<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2016.71016</article-id><article-id pub-id-type="publisher-id">AJPS-63142</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Endophytic Fungi Associated with a Holoparasitic Plant, &lt;i&gt;Balanophora japonica&lt;/i&gt; (Balanophoraceae)
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>ideko</surname><given-names>Ikeda</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Tatsuya</surname><given-names>Fukuda</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jun</surname><given-names>Yokoyama</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff2"><addr-line>Department of Forestry, Faculty of Agriculture, Kochi University, Nankoku, Japan</addr-line></aff><aff id="aff1"><addr-line>Graduate School of Science and Technology, Yamagata University, Yamagata, Japan</addr-line></aff><aff id="aff3"><addr-line>Department of Biology, Faculty of Science, Yamagata University, Yamagata, Japan</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>jyokoyam@sci.kj.yamagata-u.ac.jp(JY)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>04</day><month>01</month><year>2016</year></pub-date><volume>07</volume><issue>01</issue><fpage>152</fpage><lpage>158</lpage><history><date date-type="received"><day>16</day>	<month>December</month>	<year>2015</year></date><date date-type="rev-recd"><day>accepted</day>	<month>25</month>	<year>January</year>	</date><date date-type="accepted"><day>28</day>	<month>January</month>	<year>2016</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Holoparasitism is a special life cycle of flowering plants. All carbon resources are provided by photosynthetic host plants. A recent study revealed the presence of endophytic fungi in holoparasitic plants, but their ecological and evolutionary roles are still unknown. In this study, we examined endophytic fungi isolated from the holoparasitic plant 
  Balanophora japonica (Balanophoraceae), collected from Kochi, Shikoku in western Japan. We isolated 23 fungal strains on inflorescences and tubers from three 
  B. japonica plants at two locations and on one sample of the host plant (
  Symplocos lancifolia, Symplocaceae). Predominant isolates were 
  Trichoderma-Hypocrea, Penicillium and 
  Phialemonium. The first group was also predominant in the host plant. Fungal composition revealed in this study differed from the composition on 
  B. harlandii or other root holoparasites with endophytic fungal (
  Rafflesia cantleyi) data. Those differences might be caused by various factors, including growth habits, location, phylogenetic position or host-parasite relationship.
 
</p></abstract><kwd-group><kwd>Balanophoraceae</kwd><kwd> &lt;i&gt;Balanophora japonica&lt;/i&gt;</kwd><kwd> Endophytic Fungi</kwd><kwd> Holoparasitic Plant</kwd><kwd> &lt;i&gt;Symplocos lancifolia&lt;/i&gt;</kwd><kwd> Western Japan</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Endophytic fungi are microbes that reside in plants, but without any visible symptoms on the host plant [<xref ref-type="bibr" rid="scirp.63142-ref1">1</xref>] -[<xref ref-type="bibr" rid="scirp.63142-ref3">3</xref>] . Ecological features of these fungi are still largely unknown, but some confer functions that positively affect host plants. These functions include stimulation of plant growth [<xref ref-type="bibr" rid="scirp.63142-ref4">4</xref>] -[<xref ref-type="bibr" rid="scirp.63142-ref6">6</xref>] , resistance to environmental stress (e.g., drought or edaphic stresses, such as heavy metal ions; [<xref ref-type="bibr" rid="scirp.63142-ref7">7</xref>] -[<xref ref-type="bibr" rid="scirp.63142-ref9">9</xref>] ) and defense mechanisms against herbivores or diseases [<xref ref-type="bibr" rid="scirp.63142-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.63142-ref11">11</xref>] . Thus, at least some of the endophytic fungi play important roles in the evolution of plants and plant-fungus interactions, and the roles could be more important than previously known. We need more insight into the interactions of endophytic fungi and their host plants to fully understand their evolutionary roles.</p><p>Holoparasitism is a special nutritional feature of flowering plants. Holoparasitic plants are echlorophyllous and all substrates (including photosynthesites as carbon sources) necessary for growth and reproduction are drawn from the host plants, with a direct plant-to-plant connection [<xref ref-type="bibr" rid="scirp.63142-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.63142-ref13">13</xref>] . As for photosynthetic flowering plants, holoparasitic plants have endophytic fungi, although reports are limited (Rafflesia [<xref ref-type="bibr" rid="scirp.63142-ref14">14</xref>] ; Cuscuta [<xref ref-type="bibr" rid="scirp.63142-ref15">15</xref>] ). With the addition of endophytic fungi, cost-benefit relationships in those tripartite interactions are quite complicated. If the holoparasitic plants have their own symbiotic endophytes, the hosts also provide carbon resources to the fungi and are parasitized by both plants and fungi. Symbiotic endophytes of holoparasitic plants also might support parasitization of host plants. Thus, to uncover the ecological and evolutionary roles, studies focusing on species composition of endophytic fungi in various holoparasitic plants are needed.</p><p>Balanophoraceae (Santalales) is a large family of holoparasitic plants, comprising about 17 genera and 40 species distributed mainly in tropical regions worldwide [<xref ref-type="bibr" rid="scirp.63142-ref16">16</xref>] . An updated description of the taxon was presented previously [<xref ref-type="bibr" rid="scirp.63142-ref17">17</xref>] . All members of this family fully depend on carbon resources from woody plants growing around them. Although Balanophoraceae is a major family of holoparasitic plants, there is little information about their endophytic fungi. There is only one report of B. harlandii Hook.f. in China [<xref ref-type="bibr" rid="scirp.63142-ref18">18</xref>] . The main objective of that study was to isolate from a medicinally useful plant the fungi effective against bacteria. Not all fungi isolated were examined and no comparisons were made with host plants.</p><p>In this study, we isolated and examined endophytic fungi from Balanophora japonica Makino (<xref ref-type="fig" rid="fig1">Figure 1</xref>). Balanophora is the largest genus in the Balanophoraceae family (15 spp.), distributed mainly in the Old World tropics [<xref ref-type="bibr" rid="scirp.63142-ref19">19</xref>] . Balanophora japonica is the most common of the five species of Balanophora in Japan. It is widely distributed in the western part of the Japanese archipelago (including the Ryukyus) and Taiwan [<xref ref-type="bibr" rid="scirp.63142-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.63142-ref20">20</xref>] . Thus, this species is appropriate for the first step in investigating the composition of endophytic fungi and their ecological and evolutionary roles in Balanophoraceae.</p><fig-group id="fig1"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Appearance of Balanophora japonica. Left: A plant in Sakawa-machi. Right: A plant in Kami-shi, a host root can be seen under the tubers of the plant.</title></caption><fig id ="fig1_1"><label></label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/16-2602505x7.png"/></fig><fig id ="fig1_2"><label></label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/16-2602505x8.png"/></fig></fig-group></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Plant Material</title><p>Balanophora japonica only appears above ground in late autumn, when it flowers. Balanophora japonica samples for subsequent fungal isolation were collected in November 2012 and 2013 from the understory of Castanopsis forests in Sokabegawa, Tosayamada, Kami-shi (N33˚39’, E133˚39’, 370 m.alt: 2012) and the Nagatani gorge, Sakawa-machi, Takaoka-gun (N33˚29’, E133˚13’, 370 m.alt: 2013), Kochi Prefecture, Shikoku District, in western Japan. Plants collected from the field were stored in a refrigerator until fungal isolation. For the 2012 samples, we also collected roots from a host plant and stored them in the same manner.</p></sec><sec id="s2_2"><title>2.2. Fungal Isolation</title><p>After carefully removing soil clumps and plant debris by washing with tap water, the plants were sterilized with a mixed solution of sodium hypochlorite (2.5% effective chloride) and Tween X-100 (1%) for 5 min. The plants were then washed three times in sterilized water, divided into inflorescences and tubers and cut into pieces (2-3 mm). The pieces were placed on MMN-agar medium with ampicillin (100 mg∙l<sup>−</sup><sup>1</sup>) and incubated at 18˚C until fungal growth was observed. Fungal hyphae were transferred to new PDA plates and incubated at 18˚C for subsequent molecular characterization.</p></sec><sec id="s2_3"><title>2.3. DNA Isolation, PCR Amplification, Sequencing and Molecular Identification</title><p>Total DNA was isolated from 200 - 300 mg of fresh hyphae collected from plates using the DNeasy Plant Mini Kit (Qiagen) according to the manufacturer’s protocol. DNA was also isolated from silica-gel-dried roots of host plants. The primers ITS1 and ITS4 (<xref ref-type="table" rid="table1">Table 1</xref>) were used to amplify internal transcribed spacers (ITS) of nuclear rDNA regions [<xref ref-type="bibr" rid="scirp.63142-ref21">21</xref>] . The PCR reaction was performed using an ExTaq DNA polymerase (TaKaRa) and DNA was amplified after incubation at 95˚C for 3 min, with 35 cycles of incubation at 95˚C for 0.5 min, 51˚C for 0.5 min and 72˚C for 1.5 min, with a final extension at 72˚C for 5 min. After amplification, reaction mixtures were subjected to electrophoresis in 1% agarose gels for separation of specific amplified products. Cycle sequencing reactions were performed with approximately 80 to 100 ng of purified PCR product and a BigDye Terminator Cycle Sequencing Kit v.3.1 (Applied Biosystems, USA), according to the manufacturer’s instructions. Sequences were determined with an automated DNA sequencer (PRISM310; Applied Biosystems). A BLAST search [<xref ref-type="bibr" rid="scirp.63142-ref22">22</xref>] was conducted to identify the fungal accessions most closely related to the sequences obtained in this study. We used the DNA Data Bank of Japan (DDBJ: http://www.ddbj.nig.ac.jp) for these searches.</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><p>We isolated a total of 23 fungal strains from three individuals (one from Kami and two from Sakawa; <xref ref-type="table" rid="table2">Table 2</xref>). The most frequently isolated genus from B. japonica was Trichoderma-Hypocrea (8 of 23, 34.8%), but this genus was not isolated at Sakawa. The next frequently isolated genus was Penicillium (6 of 23, 26.1%), and all samples used in this study had the fungal genus as endophytes. Phialemonium (five strains) was isolated only from Sakawa individuals. Additional genera were Podospora (two strains), Mortierella and Bionectia (one strain each). A total of 13 strains were isolated from inflorescences and the largest number (5 of 6) of Penicillium strains and all Phialemonium were isolated from inflorescences. On the other hand, 10 residual strains were isolated from tubers, and six of the eight Trichoderma-Hypocrea strains and all Podospora strains were isolated from tubers.</p><p>We also isolated eight strains from a host plant of a Kami sample (identified as Symplocos lancifolia Siebold et Zucc.; <xref ref-type="table" rid="table1">Table 1</xref>). Similar to the parasite, Trichoderma-Hypocrea was the most common fungus isolated (3 of 8;</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> List of primers used in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Sequence (5’ to 3’)</th><th align="center" valign="middle" >Reference</th></tr></thead><tr><td align="center" valign="middle" >ITS1</td><td align="center" valign="middle" >TCCGTAGGTGAACCTGCGG</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.63142-ref21">21</xref>]</td></tr><tr><td align="center" valign="middle" >ITS4</td><td align="center" valign="middle" >TCCTCCGCTTATTGATATGC</td><td align="center" valign="middle" >[<xref ref-type="bibr" rid="scirp.63142-ref21">21</xref>]</td></tr></tbody></table></table-wrap><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> List of endophytic fungi isolated from B. japonica and its host plant</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Strain ID</th><th align="center" valign="middle" >Accession of the highest score</th><th align="center" valign="middle" >Accession No.</th><th align="center" valign="middle" >Identity</th><th align="center" valign="middle" >Identification at generic level</th></tr></thead><tr><td align="center" valign="middle" >T001-F1-1</td><td align="center" valign="middle" >Penicillium thomii FRR 2077</td><td align="center" valign="middle" >NR_077159</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Penicillium</td></tr><tr><td align="center" valign="middle" >T001-F1-2A</td><td align="center" valign="middle" >Penicillium thomii FRR 2077</td><td align="center" valign="middle" >NR_077159</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Penicillium</td></tr><tr><td align="center" valign="middle" >T001-F1-3</td><td align="center" valign="middle" >Penicillium sp. 3 JJK-2011</td><td align="center" valign="middle" >HM469421</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Penicillium</td></tr><tr><td align="center" valign="middle" >T001-F2-1</td><td align="center" valign="middle" >Penicillium sp. 3 JJK-2011</td><td align="center" valign="middle" >HM469421</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Penicillium</td></tr><tr><td align="center" valign="middle" >T001-F2-3</td><td align="center" valign="middle" >Penicillium sp. 11MA10</td><td align="center" valign="middle" >JX270445</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Penicillium</td></tr><tr><td align="center" valign="middle" >T001-R1-1A</td><td align="center" valign="middle" >Podospora sp. XSD-39</td><td align="center" valign="middle" >EU273519</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Podospora</td></tr><tr><td align="center" valign="middle" >T001-R1-1B</td><td align="center" valign="middle" >Podospora sp. XSD-39</td><td align="center" valign="middle" >EU273519</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Podospora</td></tr><tr><td align="center" valign="middle" >T001-R2-1</td><td align="center" valign="middle" >Trichoderma spirale DAOM 183974</td><td align="center" valign="middle" >NR_077177</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Trichoderma-Hypocrea</td></tr><tr><td align="center" valign="middle" >T001-R2-2</td><td align="center" valign="middle" >Trichoderma spirale isolate F28</td><td align="center" valign="middle" >JF439515</td><td align="center" valign="middle" >100%</td><td align="center" valign="middle" >Trichoderma-Hypocrea</td></tr><tr><td align="center" valign="middle" >T001-F2-4</td><td align="center" valign="middle" >Hypocrea lixii isolate FZ1302</td><td align="center" valign="middle" >HQ259308</td><td align="center" valign="middle" >100%</td><td align="center" valign="middle" >Trichoderma-Hypocrea</td></tr><tr><td align="center" valign="middle" >T003-F1-1</td><td align="center" valign="middle" >Ascomycota sp. UNEX FECRGA 2012E270</td><td align="center" valign="middle" >KP899441</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Phialemonium</td></tr><tr><td align="center" valign="middle" >T003-F2-1</td><td align="center" valign="middle" >Bionectria ochroleuca isolate XSD-89</td><td align="center" valign="middle" >EU326186</td><td align="center" valign="middle" >100%</td><td align="center" valign="middle" >Bionectria</td></tr><tr><td align="center" valign="middle" >T003-F2-2</td><td align="center" valign="middle" >Ascomycota sp. UNEX FECRGA 2012E270</td><td align="center" valign="middle" >KP899441</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Phialemonium</td></tr><tr><td align="center" valign="middle" >T003-R2-2</td><td align="center" valign="middle" >Penicillium sp. F03</td><td align="center" valign="middle" >JF439497</td><td align="center" valign="middle" >100%</td><td align="center" valign="middle" >Penicillium</td></tr><tr><td align="center" valign="middle" >T004-F1-1</td><td align="center" valign="middle" >Ascomycota sp. UNEX FECRGA 2012E270</td><td align="center" valign="middle" >KP899441</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Phialemonium</td></tr><tr><td align="center" valign="middle" >T004-F1-2</td><td align="center" valign="middle" >Hypocrea lixii isolate FZ1302</td><td align="center" valign="middle" >HQ259308</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Trichoderma-Hypocrea</td></tr><tr><td align="center" valign="middle" >T004-F2-1</td><td align="center" valign="middle" >Ascomycota sp. UNEX FECRGA 2012E270</td><td align="center" valign="middle" >KP899441</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Phialemonium</td></tr><tr><td align="center" valign="middle" >T004-F2-2</td><td align="center" valign="middle" >Ascomycota sp. UNEX FECRGA 2012E270</td><td align="center" valign="middle" >KP899441</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Phialemonium</td></tr><tr><td align="center" valign="middle" >T004-R2-1</td><td align="center" valign="middle" >Uncultured fungus clone HI38</td><td align="center" valign="middle" >JX457015</td><td align="center" valign="middle" >100%</td><td align="center" valign="middle" >Trichoderma-Hypocrea</td></tr><tr><td align="center" valign="middle" >T004-R2-2</td><td align="center" valign="middle" >Uncultured fungus clone HI38</td><td align="center" valign="middle" >JX457015</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Trichoderma-Hypocrea</td></tr><tr><td align="center" valign="middle" >T004-R1-1</td><td align="center" valign="middle" >Trichoderma tawa strain IPBCC07_545</td><td align="center" valign="middle" >KC847191</td><td align="center" valign="middle" >100%</td><td align="center" valign="middle" >Trichoderma-Hypocrea</td></tr><tr><td align="center" valign="middle" >T004-R1-2</td><td align="center" valign="middle" >Trichoderma sp. TR094</td><td align="center" valign="middle" >HQ608118</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Trichoderma-Hypocrea</td></tr><tr><td align="center" valign="middle" >T003-R2-1</td><td align="center" valign="middle" >Mortierella sp. L-4</td><td align="center" valign="middle" >KJ735027</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Mortierella</td></tr><tr><td align="center" valign="middle" >HT002-R1-1A</td><td align="center" valign="middle" >Penicillium sp. CL</td><td align="center" valign="middle" >KM520352</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Penicillium</td></tr><tr><td align="center" valign="middle" >HT002-R1-1B</td><td align="center" valign="middle" >Umbelopsis ramanniana isolate TR145</td><td align="center" valign="middle" >HQ608138</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Umbelopsis</td></tr><tr><td align="center" valign="middle" >HT002-R1-2</td><td align="center" valign="middle" >Penicillium simplicissimum voucher CC 19-02</td><td align="center" valign="middle" >KF359583</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Penicillium</td></tr><tr><td align="center" valign="middle" >HT002-R1-3</td><td align="center" valign="middle" >Podospora sp. XSD-39</td><td align="center" valign="middle" >EU273519</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Podospora</td></tr><tr><td align="center" valign="middle" >HT002-R2-1</td><td align="center" valign="middle" >Trichoderma spirale isolate F28</td><td align="center" valign="middle" >JF439515</td><td align="center" valign="middle" >100%</td><td align="center" valign="middle" >Trichoderma-Hypocrea</td></tr><tr><td align="center" valign="middle" >HT002-R2-2</td><td align="center" valign="middle" >Hypocrea koningii isolate F50</td><td align="center" valign="middle" >JF439478</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Trichoderma-Hypocrea</td></tr><tr><td align="center" valign="middle" >HT002-R3-1</td><td align="center" valign="middle" >Podospora sp. XSD-39</td><td align="center" valign="middle" >EU273519</td><td align="center" valign="middle" >100%</td><td align="center" valign="middle" >Podospora</td></tr><tr><td align="center" valign="middle" >HT002-R3-2</td><td align="center" valign="middle" >Hypocrea koningii isolate F50</td><td align="center" valign="middle" >JF439478</td><td align="center" valign="middle" >99%</td><td align="center" valign="middle" >Trichoderma-Hypocrea</td></tr></tbody></table></table-wrap><p>Note: T001, T003, and T004 are individual IDs of B. japonica. T001 was originated from Kami and the others from Sakawa. HT002 is an ID of a host plant of B. japonica (Symplocos lancifolia from Kami). The subsequent letters “F” and “R” indicate the parts of plants used for isolation (“F” refers to inflorescences and “R” to tubers for B. japonica and roots for a host plant).</p><p>37.5%), and Penicillium and Podospora were the least common (2 of 8; 25%). Umbelopsis (1 strain) was the only fungus that was isolated from a host plant, but not from B. japonica. All results for molecular identifications will appear in DDBJ/EMBL/GenBank International DNA Data Bank under the accession nos. LC109274- LC109304.</p><p>All isolated fungal genera are known as common soil fungi and frequently found in various woody plant species as endophytes [<xref ref-type="bibr" rid="scirp.63142-ref23">23</xref>] -[<xref ref-type="bibr" rid="scirp.63142-ref25">25</xref>] . The similarity in fungal composition on B. japonica and its host suggested either a similar process of acquiring endophytic fungi from soil, horizontal transmission from hosts to parasites or both. In the case of Penicillium, however, most isolates were obtained from inflorescences. Detailed identification indicated that the species from host roots differed from those isolated from parasites. These facts suggest that most endophytic Penicillium strains were acquired after the aboveground parts of B. japonica.</p><p>This interpretation did not coincide with the B. harlandii results from China, as Tu et al. [<xref ref-type="bibr" rid="scirp.63142-ref18">18</xref>] did not isolate fungi from flowers or leaves. We could not identify any reason for these differences, but factors, such as age and longevity of aboveground parts or differences among species, might be related. Further examinations, particularly time-series analyses of fungal infections, should be conducted.</p><p>Although the major infected parts differed from each other, Penicillium was the only endophytic fungus in common with results from the previous study of B. harlandii [<xref ref-type="bibr" rid="scirp.63142-ref18">18</xref>] . However, the dominance status differed between the two species. Penicillium was one of the major fungi isolated, while only 3 of the 28 identified strains were Penicillium in B. harlandii. The major fungus found in China was the basidiomycotan anamorphic fungus Rhizoctonia [<xref ref-type="bibr" rid="scirp.63142-ref18">18</xref>] . This difference might be caused by differences in how the hosts are used. The host of B. harlandii is Ficus spp. (Moraceae), while B. japonica mainly uses Symplocos spp. as the host [<xref ref-type="bibr" rid="scirp.63142-ref20">20</xref>] . The endophytic assemblage of Ficus spp. [<xref ref-type="bibr" rid="scirp.63142-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.63142-ref27">27</xref>] indicated the presence of some fractions of “sterile forms” that might correspond to Rhizoctonia. Tu et al. [<xref ref-type="bibr" rid="scirp.63142-ref18">18</xref>] characterized the anamorph genus as different from conidiospores. Further studies, especially exhaustive molecular identification of fungi, are needed to elucidate the relationships between fungi and hosts in different parasitic plants.</p><p>The only example of a root holoparasite, other than Balanophoraceae, was Rafflesia cantleyi [<xref ref-type="bibr" rid="scirp.63142-ref14">14</xref>] . However, the results of Rafflesia were completely different from those of Balanophoraceae. Major isolates were Colletotrichum spp. that were never isolated from Balanophora (Tu et al. [<xref ref-type="bibr" rid="scirp.63142-ref18">18</xref>] and this study). Colletotricum is also a major endophytic fungus isolated from various plants [<xref ref-type="bibr" rid="scirp.63142-ref28">28</xref>] [<xref ref-type="bibr" rid="scirp.63142-ref29">29</xref>] . This fact might be caused by differences in host taxa (Tetrastigma [Vitaceae] is a host of Rufflesia spp.), distribution range (tropical vs. temperate evergreen forests) and/or phylogenetic position (Malpighiales vs. Santalales). Additional studies are required to identify the factors that contribute to these differences through an investigation of fungal composition of other holoparasitic species.</p><p>In this study, we could not identify roles for endophytic fungi of B. japonica in relation to its parasitic lifestyle. High similarity at the generic level indicated that B. japonica might obtain beneficial effects similar to those of host plants. In particular, the predominance of Trichoderma-Hypocrea might affect root growth stimulation [<xref ref-type="bibr" rid="scirp.63142-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.63142-ref6">6</xref>] and, thus, is advantageous to both hosts and parasites. Trichoderma-Hypocrea was not isolated in this study. This variation among B. japonica individuals, in terms of fungal composition, might provide a good opportunity to test the effects of endophytes. We only found a hint of tripartite relationships among host plants, parasitic plants and endophytic fungi. Further study is required to elucidate these relationships and the roles of each organism.</p></sec><sec id="s4"><title>Acknowledgements</title><p>We thank Y. Kumekawa, K. Matsuyama, Y. Muramatsu, M. Muroi, K. Ohga, and N. Yokoyama for their help in the course of this study. This study was partly supported by a Grant-in-Aid for Scientific Research from the Ministry of Education, Culture, Sports, Science and Technology, JAPAN (KAKENHI: No. 26291076 for J.Y. and T.F.)</p><p>The English in this document has been checked by at least two professional editors, both native speakers of English. For a certificate, please see: http://www.textcheck.com/certificate/A8VLeD.</p></sec><sec id="s5"><title>Cite this paper</title><p>HidekoIkeda,TatsuyaFukuda,JunYokoyama,11, (2016) Endophytic Fungi Associated with a Holoparasitic Plant, &lt;i&gt;Balanophora japonica&lt;/i&gt; (Balanophoraceae). American Journal of Plant Sciences,07,152-158. doi: 10.4236/ajps.2016.71016</p></sec><sec id="s6"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.63142-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Carroll, G. (1988) Fungal Endophytes in Stems and Leaves: From Latent Pathogen to Mutualistic Symbiont. Ecology, 69, 2-9. http://dx.doi.org/10.2307/1943154</mixed-citation></ref><ref id="scirp.63142-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Schardl, C.L. and Phillips, T.D. (1997) Protective Grass Endophytes. Where Are They from and Where Are They Going? Plant Disease, 81, 430-438. http://dx.doi.org/10.1094/PDIS.1997.81.5.430</mixed-citation></ref><ref id="scirp.63142-ref3"><label>3</label><mixed-citation publication-type="book" xlink:type="simple">Stone, J.K., Bacon, C.W. and White, J.F. (2000) An Overview of Endophytic Microbes: Endophytism Defined. In: Bacon, C.W. and White, J.F., Eds., Microbial Endophytes, Marcel Dekker, New York, 3-29.</mixed-citation></ref><ref id="scirp.63142-ref4"><label>4</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Verma</surname><given-names> A.</given-names></name>,<name name-style="western"><surname> Verma</surname><given-names> S.</given-names></name>,<name name-style="western"><surname> Sudha</surname><given-names> Sahay</given-names></name>,<name name-style="western"><surname> N.</surname><given-names> Bütehorn</given-names></name>,<name name-style="western"><surname> B. and Franken</surname><given-names> P. </given-names></name>,<etal>et al</etal>. (<year>1999</year>)<article-title>Piriformospora indica, a Cultivable Plant-Growth-Promoting Root Endophyte</article-title><source> Applied and Environmental Microbiology</source><volume> 65</volume>,<fpage> 2741</fpage>-<lpage>2744</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.63142-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Bae, H., Sicher, R.C., Kim, M.S., Kim, S.-H., Strem, M.D., Melnick, R.L. and Bailey, B.A. (2009) The Beneficial Endophyte Trichoderma hamatum Isolate DIS 219b Promotes Growth and Delays the Onset of the Drought Response in Theobroma cacao. Journal of Experimental Botany, 60, 3279-3295. http://dx.doi.org/10.1093/jxb/erp165</mixed-citation></ref><ref id="scirp.63142-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Hermosa, R., Viterbo, A., Chet, I. and Monte, E. (2012) Plant-Beneficial Effects of Trichoderma and of Its Genes. Microbiology, 158, 17-25. http://dx.doi.org/10.1099/mic.0.052274-0</mixed-citation></ref><ref id="scirp.63142-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Rodriguez, R.J., Redman, R.S. and Henson, J.M. (2004) The Role of Fungal Symbioses in the Adaptation of Plants to High Stress Environments. Mitigation and Adaptation Strategies for Global Change, 9, 261-272. http://dx.doi.org/10.1023/B:MITI.0000029922.31110.97</mixed-citation></ref><ref id="scirp.63142-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Rodriguez, R.J. and Redman, R.S. (2008) More than 400 Million Years of Evolution and Some Plants Still Can’t Make It on Their Own: Plant Stress Tolerance via Fungal Symbiosis. Journal of Experimental Botany, 59, 1109-1114. http://dx.doi.org/10.1093/jxb/erm342</mixed-citation></ref><ref id="scirp.63142-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Worchel, E.R., Giauque, H.E. and Kivlin, S.N. (2013) Fungal Symbionts Alter Plant Drought Response. Miclobial Ecology, 65, 671-678. http://dx.doi.org/10.1007/s00248-012-0151-6</mixed-citation></ref><ref id="scirp.63142-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Arnold, A.E., Mejia, L.C., Kyllo, D., Rojas, E.I., Maynard, Z., Robbins, N. and Herre, E.A. (2003) Fungal Endophytes Limit Pathogen Damage in a Tropical Tree. Proceeding of the National Academy of Sciences of the United States of America, 100, 15649-15654. http://dx.doi.org/10.1073/pnas.2533483100</mixed-citation></ref><ref id="scirp.63142-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Czarnoleski, M., Pawlik, K., Olejniczak, P., Kozlowski, J. and Lembicz, M. (2012) An Endophytic Fungus Reduces Herbivory in Its Recently Colonised Grass Host: A Food-Choice Experiment on Common Voles, Weeping Alkaligrass and Epichlo&amp;euml typhina. Plant Ecology, 213, 1049-1053. http://dx.doi.org/10.1007/s11258-012-0064-y</mixed-citation></ref><ref id="scirp.63142-ref12"><label>12</label><mixed-citation publication-type="book" xlink:type="simple">Press, M.C. and Graves, J.D. (Eds.) (1995) Parasitic Plants. Chapman &amp; Hall, London, 292.</mixed-citation></ref><ref id="scirp.63142-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Nickrent, D.L. and Musselman, L.J. (2004) Introduction to Parasitic Flowering Plants. The Plant Health Instruc-tor.http://www.apsnet.org/edcenter/intropp/PathogenGroups/Pages/ParasiticPlants.aspxhttp://dx.doi.org/10.1094/PHI-I-2004-0330-01</mixed-citation></ref><ref id="scirp.63142-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Refaei, J., Jones, E.B.G., Sakayaroj, J. and Santhanam, J. (2011) Endophytic Fungi from Rafflesia cantleyi: Species Diversity and Antimicrobial Activity. Mycosphere, 2, 429-447.</mixed-citation></ref><ref id="scirp.63142-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Suryanarayanan, T.S., Senthilarasu, G. and Muruganandam, V. (2000) Endophytic Fungi form Cuscuta reflexa and Its Host Plants. Fungal Diversity, 4, 117-123.</mixed-citation></ref><ref id="scirp.63142-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Stevens, P.F. (2001) Angiosperm Phylogeny Website. Version 12, July 2012 [and More or Less Continuously Updated Since]. http://www.mobot.org/MOBOT/research/APweb/</mixed-citation></ref><ref id="scirp.63142-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Su, H.J., Hu, J.M., Anderson, F.E., Der, J.P. and Nickrent, D.L. (2015) Phylogenetic Relationships of Santalales with Insights into the Origins of Holoparasitic Balanophoraceae. Taxon, 64, 491-506. http://dx.doi.org/10.12705/643.2</mixed-citation></ref><ref id="scirp.63142-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Tu, X., Zhang, Y., Han, Q., Yu, C. and An, R. (2011) Isolation and Screening of Endophytic Antibacteria from Balanophora harlandii Hook.f. Chinese Agricultural Science Bulletin, 27, 309-312.</mixed-citation></ref><ref id="scirp.63142-ref19"><label>19</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Hansen</surname><given-names> B. </given-names></name>,<etal>et al</etal>. (<year>1972</year>)<article-title>The Genus Balanophora, a Taxonomic Monograph</article-title><source> Dansk Botanisk Arkiv</source><volume> 28</volume>,<fpage> 1</fpage>-<lpage>188</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.63142-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Su, H.J., Murata, J. and Hu, J.M. (2012) Morphology and Phylogeny of Two Holoparasitic Plants, Balanophora japonica and Balanophora yakushimensis (Balanophoraceae), and Their Hosts in Taiwan and Japan. Journal of Plant Research, 125, 317-326.</mixed-citation></ref><ref id="scirp.63142-ref21"><label>21</label><mixed-citation publication-type="book" xlink:type="simple">White, T.J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and Direct Sequencing of Fungal Ribosomal RNA Genes for Phylogenetics. In: Innis, M., Gelfand, D., Sninsky, J. and White, T.J., Eds., PCR Protocols: A Guide to Methods and Application, Academic Press, San Diego, 315-322. http://dx.doi.org/10.1016/b978-0-12-372180-8.50042-1</mixed-citation></ref><ref id="scirp.63142-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Altschul, S.F., Madden, T.L., Schaffer, A.A., Zhang, J., Zhang, Z., Miller, W. and Lipman, D.J. (1997) Gapped BLAST and PSI-BLAST: A New Generation of Protein Database Search Programs. Nucleic Acids Research, 25, 3389-3402. http://dx.doi.org/10.1093/nar/25.17.3389</mixed-citation></ref><ref id="scirp.63142-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Hoff, J.A., Klopfenstein, N.B., McDonald, G.I., Tonn, J.R., Kim, M.-S., Zambino, P.J., Hessburg, P.F., Rogers, J.D., Peever, T.L. and Carris, L.M. (2004) Fungal Endophytes in Woody Roots of Douglasfir (Pseudotsuga menziesii) and Ponderosa Pine (Pinus ponderosa). Forest Pathology, 34, 255-271. http://dx.doi.org/10.1111/j.1439-0329.2004.00367.x</mixed-citation></ref><ref id="scirp.63142-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Summerbell, R.C. (2005) Root Endophyte and Mycorrhizosphere Fungi of Black Spruce, Picea mariana, in a Boreal Forest Habitat: Influence of Site Factors on Fungal Distributions. Studies in Mycology, 53, 121-145. http://dx.doi.org/10.3114/sim.53.1.121</mixed-citation></ref><ref id="scirp.63142-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Gazis, R. and Chaverri, P. (2010) Diversity of Fungal Endophytes in Leaves and Stems of Wild Rubber Trees (Hevea brasiliensis) in Peru. Fungal Ecology, 3, 240-254. http://dx.doi.org/10.1016/j.funeco.2009.12.001</mixed-citation></ref><ref id="scirp.63142-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Suryanarayanan, T.S. and Vijaykrishna, D. (2001) Fungal Endophytes of Aerial Roots of Ficus benghalensis. Fungal Diversity, 8, 155-161.</mixed-citation></ref><ref id="scirp.63142-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Maheswari, S. and Rajagopal, K. (2011) Biodiveristy of Endophytic Fungi Associated with Ficus religiosa and F. benghalensis. Mycologia Balcanica, 8, 169-172.</mixed-citation></ref><ref id="scirp.63142-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Photita, W., Taylor, P.W.J., Ford, R., Hyde, K.D. and Lumyong, S. (2005) Morphological and Molecular Characterization of Colletotrichum Species from Herbaceous Plants in Thailand. Fungal Diversity, 18, 117-133.</mixed-citation></ref><ref id="scirp.63142-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Gonzaga, L.L., Costa, L.E.O., Santos, T.T., Araújo, E.F. and Queiroz, M.V. (2014) Endophyic Fungi from the Genus Colletotrichum Are Abundant in the Phaseolus vulgaris and Have High Genetic Diversity. Journal of Applied Microbiology, 118, 485-496. http://dx.doi.org/10.1111/jam.12696</mixed-citation></ref></ref-list></back></article>