure 4</xref>). It is reported that fish express chitinase to the digestive organs for digestion of chitin from food [<xref ref-type="bibr" rid="scirp.63276-ref17">17</xref>] . The expression profile results indicated that AkChi was present only in the ovotestis. We previously detected chitinase activity in the ovotestis and egg from A. kurodai [<xref ref-type="bibr" rid="scirp.63276-ref16">16</xref>] , whereas lysozyme activity (antibacterial enzyme activity) was not detected in any of the organs [<xref ref-type="bibr" rid="scirp.63276-ref16">16</xref>] . A. kurodai has to prey on seaweed.</p><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Multiple alignment of duduced amino acid sequences of A. kurodai chitinase (AkChi) with Aplysia californica acidic mammalian chitinase (AcAMCase), Hyriopsis cumingii chitinase-3 (HcChi-3), Crassostrea gigas Chit3 protein A (CgChi3), Euprymna scolopes chitotriosidase (EsChito), and Sepia esculenta chitinase (SeChi). GenBank accession nos.: AcAMCase, XM_005112601; HcChi-3, JN582038; CgChi3, AJ971239; EsChito, KF015222; SeChi, AB986212. Matched sequences are shown in black</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/5-7301168x8.png"/></fig><fig id="fig4"  position="float"><label><xref ref-type="fig" rid="fig4">Figure 4</xref></label><caption><title> Expression profiles of AkChi and β-actin mRNA in tissue using RT-PCR. M, markers; 1, ovotestis; 2, egg; 3, skin; 4, gill; 5, buccal mass; 6, crop; 7, anterior gizzard; 8, posterior gizzard</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/5-7301168x9.png"/></fig><p>Thus, A. kurodai is not necessary chitinase in digestion and attack of food as squid [<xref ref-type="bibr" rid="scirp.63276-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.63276-ref11">11</xref>] and octopus [<xref ref-type="bibr" rid="scirp.63276-ref12">12</xref>] , respectively. In addition, there is not necessary to shell formation because it does not even have shells. These results suggest that the role of this chitinase is as a defense against nematodes and fungus which have chitin in the body wall as a structural component.</p></sec><sec id="s3_4"><title>3.4. Phylogenetic Tree Analysis of AkChi</title><p>We performed a phylogenetic tree analysis of GH family 18 chitinases and AkChi (<xref ref-type="fig" rid="fig5">Figure 5</xref>). Acidic mamma-</p><fig-group id="fig5"><label><xref ref-type="fig" rid="fig5">Figure 5</xref></label><caption><title> Phylogenetic tree analysis of chitinase amino acid sequence by the neighbor-joining method of the program Clustal W. A bacterial chitinase, Serratia marcescens chitinase, was used as the out group. The scale bar indicates the substitution rate per residue. The arrow shows AkChi obtained in the present study. * Molluscan chitinase without a CBD; ** Molluscan chitinase with one CBD; *** Molluscan chitinase with two CBDs.</title></caption><fig id ="fig5_1"><label></label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/5-7301168x10.png"/></fig><fig id ="fig5_2"><label></label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="Images/Table_Tmp.jpg"/></fig></fig-group><p>lian chitinases (AMCases) have been found in the stomach of mammals. Two chitinase groups with different structures and activity toward short substrates, AFCase-1 and AFCase-2, have been found in the stomach of fish [<xref ref-type="bibr" rid="scirp.63276-ref8">8</xref>] . Crustacean showed a chitinase group [<xref ref-type="bibr" rid="scirp.63276-ref18">18</xref>] . In contrast, molluscan chitinases did not show clear chitinase groups. The reason for this might be the differences in the chitinase domain structure that are due to the presence or absence of a CBD and the number of CBDs. We previously detected chitinase activity in the ovotestis and oviduct from the Walking sea hare Aplysia juliana [<xref ref-type="bibr" rid="scirp.63276-ref16">16</xref>] . If the success in cloning the chitinase from A. juliana, it will be conceivable to form a group of sea hare chitinase.</p></sec></sec><sec id="s4"><title>4. Conclusion</title><p>The cDNA of the ovotestis chitinase obtained from A. kurodai contained a 1263 bp open reading frame with a coding potential for 421 amino acid peptides. AkChi had the structural motifs of GH family 18 chitinase, but it did not have chitin binding domain. This study is the first report of the cloning of chitinase from the ovotestis of a sea hare.</p></sec><sec id="s5"><title>Acknowledgements</title><p>This work was supported in part by a Grant-in-Aid for Scientific Research (C) (no. 25450309) and a College of Bioresource Science, Nihon-University Grant (2015).</p></sec><sec id="s6"><title>Cite this paper</title><p>GakuMatsunaga,SyuujiKarasuda,RyoNishino,HidetoFukushima,MasahiroMatsumiya, (2016) Molecular Cloning of a Chitinase Gene from the Ovotestis of Kuroda’s Sea Hare Aplysia kurodai. Advances in Bioscience and Biotechnology,07,38-46. doi: 10.4236/abb.2016.71005</p></sec><sec id="s7"><title>Abbreviations</title><p>RT-PCR: reverse transcription-polymerase chain reaction;</p><p>RACE: rapid amplification of cDNA ends;</p><p>GH: glycoside hydrolase;</p><p>AFCase-1: acidic fish chitinase-1;</p><p>AFCase-2: acidic fish chitinase-2;</p><p>CBD: chitin binding domain;</p><p>K<sub>3</sub>[Fe(CN)<sub>6</sub>]: potassium ferricyanide;</p><p>Na<sub>2</sub>S<sub>2</sub>O<sub>3</sub>: sodium thiosulfate.</p></sec></body><back><ref-list><title>References</title><ref id="scirp.63276-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Khandeparker, L., Gaonkar, C.C. and Desai, D.V. (2013) Degradation of Barnacle Nauplii: Implications to Chitin Regulation in the Marine Environment. Biologia, 68, 696-706. http://dx.doi.org/10.2478/s11756-013-0202-6</mixed-citation></ref><ref id="scirp.63276-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Arbia, W., Arbia, L., Adour, L. and Amrane, A. (2013) Chitin Extraction from Crustacean Shells Using Biological Methods—A Review. Food Technology and Biotechnology, 51, 12-25.</mixed-citation></ref><ref id="scirp.63276-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Kramer, K.J. and Koga, D. (1986) Insect Chitin: Physical State, Synthesis, Degradation and Metabolic Regulation. Insect Biochemistry, 16, 851-877. http://dx.doi.org/10.1016/0020-1790(86)90059-4</mixed-citation></ref><ref id="scirp.63276-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Umemoto, N., Ohnuma, T., Mizuhara, M., Sato, H., Skriver, K. and Fukamizo, T. (2013) Introduction of a Tryptophan Side Chain into Subsite +1 Enhances Transglycosylation Activity of a GH-18 Chitinase from Arabidopsis thaliana, AtChiC. Glycobiology, 23, 81-90. http://dx.doi.org/10.1093/glycob/cws125</mixed-citation></ref><ref id="scirp.63276-ref5"><label>5</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Gooday</surname><given-names> G.W. </given-names></name>,<etal>et al</etal>. (<year>1999</year>)<article-title>Aggressive and Defensive Roles for Chitinases, Chitin and Chitinases</article-title><source> Cellular and Molecular Life Sciences</source><volume> 87</volume>,<fpage> 157</fpage>-<lpage>169</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.63276-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Henrissat, B. (1991) A Classification of Glycosyl Hydrolases Based on Amino Acid Sequence Similarities. Biochemical Journal, 280, 309-316. http://dx.doi.org/10.1042/bj2800309</mixed-citation></ref><ref id="scirp.63276-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Ikeda, M., Miyauchi, K. and Matsumiya M. (2012) Purification and Characterization of a 56 kDa Chitinase Isozyme (PaChiB) from the Stomach of the Silver Croaker, Pennahia argentatus. Bioscience, Biotechnology, and Biochemistry, 76, 971-979. http://dx.doi.org/10.1271/bbb.110989</mixed-citation></ref><ref id="scirp.63276-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Ikeda, M., Kondo, Y. and Matsumiya, M. (2013) Purification, Characterization, and Molecular Cloning of Chitinases from the Stomach of the Threeline Grunt Parapristipoma trilineatum. Process Biochemistry, 48, 1324-1334. http://dx.doi.org/10.1016/j.procbio.2013.06.016</mixed-citation></ref><ref id="scirp.63276-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Laribi-Habchi, H., Dziril, M., Badis, A., Mouhoub, S. and Mameri, N. (2012) Purification and Characterization of a Highly Thermostable Chitinase from the Stomach of the Red Scorpionfish Scorpaena scrofa with Bioinsecticidal Activity toward Cowpea Weevil Callosobruchus maculates (Coleoptera: bruchidae). Bioscience, Biotechnology, and Biochemistry, 76, 1733-1740. http://dx.doi.org/10.1271/bbb.120344</mixed-citation></ref><ref id="scirp.63276-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Nishino, R., Suyama, A., Ikeda, M., Kakizaki, H. and Matsumiya, M. (2014) Purification and Characterization of a Liver Chitinase from Golden Cuttlefish, Sepia esculenta. Journal of Chitin and Chitosan Science, 2, 238-243. http://dx.doi.org/10.1166/jcc.2014.1065</mixed-citation></ref><ref id="scirp.63276-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Matsumiya, M., Miyauchi, K. and Mochizuki, A. (2002) Characterization of 38 kDa and 42 kDa Chitinase Isozymes from the Liver of Japanese Common Squid Todarodes pacificus. Fisheries Science, 68, 603-609. http://dx.doi.org/10.1046/j.1444-2906.2002.00467.x</mixed-citation></ref><ref id="scirp.63276-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Ogino, T., Tabata, T., Ikeda, M., Kakizaki, H. and Matsumiya, M. (2014) Purification of a Chitinase from the Posterior Salivary Gland of Common Octopus Octopus vulgaris and Its Properties. Journal of Chitin and Chitosan Science, 2, 135-142. http://dx.doi.org/10.1166/jcc.2014.1049</mixed-citation></ref><ref id="scirp.63276-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, G., Fang, X., Guo, X., Li, L., Luo, R., Xu, F., Yang, P., Zhang, L., Wang, X., Qi, H., Xiong, Z., Que, H., Xie, Y., Holland, P.W.H., Paps, J., Zhu, Y., Wu, F., Chen, Y., Wang, J., Peng, C., Meng, J., Yang, L., Liu, J., Wen, B., Zhang, N., Huang, Z., Zhu, Q., Feng, Y., Mount, A., Hedgecock, D., Xu, Z., Liu, Y., Domazet-Loso, T., Du, Y., Sun, X., Zhang, S., Liu, B., Cheng, P., Jiang, X., Li, J., Fan, D., Wang, W., Fu, W., Wang, T., Wang, B., Zhang, J., Peng, Z., Li, Y., Li, N., Wang, J., Chen, M., He, Y., Tan, F., Song, X., Zheng, Q., Huang, R., Yang, H., Du, X., Chen, L., Yang, M., Gaffney, P.M., Wang, S., Luo, L., She, Z., Ming, Y., Huang, W., Zhang, S., Huang, B., Zhang, Y., Qu, T., Ni, P., Miao, G., Wang, J., Wang, Q., Steinberg, C.E.W., Wang, H., Li, N., Qian, L., Zhang, G., Li, Y., Yang, H., Liu, X., Wang, J., Yin, Y. and Wang, J. (2012) The Oyster Genome Reveals Stress Adaptation and Complexity of Shell Formation. Nature, 490, 49-54. http://dx.doi.org/10.1038/nature11413</mixed-citation></ref><ref id="scirp.63276-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Wang, G.-L., Xu, B., Bai, Z.-Y. and Li, J.-L. (2012) Two Chitin Metabolic Enzyme Genes from Hyriopsis cumingii: Cloning, Characterization, and Potential Functions. Genetics and Molecular Research, 11, 4539-4551. http://dx.doi.org/10.4238/2012.October.15.4</mixed-citation></ref><ref id="scirp.63276-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Kremer, N., Philipp, E.E.R., Carpentier, MC., Brennan, C.A., Kraemer, L., Altura, M.A., Augustin, R., H&amp;aumlsler, R., Heath-Heckman, E.A.C., Peyer, S.M., Schwartzman, J., Rader, B., Ruby, E.G., Rosenstiel, P. and McFall-Ngai, M.J. (2013) Initial Symbiont Contact Orchestrates Host-Organ-Wide Transcriptional Changes that Prime Tissue Colonization. Cell Host &amp; Microbe, 14, 183-194. http://dx.doi.org/10.1016/j.chom.2013.07.006</mixed-citation></ref><ref id="scirp.63276-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Karasuda, S., Ikeda, M., Miyauchi, K. and Matsumiya, M. (2011) Existence and Physiological Role of Chitinase in the Gonad of Two Species of Sea Hare, Kuroda’s Sea Hare Aplysia kurodai and Walking Sea Hare Aplysia Juliana. Proceedings of the 9th Asia-Pacific Chitin and Chitosan Symposium, Vietnum, 3-6 August 2011, 169-172.</mixed-citation></ref><ref id="scirp.63276-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Kakizaki, H., Ikeda, M., Fukushima, H. and Masahiro, M. (2015) Distribution of Chitinolytic Enzymes in the Organs and cDNA Cloning of Chitinase Isozymes from the Stomach of Two Species of Fish, Chub Mackerel (Scomber japonicus) and Silver Croaker (Pennahia argentata). Open Journal of Marine Sciences, 5, 398-411. http://dx.doi.org/10.4236/ojms.2015.54032</mixed-citation></ref><ref id="scirp.63276-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Fujitani, N., Hasegawa, H., Kakizaki, H., Ikeda, M. and Masahiro, M. (2014) Molecular Cloning of Multiple Chitinase Genes in Swimming Crab Portunus trituberculatus. Journal of Chitin and Chitosan Science, 2, 149-156. http://dx.doi.org/10.1166/jcc.2014.1046</mixed-citation></ref></ref-list></back></article>