Human epidermal keratinocytes were isolated from skin by enzymatic digestion method as described previously [16] . Skin samples were obtained from donors with informed consents, under the approval of the Institutional Review Board of Chang Gung Memorial Hospital in Tao-Yuan, Taiwan. Briefly, skin was rinsed in 10% iodine for 30 sec and cleaned with 1 × PBS, then incubated in dispase (type II, 2.5 mg/ml in 1 × PBS) for 2 h at 37˚C to dissociate the epidermis from dermis. The epidermal layer was peeled off carefully and cut into small pieces and incubated in 0.25% trypsin for 30 min at 37˚C to release single cell. Cells were centrifuged and the cell pellet was resuspended in keratinocyte serum-free medium (KSFM, GIBCO^®) containing EGF and bovine pituitary extract and maintained at 37˚C in a humidified atmosphere of 95% air and 5% CO₂. Keratinocytes between passages 3 and 5 were used for all the experiments. In the present study, epidermal keratinocytes at 70% - 80% confluence were treated with melanin (0 - 100 μg/ml) for 24 h or indicated time and used for the analysis. All experiments were performed in triplicate.

The content of melanin uptake in keratinocytes was determined by spectrophotometric method. Cells were washed thoroughly by 1 × PBS, homogenized with 1N NaOH and heated at 95˚C for 30 min to dissolve intracellular melanin. The melanin content was determined by measuring the absorbance at 495 nm using a spectrophotometer.

Keratinocytes cultured on coverslips were fixed in 1 × PBS containing 4% paraformaldehyde for 15 min and stained with modified Wright-Giemsa stain (Sigma) for the microscopic examination of melanin uptake in cells. HE-stained tissue sections of solar lentigo was obtained from the tissue bank in Chang Gung Memorial Hospital (Tao-Yuan, Taiwan) and pathology was diagnosed and identified by Dr. Wen-Rou Wong who is a skin specialist. Solar lentigo is a small pigmented spot with a clearly defined edge on the skin associated with aging and exposure to ultraviolet radiation from the sun. Histologically, the hallmark of solar lentigo is an increase in basal melanin.

Epidermal keratinocytes grown in 24-well culture plate with or without melanin treatment for 24 h were washed once with 1 × PBS, followed by addition of 0.5 ml KSFM containing 0.05 mg/ml 3-[4, 5-dimethylthiazol-2-yl]-2, 5-diphenyltetrazolium bromide (MTT). After incubation at 37˚C for 1 h, the medium was removed and formazan crystals in the cells were dissolved in 1 ml DMSO for OD reading at 570 nm using a spectrophotometer.

Keratinocytes cultured on coverslips were fixed in 4% paraformaldehyde in 1 × PBS for 15 min and then in methanol at −20˚C for 10 min. Cells were blocked in 1 × PBS containing 1% BSA and 1% goat serum for 30 min. Rabbit antibody against Ki67 (Lab Vision) was added to blocking solution in a ratio of 1:50 and incubated at 4˚C overnight. After washing with 1 × PBS, FITC-conjugated goat anti-rabbit IgG (BioFX) was added (1:2000 in 1 × PBS) for 30 min. After washing with 1 × PBS, cell nuclei were counter-stained by propidium iodide for 10 min at 37˚C. Coverslips were mounted with fluorescent specific medium for the examination under fluorescent microscope.

Rehydrated tissue section was pretreated in 10 mM citrate buffer, pH 6.0, at 95˚C for 20 min followed by cooling at room temperature for 20 min. Tissue section was blocked in 1 × PBS containing 1% BSA and 1% goat serum for 30 min. Rabbit antibody against Ki67 (Lab Vision) was added to blocking solution in a ratio of 1:50 and incubated at 4˚C overnight. After washing with 1 × PBS, section was incubated with biotinylated goat anti-rabbit IgG (Thermo Scientific) for 15 min. After washing with 1 × PBS, section was incubated with streptavidin-con- jugated peroxidase (Thermo Scientific) for 10 min. In order to differentiate from the brown color of melanin in lentigo tissue, positive signals were developed by reacting peroxidase with ImmPACT^TM SG substrate (VECTOR) for 15 min and Ki67 expression was developed into blue color. Cell nuclei were counterstained by nuclear fast red (VECTOR) for 10 min and mounted with VectaMount^TM AQ mounting medium (VECTOR).

Keratinocytes were harvested by trypsinization. After washing with 1 × PBS and centrifugation, the cell pellet was resuspended in 1 ml ice-cold 70% ethanol and incubated overnight on a rocker at 4˚C. Cells were collected, washed and incubated in a solution of 0.5% Triton X-100 and 0.05% RNase at 37˚C for 1 h. Cell nuclei were then stained by propidium iodide (PI) solution (50 mg/ml PI in 1 × PBS) and incubated at 4˚C for 20 min. Cell cycle distribution was quantified with a FACS Calibur system (Becton-Dickinson). Percentages of cells in the G₀/G₁, S, and G₂/M phases of the cell cycle were determined and analyzed using CellQuest Pro software (Becton Dickinson).

Total RNA was extracted from keratinocytes by acid guanidinium thiocyanate?phenol?chloroform extraction method, and complementary (c) DNA was synthesized using 1 μg total RNA in a 20 μl RT reaction mix containing 0.5 μg/μl of random primers, 0.1 mM dNTP, 0.1 M DTT and 5× first strand buffer. Real-time PCR was performed using an SYBR Green I technology and MxPro- Mx3000P QPCR machine (Stratagene), and a master mix was prepared with Smart Quant Green Master Mix with dUTP & ROX Kit (Protech). Relative gene expressions between experimental groups were determined using MxPro software (Stratagene) and GAPDH was used as an internal control. All real-time PCRs were performed in triplicate, and changes in gene expressions were reported as multiples of increases relative to the controls. The following primers were used: GAPDH: 5’ - GAGGGGCCATCCACAGTCTT -3’ (forward) and 5’-TTCATTGACCTCAACTACAT -3’ (reverse). DKK1: 5’- CGTTGTTACTGTGGAGAA-3’ (forward) and 5’-GTGTGAAGCCTAGAAGAAT-3’ (reverse).

Epidermal keratinocytes were rinsed with cold 1 × PBS, scraped and solubilized in lysis buffer ( 20 mM Tris-Cl, pH 7.5, 150 mM NaCl, 1 mM Na₂EDTA, 1 mM EGTA, 1% Triton, 2.5 mM sodium pyrophosphate, 1 mM β-glycerophosphate, 1 mM Na₃VO₄, 1 mM PMSF, 1 μg/ml aprotinin, and 1 μg/ml leupeptin), followed by sonication and centrifugation at 12,000 g for 20 min at 4˚C. The protein concentration in the supernatant was determined by Bradford protein assay kit (Bio-Rad). Cell lysates containing equal amounts of protein were separated by 10% SDS-PAGE, and transferred onto PVDF membrane (Millipore). The membrane was incubated in blocking solution (1% BSA, 1% goat serum in 1 × PBS) for 1 h, followed by incubation with primary antibody diluted in blocking solution. After washing, the membrane was incubated in 1 × PBS containing secondary antibody conjugated with horseradish peroxidase for 1 h. The membrane was washed and the positive signals were developed with enhanced chemiluminescence reagent (Amershan Pharmacia Biotech). The following primary antibodies were used: anti-CDK1 antibody (MS-110-P1, Thermo), anti-CDK2 antibody (MS-459-P0, Thermo), anti-cyclin A antibody (ab38, Abcam), anti-cyclin B antibody (MS-338, Thermo), anti-cyclin E antibody (14- 6714, eBioscience), anti-DKK1 (AF1096, R&D systems) and anti-tubulin-α antibody (MS-581-P, Thermo). Tubulin was used as the sample loading control.

In order to study the direct effect of melanin on the cellular function of epidermal kerationcytes, we incubated keratinocytes with melanin in culture medium for 24 h and the uptake of melanin was measured by spectrophot- ometric method. The uptake of melanin by keratinocytes occurred soon after the addition of melanin for 1 h and the extent of uptake significantly increased in a dose- and time-dependent manner (Figure 1(a) and Figure 1(b), respectively). The uptaken melanin was revealed to be accumulated surrounding the nucleus (Figure 1(c)) which was similarly observed in human lentigo tissue (Figure 1(d)) as indicated by yellow arrows.

To understand the possible mechanism for epidermal keratinocytes to directly uptake melanin, we tested two well-known inhibitors for the transfer and uptake of melanosome into epidermal keratinocytes on this simplified cell model. Epidermal keratinocytes were pretreated with niacinamide or trypsin inhibitors for 3 h and then 50 μg/ml melanin was added for 24 h. The amount of melanin uptaken by epidermal keratinocytes was demonstrated to be dose-dependently suppressed by niacinamide or trypsin inhibitor (Figure 2(a) and Figure 2(b), respectively).

The uptake of melanin appeared to reduce the cell density of epidermal kertinocytes from microscopic observation. Epidermal keratinocytes with different concentration of melanin treatment for 24 h were analyzed by MTT assay. Results in Figure 3(a) demonstrated the dose-dependent effect of melanin on decreasing the cell number of epidermal keratinocytes. To further prove the inhibitory effect of melanin on the cell proliferation of epidermal keratinocytes, the expression of Ki-67, a cell proliferating marker, was fluorescently stained in epidermal keratinocytes. As clearly shown in Figure 3(b), the number of cells with positively stained Ki-67 expression (green fluorescent signal) in the nucleus was significantly decreased after melanin treatment. The dose-depen- dent effect of melanin on suppressing the Ki-67 expression in keratinocytes was calculated and confirmed in

Figure 3(c). Similar correlation was also found in human solar lentigo tissue as shown in Figure 4. Yellow arrow pointed out the cell with perinuclear accumulation of melanin (brown color) in which Ki67 expression was observed to be reduced. On the other hand, cell with positive Ki67 signal (blue color) as pointed out by red arrow was found to contain less melanin accumulation in the cells.

The inhibitory effect of melanin on the proliferation of epidermal keratinocytes was further confirmed by the cell cycle distribution analysis using flow cytometry. Results in Figure 5(a) clearly revealed that the melanin treatment resulted in the increase of G1phase-cells from 41.84% to 57.57% and the decrease of S phase-cells from 45.52% to 30.09%. Clearly, the cell cycle progression of epidermal keratinocytes was delayed and partially arrested at G1 phase by melanin. The expressions of cell cycle-dependent genes including CDK1, CDK2, cyclin E, cyclin A and cyclin B were dose-dependently suppressed in epidermal keratinocytes by the treatment with melanin for 24 h (Figure 5(b)).

To further explore the potential effect of melanin on the biological functions of epidermal keratinocytes, we

isolated RNA isolated from this simplified cell model and microarray analysis was performed by Phalanx Biotech Group (Hsinchu, Taiwan, R.O.C.) using The Human Whole Genome One Array® v6 containing 32,679 DNA oligonucleotide probes to reveal the gene expression profile changed by melanin. Results shown in Figure 6(a)

revealed 800 genes with more than two-fold changes in melanin-treated keratinocytes. Among them, DKK1 was found to be remarkably suppressed in epidermal keratinocytes by melanin. In Figure 6(b) and Figure 6(c), the mRNA and protein expression levels of DKK 1 in epidermal keratinocytes were further confirmed to be decreased in a dose-dependent manner.