<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">NS</journal-id><journal-title-group><journal-title>Natural Science</journal-title></journal-title-group><issn pub-type="epub">2150-4091</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ns.2015.712057</article-id><article-id pub-id-type="publisher-id">NS-61473</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Chemistry&amp;Materials Science</subject><subject> Earth&amp;Environmental Sciences</subject><subject> Medicine&amp;Healthcare</subject><subject> Physics&amp;Mathematics</subject></subj-group></article-categories><title-group><article-title>
 
 
  Isoflavone Ameliorates H&lt;sub&gt;2&lt;/sub&gt;O&lt;sub&gt;2&lt;/sub&gt; Induced Injury by Activating the Antioxidant System of Sow Mammary Gland Cell
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>ianyong</surname><given-names>Ma</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Zongyong</surname><given-names>Jiang</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Jian</surname><given-names>Zhang</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Youjun</surname><given-names>Hu</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Kaiguo</surname><given-names>Gao</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Li</surname><given-names>Wang</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Xuefen</surname><given-names>Yang</given-names></name><xref ref-type="aff" rid="aff5"><sup>5</sup></xref></contrib></contrib-group><aff id="aff3"><addr-line>State Key Laboratory of Livestock and Poultry Breeding, Guangzhou, China</addr-line></aff><aff id="aff1"><addr-line>Institute of Animal Science, Guangdong Academy of Agricultural Sciences, Guangzhou, China</addr-line></aff><aff id="aff4"><addr-line>Guangdong Public Laboratory of Animal Breeding and Nutrition, Guangzhou, China</addr-line></aff><aff id="aff2"><addr-line>Key Laboratory of Animal Nutrition and Feed Science in South China, Ministry of Agriculture, Guangzhou, China</addr-line></aff><aff id="aff5"><addr-line>Guangdong Key Laboratory of Animal Breeding and Nutrition, Guangzhou, China</addr-line></aff><pub-date pub-type="epub"><day>23</day><month>11</month><year>2015</year></pub-date><volume>07</volume><issue>12</issue><fpage>571</fpage><lpage>580</lpage><history><date date-type="received"><day>26</day>	<month>October</month>	<year>2015</year></date><date date-type="rev-recd"><day>accepted</day>	<month>22</month>	<year>November</year>	</date><date date-type="accepted"><day>25</day>	<month>November</month>	<year>2015</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  The antioxidant and protective properties of a synthetic soybean isoflavone (ISO) were investigated using sow mammary gland cell. Cells were cultured with 10, 20 and 30 uM ISO, respectively, under 80 uM FeSO
  <sub>4</sub>&#183;7H
  <sub>2</sub>O/H
  <sub>2</sub>O
  <sub>2</sub> conditions. After 48 h of incubation, the cells in the presence of ISO were lost less compared with that of control under oxidative damage by H
  <sub>2</sub>O
  <sub>2</sub>/FeSO
  <sub>4</sub>; ISO decreased the cell number at G1 and G2 stages, increased the cell number at S stage (all 
  P &lt; 0.05), it also reduced apoptosis of the cells (
  P &lt; 0.01, 
  P &lt; 0.01, 
  P &lt; 0.05). The addition of ISO significantly promoted cell proliferation (
  P &lt; 0.05) from 3
  <sup>rd</sup> to 6
  <sup>th</sup> days. Upon these, the activities of total superoxide dismutase (SOD), glutathione peroxidase (GPX), total antioxidant ability (T-AOC) also were increased and the activities of NADPH oxidase (NOX) decreased by ISO treatment (all 
  P &lt; 0.05). ISO decreased the concentration of ROS (
  P &lt; 0.05) and MDA (
  P &lt; 0.05). 10 uM, 20 uM, 30 uM ISO increased the relative mRNA abundance of SOD1 (all 
  P &lt; 0.05) and SOD2 (
  P &lt; 0.05, 
  P &lt; 0.01, 
  P &lt; 0.05) and SOD3 (all 
  P &lt; 0.05); ISO significantly increased the relative mRNA abundance of GPX4 (all 
  P &lt; 0.01) and NOX4 (all 
  P &lt; 0.05), 20 uM ISO also increased the relative mRNA abundance of NOX2 (
  P &lt; 0.05). It was concluded that supplementation of ISO enhanced the anti-oxidative function and prevented lipid peroxidation, possibly through the activation of the antioxidant enzymes and inhibition of cell apoptosis.
 
</p></abstract><kwd-group><kwd>Isoflavone</kwd><kwd> Antioxidant System</kwd><kwd> Sow Mammary Gland Cell</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Recently, more and more researches showed that soybean isoflavones (ISO) have been shown to possess antioxidant activity [<xref ref-type="bibr" rid="scirp.61473-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.61473-ref2">2</xref>] , which might be related to their anticancer, anti-inflammatory, and cardio-protective function. Some of the biological actions of ISO were partly attributed to their antioxidant properties, either through their reducing capacities or through their influence on intracellular redox status [<xref ref-type="bibr" rid="scirp.61473-ref3">3</xref>] . The phenolic compounds of ISO can be direct, stemming from their activity as free radical scavengers, or indirect, as modulators of intracellular pro- and anti-oxidant enzymes [<xref ref-type="bibr" rid="scirp.61473-ref4">4</xref>] . In research on human subjects, dietary ISO decreased risks of cardiovascular disease, osteoporosis, breast and prostate cancer, and menopausal symptoms [<xref ref-type="bibr" rid="scirp.61473-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.61473-ref6">6</xref>] . In animal models, dietary isoflavone enhanced the antioxidant function and prevented lipid oxidation of chicken [<xref ref-type="bibr" rid="scirp.61473-ref7">7</xref>] . Yousef et al. [<xref ref-type="bibr" rid="scirp.61473-ref8">8</xref>] found that ISO decreased the production of free radicals in plasma, liver, brain, testes, and kidney of male rabbits. Liu et al. [<xref ref-type="bibr" rid="scirp.61473-ref9">9</xref>] found that diets containing ISO (150 and 250 mg/kg) obviously elevated antioxidant enzymatic levels such as superoxide dismutase (SOD), catalase (CAT) and glutathione peroxidase (GPX) in various organs of rats fed diets containing partially oxidized oil. Our previous study [<xref ref-type="bibr" rid="scirp.61473-ref10">10</xref>] showed that dietary ISO improved the activities of antioxidant indices and productive performance of sows. Based on the results, we further investigated the mechanism of ISO playing their antioxidant function through the mammary cell culture experiment. Chen et al. [<xref ref-type="bibr" rid="scirp.61473-ref11">11</xref>] used MCF-7 human breast cancer cells as model and found that ISO induced apoptosis of this cell. Peng &amp; Kuo [<xref ref-type="bibr" rid="scirp.61473-ref12">12</xref>] used Caco-2 intestinal cells as model to research the antioxidant function and related mechanism of ISO. However, very few studies have looked at their antioxidant effects in domestic animal cells. This is the first time we investigate the antioxidant function and related mechanism of ISO on normal sow mammary cell, which will provide an important basis for the research of human breast health.</p></sec><sec id="s2"><title>2 Materials and Methods</title><sec id="s2_1"><title>2.1. Cell and Chemicals</title><p>Sow mammary cell line was obtained from Department of Animal Science, Texas A&amp;M University, USA, and were maintained according to their recommendation. The soybean isoflavone (ISO) was from Guangdong New Land Co., and its purity was &gt;98%. Dimethylsulfoxide (DMSO) and 3-[4,5-dimethylthiazol-2-yl]-2,5-diphe- nyltetrazoliumbromide (MTT) were purchased from Sigma Chemical Co. (St. Louis, MO, USA).</p></sec><sec id="s2_2"><title>2.2. Cell Culture and Treatment</title><p>Cells were cultured with an initial concentration of 5 &#215; 10<sup>5</sup> cells/ml, and cultured in 96-well microtiter plates for both morphology observation and cell proliferation assay. Others chemical indexes were tested using cells cultured in 6-well microtiter plates. The ISO was diluted in DMSO and added into the serum-free media to reach final concentrations of 10, 20 and 30 uM. The control cells were similarly treated with the same amount of DMSO (0.025% (v/v)). Oxidative damage was introduced by adding 80 uM of ferrous ions (as FeSO<sub>4</sub>・7H<sub>2</sub>O) and H<sub>2</sub>O<sub>2</sub> to each well for 2 hours.</p></sec><sec id="s2_3"><title>2.3. Observation of Cell Morphology</title><p>Cells were incubated for 48 h in the presence or absence of ISO (0, 10, 20 and 30 uM). The morphological changes of the cells were observed using phase-contrast microscopy (Axiovert 25 HBO 50/AC, Carl Zeiss, Jena, Gemany).</p></sec><sec id="s2_4"><title>2.4. Cell Proliferation Assay</title><p>The colorimetric MTT metabolic activity assay [<xref ref-type="bibr" rid="scirp.61473-ref13">13</xref>] was used to determine relative numbers of living cells. Mammary cells (1 &#215; 10<sup>5</sup> cells/well), from above, were cultured in 96-well plates at 37˚C, and exposed to varying concentrations (0 - 30 uM, n = 12, each) of ISO for 1 - 6 d. After incubation with 80 uM of ferrous ions, the medium was removed and the cells were washed twice with PBS, 20 uL of MTT solution (5 mg/mL in PBS) and 100 uL of fresh medium were added and incubation continued for another 4 h. The resultant formazan crystals were dissolved in DMSO (100 uL) and the absorbance was measured (Spectra Max M5, USA) at 490 nm.</p></sec><sec id="s2_5"><title>2.5. Cell Cycle and Cell Apoptosis Identification</title><p>Cells were incubated with ISO for 48 h in 6-well plates according to the condition from above. Cell cycle distributions were determined by measuring the celluar DNA content using flow cytometry. Cells were washed with 700 mL/L ethanol for 20 min and stored at 4˚C overnight, then washed with PBS, and stained with 100 uL of 50 mg/L PI at 4˚C for 30 min. The cells were then subjected to flow cytometric analysis on a FACS cancytofluorimeter (BD Co., USA ). Cell apoptosis were analyzed using cell apoptosis testing kits (BD Co., USA ) according to manufacturer’s instructions.</p></sec><sec id="s2_6"><title>2.6. Biochemical Determinations</title><p>For enzymes and malondialdehyde (MDA), triphosphopyridine nucleotide (NADPH) measurement, the cells were harvested by scraping in a buffer containing 80 mmol/L potassium phosphate and 5 mmol/L EDTA, pH 7.6. The activities of total SOD (T-SOD), GPX, CAT and the total antioxidant ability (T-AOC) was measured using colorimetric methods with a spectrophotometer (Biomate 5, Thermo Electron Corporation, Rochester, NY, USA) and the assay kits purchased from Nanjing Jiancheng Institute of Bioengineering (Nanjing, Jiangsu, PR China) according to the appropriate procedures. Cellular content of MDA and NO was determined with commercial test kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, China).</p></sec><sec id="s2_7"><title>2.7. Measurement of ROS Level in the Cells and Medium</title><p>Intracellular levels of ROS were measured as described by Sen et al. [<xref ref-type="bibr" rid="scirp.61473-ref14">14</xref>] . Cells were washed and re-suspended in 200 uL of DMEM/F19 and were loaded with the cell-permeate probe 20, 70-dichlorodihydro-fluorescein diacetate (H<sub>2</sub>DCFDA), at a final concentration of 40 uM. After incubation for 30 min at 37˚C in the dark, fluorescence was measured with the spectrofluorimeter using 507 nm as excitation and 530 nm as emission wavelengths. Fluorescence intensities were expressed on the basis of mg protein in each culturedish.</p></sec><sec id="s2_8"><title>2.8. Isolation of RNA and Real-Time PCR</title><p>At the end of the experiment, the cells were harvested for RNA extraction by first removing the medium and washing the cells briefly in PBS and then scraped in the lysis buffer from the RNeasy Mini Kit (Qiagen GmbH, Hilden, Germany). Total RNA was extracted from cell samples using TRIzol reagent (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. The quality and quantity of RNA was assessed by OD<sub>260</sub>/ OD<sub>280</sub> and gel electrophoresis. The cDNA was produced using a commercial kit containing Reverse Transcriptase XL (AMV) and RNA sin (Invitrogen Co., USA ). Real-time PCR was performed using with qPCR Mix (TaKaRa, BIOINC, Japan ) according to the manufacturers’ instructions. The DNA was sequenced by Sangon Technical Co. Ltd. (Shanghai, China). Primers of the genes were designed and listed in <xref ref-type="table" rid="table1">Table 1</xref>. The real-time PCR cycling conditions used were 95˚C for 40 s, followed by 40 cycles at 95˚C for 5 s and 58˚C for 20 s, then onecycle at 72˚C for 30 s. The Ct (threshold cycle) value for each reaction was used to calculate gene expression, relative to β-actin mRNA, expressed as 2<sup>−</sup><sup>△△</sup><sup>Ct</sup>.</p></sec><sec id="s2_9"><title>2.9. Statistical Analysis</title><p>Data were expressed as means &#177; SE. The effects of ISO at the various concentrations were compared with that of control by one-way analysis of variance using computing software SAS (v6.12, SAS Institute, USA). P-values &lt; 0.05 were considered to be significant and P-values &lt; 0.01 were considered to be extremely significant.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Cells Proliferation Analysis</title><p>Cell proliferation rate of mammary gland cell was tested from d 1 to day 6 by MTT method (<xref ref-type="fig" rid="fig1">Figure 1</xref>). MTT assay indicated that ISO treatment did not affect the proliferation rate of mammary gland cells at the first 2 days compared with the control (P &gt; 0.05); 20 uM ISO increased the proliferation rate of mammary gland cells at the 3<sup>rd</sup> and 4<sup>th</sup> days (P &lt; 0.05); 10 uM, 20 uM ISO increased the proliferation rate of cells at the 5<sup>th</sup> and 6<sup>th</sup></p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Effects of ISO on cell proliferation from 0 d to 6 d. “*” indicates significantly different from control (P &lt; 0.05); “**” indicates extremelysignificantly different from control (P &lt; 0.01)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/5-8302659x7.png"/></fig><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> The primer sequence of selected genes</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene name</th><th align="center" valign="middle" >Primer sequence</th></tr></thead><tr><td align="center" valign="middle" >CAT</td><td align="center" valign="middle" >Up 5’-CCTCAAGTACGTCCGACCAG-3’ Down 5’-TTCCATGCGATGTCATTGCG-3’</td></tr><tr><td align="center" valign="middle" >SOD1</td><td align="center" valign="middle" >Up 5’-GGTCCTCACTYCAATCCTG-3’ Down 5’-GGTCCTAACTTCAATCCTG-3’</td></tr><tr><td align="center" valign="middle" >SOD2</td><td align="center" valign="middle" >Up 5’- GATCACCATG TTGTGCAGG-3’ Down 5’-GTTGTTCACGTAGGCCGCGT-3’</td></tr><tr><td align="center" valign="middle" >SOD3</td><td align="center" valign="middle" >Up- 5’- GAGCCCAGCC CCGACCTGAT-3’ Down 5’-CAGCGTGGCGGACGGCTGCA-3’</td></tr><tr><td align="center" valign="middle" >GPX1</td><td align="center" valign="middle" >UP 5’-CCCACGCTCGGTGTATGCCT-3’ DOWN 5’-AGAAAGCGACGGCTGTAC-3’</td></tr><tr><td align="center" valign="middle" >GPX4</td><td align="center" valign="middle" >Up 5’-TGTGGTTTACGGATTCTGG-3’ DOWN 5’- CCTTGGGCTGGACTTTCA-3’</td></tr><tr><td align="center" valign="middle" >NOX2</td><td align="center" valign="middle" >Up 5’- ACCCTTTCACCCTGACCTCT-3’ Down 5’-AATCCCTGCTCCCACTAACA-3’</td></tr><tr><td align="center" valign="middle" >NOX4</td><td align="center" valign="middle" >Up 5’-TGGAACGCACTACCAGGATG-3’ Down 5’-TTCGGCACAATACAGGCACA</td></tr><tr><td align="center" valign="middle" >NOX5</td><td align="center" valign="middle" >Up 5’-GCCTGGCGACTACTTGTATCTG-3’ Down 5’-CTTCCTCTGACTCCTTCTCATTTTC-3’</td></tr><tr><td align="center" valign="middle" >Beta-actin</td><td align="center" valign="middle" >Up 5’- GACCTGACCGACTACCTCAT -3’ Down 5’- GCCGATGGTGATGACCTGGC -3’</td></tr></tbody></table></table-wrap><p>days (P &lt; 0.05).</p></sec><sec id="s3_2"><title>3.2. Cell Cycle and Cell Apoptosis Analysis</title><p>Under oxidative damage by H<sub>2</sub>O<sub>2</sub>/FeSO<sub>4</sub>, the cells in the presence of ISO were lost less compared with that of control, and the cells cultured with 10 uM or 20 uM ISO grew obviously better (<xref ref-type="fig" rid="fig2">Figure 2</xref>). In the analysis of apoptosis, 10 uM, 20 uM and 30 uM ISO treatment reduced apoptosis of the mammary gland cells compared to the control (P &lt; 0.01, P &lt; 0.01, P &lt; 0.05) respectively (<xref ref-type="fig" rid="fig2">Figure 2</xref>). In the analysis of the cell cycle, ISO (10 - 30 uM) decreased the cell number at G1 and G2 stages, increased the cell number at S stage (P &lt; 0.05) (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p></sec><sec id="s3_3"><title>3.3. Biochemical Analyses</title><p>The activities of antioxidant or pro-oxidant enzymes were listed in <xref ref-type="table" rid="table2">Table 2</xref>. Compared with the control, 10 uM, 20 uM, 30 uM ISO increased the activities of SOD by 23.98%, 33.69%, 17.89% and decreased the activities of</p><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Effects of ISO on the morphology and apoptosis index of sow mammary gland cells. (a) Themorphology of the cell under different concentration of ISO; (b) The apoptosis index analysis of the cells. “*” indicates significantly different from control (P &lt; 0.05); “**” indicates extremely significantly different from control (P &lt; 0.01)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/5-8302659x8.png"/></fig><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Effects of ISO on cell cycle of sow mammary gland cells. Cellcycle was analyzed by using proliferation index. “*” indicates significantly different from control (P &lt; 0.05)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/5-8302659x9.png"/></fig><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Effects of ISO on the activities of antioxidant or pro-oxidant enzymes in cells (n = 16)</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Treatment</th><th align="center" valign="middle" >Control</th><th align="center" valign="middle" >ISO 10 uM</th><th align="center" valign="middle" >ISO 20 uM</th><th align="center" valign="middle" >ISO 30 uM</th></tr></thead><tr><td align="center" valign="middle" >SOD (U/mgprot)</td><td align="center" valign="middle" >15.76 &#177; 1.14</td><td align="center" valign="middle" >19.54 &#177; 1.59<sup>*</sup></td><td align="center" valign="middle" >21.07 &#177; 1.22<sup>*</sup></td><td align="center" valign="middle" >18.58 &#177; 1.26<sup>*</sup></td></tr><tr><td align="center" valign="middle" >CAT (U/mgprot)</td><td align="center" valign="middle" >0.89 &#177; 0.06</td><td align="center" valign="middle" >1.03 &#177; 0.08<sup>*</sup></td><td align="center" valign="middle" >1.12 &#177; 0.10<sup>*</sup></td><td align="center" valign="middle" >1.04 &#177; 0.14</td></tr><tr><td align="center" valign="middle" >GSH-Px (U/mgprot)</td><td align="center" valign="middle" >51.85 &#177; 6.33</td><td align="center" valign="middle" >84.33 &#177; 4.55<sup>**</sup></td><td align="center" valign="middle" >89.12 &#177; 6.19<sup>**</sup></td><td align="center" valign="middle" >69.24 &#177; 5.22<sup>*</sup></td></tr><tr><td align="center" valign="middle" >T-AOC (U/mgprot)</td><td align="center" valign="middle" >2.81 &#177; 0.15</td><td align="center" valign="middle" >4.60 &#177; 0.24<sup>**</sup></td><td align="center" valign="middle" >3.76 &#177; 0.15<sup>**</sup></td><td align="center" valign="middle" >3.39 &#177; 0.23<sup>*</sup></td></tr><tr><td align="center" valign="middle" >NOX (ng/ml)</td><td align="center" valign="middle" >0.54 &#177; 0.03</td><td align="center" valign="middle" >0.42 &#177; 0.03<sup>*</sup></td><td align="center" valign="middle" >0.40 &#177; 0.02<sup>*</sup></td><td align="center" valign="middle" >0.45 &#177; 0.03<sup>*</sup></td></tr><tr><td align="center" valign="middle" >ODC (ng/ml)</td><td align="center" valign="middle" >1.15 &#177; 0.12</td><td align="center" valign="middle" >1.48 &#177; 0.20</td><td align="center" valign="middle" >1.27 &#177; 0.11</td><td align="center" valign="middle" >1.29 &#177; 0.17</td></tr></tbody></table></table-wrap><p>“*” indicates significantly different from control (P &lt; 0.05); “**” indicates extremely significantly different from control (P &lt; 0.01).</p><p>NADPH oxidase (NOX) by 22.22%, 25.93%, 16.67% (all P &lt; 0.05); 10 uM, 20 uM ISO significantly increased the activities of GPX and T-AOC (P &lt; 0.01), and 30 uM ISO increased the activities of GPX and T-AOC (P &lt; 0.05); 10 uM and 20 uM ISO increased the activities of CAT (P &lt; 0.05). ISO treatment did not affect the activity of ornithine decarboxylase (ODC) (P &gt; 0.05).</p></sec><sec id="s3_4"><title>3.4. ROS, MDA and NO Analysis</title><p>From <xref ref-type="table" rid="table3">Table 3</xref>, compared with the control, 10 uM, 20 uM, and 30 uM ISO decreased the concentration of ROS (P &lt; 0.05); 10 uM, 20 uM ISO decreased the concentration of MDA in the cells (P &lt; 0.05); 10 uM, 20 uM, and 30 uM ISO did not affect the concentration of NO in the cells (P &gt; 0.05).</p></sec><sec id="s3_5"><title>3.5. Relative mRNA Expression in Mammary Gland Cells</title><p>The result from <xref ref-type="table" rid="table4">Table 4</xref> showed that ISO did not affect the relative mRNA abundance of CAT compared with the control; 10 uM, 20 uM, 30 uM ISO increased the relative mRNA abundance of SOD1 (all P &lt; 0.05) and SOD2 (P &lt; 0.05, P &lt; 0.01, P &lt; 0.05) and SOD3 (P &lt; 0.05, P &lt; 0.05, P &gt; 0.05); ISO significantly increased the relative mRNA abundance of GPX4 (all P &lt; 0.01), but did not affect relative mRNA abundance of GPX1except for 20 uM ISO; 10 uM, 20 uM, 30 uM ISO increased the relative mRNA abundance of NOX4 (all P &lt; 0.05), 20 uM ISO also increased the relative mRNA abundance of NOX2 (P &lt; 0.05), but did not affect the relative mRNA abundance of NOX5 (all P &gt; 0.05).</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>Our results showed that ISO stimulated the mammary gland cells proliferation by inducing cell accumulation in M or S phases and decreasing the cells number at G1 and G2 phases. Matsukawa et al. [<xref ref-type="bibr" rid="scirp.61473-ref15">15</xref>] found that the proliferation of human gastric cancer cells (HGC-27) was inhibited by ISO and most of the cells were arrested in the M phase. Cell cycle arrest is a characteristic of cells and the cell cycle progresses through different phases commonly referred to as checkpoints [<xref ref-type="bibr" rid="scirp.61473-ref16">16</xref>] . Cell cycle checkpoints are transient delays in S or M phase to response to DNA damage by cellular stressors, including ROS, and allow time for the activation of repair mechanisms [<xref ref-type="bibr" rid="scirp.61473-ref17">17</xref>] . Following repair of damaged DNA, cells resume cell cycle progression. However, if the damage is too severe, the cells may undergo apoptosis or irreversible senescence [<xref ref-type="bibr" rid="scirp.61473-ref18">18</xref>] . ROS caused DNA damage and induced M phase arrest and apoptosis [<xref ref-type="bibr" rid="scirp.61473-ref19">19</xref>] and genistein inhibited it [<xref ref-type="bibr" rid="scirp.61473-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.61473-ref21">21</xref>] . Other reports [<xref ref-type="bibr" rid="scirp.61473-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.61473-ref23">23</xref>] showed that genistein (one kind of ISO) induced cell cycle arrest and cell apoptosis because of its anti-angiogenesis and</p><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Effects of ISO on the content of oxidant products in cells (n = 16)</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Treatment</th><th align="center" valign="middle" >Control</th><th align="center" valign="middle" >ISO 10 uM</th><th align="center" valign="middle" >ISO 20 uM</th><th align="center" valign="middle" >ISO 30 uM</th></tr></thead><tr><td align="center" valign="middle" >ROS (photons/min)</td><td align="center" valign="middle" >63.11 &#177; 9.12</td><td align="center" valign="middle" >39.44 &#177; 4.87<sup>*</sup></td><td align="center" valign="middle" >43.92 &#177; 4.59<sup>*</sup></td><td align="center" valign="middle" >51.04 &#177; 6.33<sup>*</sup></td></tr><tr><td align="center" valign="middle" >MDA (nmol/mL)</td><td align="center" valign="middle" >1.95 &#177; 0.24</td><td align="center" valign="middle" >1.47 &#177; 0.11<sup>*</sup></td><td align="center" valign="middle" >1.62 &#177; 0.23<sup>*</sup></td><td align="center" valign="middle" >1.71 &#177; 0.12</td></tr><tr><td align="center" valign="middle" >NO (nmol/mL)</td><td align="center" valign="middle" >9.52 &#177; 0.78</td><td align="center" valign="middle" >8.19 &#177; 0.97</td><td align="center" valign="middle" >8.37 &#177; 1.11</td><td align="center" valign="middle" >8.87 &#177; 1.02</td></tr></tbody></table></table-wrap><p>“*” indicates significantly different from control (P &lt; 0.05).</p><table-wrap id="table4" ><label><xref ref-type="table" rid="table4">Table 4</xref></label><caption><title> Effects of ISO on the genes expression related with antioxidant enzymes in cells (n = 16)</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Treatment</th><th align="center" valign="middle" >Control</th><th align="center" valign="middle" >ISO 10 uM</th><th align="center" valign="middle" >ISO 20 uM</th><th align="center" valign="middle" >ISO 30 uM</th></tr></thead><tr><td align="center" valign="middle" >CAT (&#215;10<sup>−2</sup>)</td><td align="center" valign="middle" >1.16 &#177; 0.22</td><td align="center" valign="middle" >1.26 &#177; 0.37</td><td align="center" valign="middle" >1.01 &#177; 0.46</td><td align="center" valign="middle" >1.23 &#177; 0.33</td></tr><tr><td align="center" valign="middle" >SOD1 (&#215;10<sup>−2</sup>)</td><td align="center" valign="middle" >0.75 &#177; 0.08</td><td align="center" valign="middle" >1.94 &#177; 0.21<sup>*</sup></td><td align="center" valign="middle" >1.83 &#177; 0.34<sup>*</sup></td><td align="center" valign="middle" >1.34 &#177; 0.24<sup>*</sup></td></tr><tr><td align="center" valign="middle" >SOD2 (&#215;10<sup>−3</sup>)</td><td align="center" valign="middle" >2.56 &#177; 0.33</td><td align="center" valign="middle" >3.48 &#177; 1.09<sup>*</sup></td><td align="center" valign="middle" >4.17 &#177; 1.10<sup>**</sup></td><td align="center" valign="middle" >3.14 &#177; 0.54<sup>*</sup></td></tr><tr><td align="center" valign="middle" >SOD3 (&#215;10<sup>−3</sup>)</td><td align="center" valign="middle" >0.94 &#177; 0.08</td><td align="center" valign="middle" >1.45 &#177; 0.13<sup>*</sup></td><td align="center" valign="middle" >1.38 &#177; 0.15<sup>*</sup></td><td align="center" valign="middle" >1.26 &#177; 0.26</td></tr><tr><td align="center" valign="middle" >GPX1 (&#215;10<sup>−3</sup>)</td><td align="center" valign="middle" >2.13 &#177; 0.44</td><td align="center" valign="middle" >2.56 &#177; 0.34</td><td align="center" valign="middle" >3.49 &#177; 0.54<sup>*</sup></td><td align="center" valign="middle" >3.15 &#177; 0.46</td></tr><tr><td align="center" valign="middle" >GPX4 (&#215;10<sup>−2</sup>)</td><td align="center" valign="middle" >0.69 &#177; 0.10</td><td align="center" valign="middle" >2.88 &#177; 0.34<sup>**</sup></td><td align="center" valign="middle" >3.16 &#177; 0.39<sup>**</sup></td><td align="center" valign="middle" >2.40 &#177; 0.45<sup>**</sup></td></tr><tr><td align="center" valign="middle" >NOX2 (&#215;10<sup>−3</sup>)</td><td align="center" valign="middle" >5.66 &#177; 0.54</td><td align="center" valign="middle" >7.04 &#177; 0.88</td><td align="center" valign="middle" >8.12 &#177; 1.03<sup>*</sup></td><td align="center" valign="middle" >6.12 &#177; 1.01</td></tr><tr><td align="center" valign="middle" >NOX4 (&#215;10<sup>−2</sup>)</td><td align="center" valign="middle" >0.79 &#177; 0.11</td><td align="center" valign="middle" >1.24 &#177; 0.08<sup>*</sup></td><td align="center" valign="middle" >1.31 &#177; 0.12<sup>*</sup></td><td align="center" valign="middle" >1.18 &#177; 0.20<sup>*</sup></td></tr><tr><td align="center" valign="middle" >NOX5 (&#215;10<sup>−3</sup>)</td><td align="center" valign="middle" >1.02 &#177; 0.23</td><td align="center" valign="middle" >1.89 &#177; 0.21</td><td align="center" valign="middle" >1.67 &#177; 0.27</td><td align="center" valign="middle" >1.87 &#177; 0.32</td></tr></tbody></table></table-wrap><p>“*” indicates significantly different from control (P &lt; 0.05); “**” indicates extremely significantly different from control (P &lt; 0.01).</p><p>antioxidant activities. In the present research, it also implied that ISO increasing the cell proliferation and decreasing the cell apoptosis by affecting cell cycle checkpoint were related with its antioxidant function. In recent years, ROS and antioxidant usage have received significant attention because aberrant production or regulation of ROS activity has been shown to contribute to development of some prevalent diseases and conditions [<xref ref-type="bibr" rid="scirp.61473-ref24">24</xref>] . Dietary flavonoids appeared to play a role in prevention of a number of chronic diseases, such as cancer and cardiovascular disease, with a particular focus on isoflavones [<xref ref-type="bibr" rid="scirp.61473-ref25">25</xref>] .</p><p>Several previous studies revealed that genistein prevented apoptotic cell death via its antioxidant properties [<xref ref-type="bibr" rid="scirp.61473-ref26">26</xref>] [<xref ref-type="bibr" rid="scirp.61473-ref27">27</xref>] . The present study demonstrated an important role of ISO in decreasing ROS generation and thereby exerting an antioxidant effect. It is known that intracellular ROS are produced by mitochondria as well as by a number of ROS-generating plasmamembrane and cytosolic enzymes [<xref ref-type="bibr" rid="scirp.61473-ref28">28</xref>] . Among the ROS-producing enzymes, the NADPH oxidase (NOX) family was the major source of non-mitochondrial ROS in many cells, including phagocytes and non-phagocytes [<xref ref-type="bibr" rid="scirp.61473-ref29">29</xref>] - [<xref ref-type="bibr" rid="scirp.61473-ref31">31</xref>] . The present study indicated that ISO decreased the activities of NOX. Consistent with the present results, the inhibitory role of genistein in regulating NOX also was demonstrated in human oral squamous carcinoma cells [<xref ref-type="bibr" rid="scirp.61473-ref32">32</xref>] and in a diabetic mouse model subjected to chronic i.p. treatment with genistein [<xref ref-type="bibr" rid="scirp.61473-ref33">33</xref>] . ROS attacked the membrane polyunsaturated fatty acids, leding to lipid peroxidation and cell membrane function lost, so detecting the content of ROS and MDA can indirectly reflect the cells by free radicals attack severity. Our research showed that 10 ? 30 uM ISO decreased the content of ROS and MDA in mammary cell and increased the activities of SOD, GPX and T-AOC et al., especially the activity of GPX. In this present study, the GPX activity was found to be around 70 U/g of protein using ISO treatment, which was higher than the mean activity found in bovine mammarytissue (mean 33 U/g, range 4 - 62 U/g) [<xref ref-type="bibr" rid="scirp.61473-ref34">34</xref>] . SOD, GPX and CAT were the three main enzymes of the antioxidant system, and our result showed that ISO protected the antioxidant system of the sow mammary cells. Choi et al. [<xref ref-type="bibr" rid="scirp.61473-ref35">35</xref>] reported that genistein increased the activities of SOD, decreasing the cell apoptosis, which implied that the increase of SOD activity was related with the decrease of cell apoptosis.</p><p>We determined the mRNA level of SOD1, SOD2, and SOD3 present in sow mammary gland cells because these three enzymes acted spatially to maintain steady-state concentrations of O2<sup>−</sup> through conversion to H<sub>2</sub>O<sub>2</sub>. In the present research, ISO increased the mRNA level of SOD1, SOD2 and SOD3. GPX was taken as the main enzymes removing the peroxide from cytoplasm. It also was the main selenoprotein in mammary gland cells. GPX4 could savage the ROS like other members of GPX family [<xref ref-type="bibr" rid="scirp.61473-ref36">36</xref>] , it also has special antioxidant function，playing very important function in regulating cell apoptosis. Only GPX4 could transform the PLOOH located in the cell membrane to corresponding hydroxyl compound, terminating the peroxidation and protecting the membrane from oxidative damage [<xref ref-type="bibr" rid="scirp.61473-ref36">36</xref>] - [<xref ref-type="bibr" rid="scirp.61473-ref38">38</xref>] . GPX 3 was the only selenoprotein thus far detected in milk [<xref ref-type="bibr" rid="scirp.61473-ref39">39</xref>] [<xref ref-type="bibr" rid="scirp.61473-ref40">40</xref>] together with an observation of SeP in mouse milk [<xref ref-type="bibr" rid="scirp.61473-ref41">41</xref>] , and its expression has been detected in bovine, human and mouse mammary tissue [<xref ref-type="bibr" rid="scirp.61473-ref34">34</xref>] [<xref ref-type="bibr" rid="scirp.61473-ref42">42</xref>] , the mRNA abundance of GPX1 and GPX4 also were detected in bovine mammary gland cells [<xref ref-type="bibr" rid="scirp.61473-ref43">43</xref>] . In the present study, the gene expression of GPX4 and GPX1 was increased by ISO. These results showed that GPX in sow mammary gland cells respond to ISO supplementation, and that the changes in their mRNA level are similar to the one found in bovine mammary tissue and other systems. Sow mammary gland cell is therefore as a useful model system for studying the GPX or selenoprotein biosynthesis. As NOX family was the major source of non-mitochondrial ROS in many cells [<xref ref-type="bibr" rid="scirp.61473-ref30">30</xref>] [<xref ref-type="bibr" rid="scirp.61473-ref31">31</xref>] . We also identified the gene expression of NOX (NOX2, NOX4 and NOX5) in sow mammary cells treated by ISO. The result indicated that ISO decreased the gene expression of NOX2 and NOX4, which consistent with the activity of NOX enzyme results. Taken together, ISO increased the genes expression of SOD and GPX with concomitant decreases in NOX, indicative of decreased oxidative stress.</p></sec><sec id="s5"><title>5. Conclusion</title><p>The results presented here suggested that supplementation of ISO enhanced the anti-oxidative function and prevented lipid peroxidation, possibly through the activation of the antioxidant enzymes and inhibition of cell apoptosis.</p></sec><sec id="s6"><title>Acknowledgements</title><p>This work was supported by grants from Guangdong international science and technology cooperation program (2013B050800016), the earmarked fund for China Agriculture Research System (CARS-36), Provincial Key Laboratory support construction projects (2012A061100005).</p></sec><sec id="s7"><title>Cite this paper</title><p>XianyongMa,ZongyongJiang,JianZhang,YoujunHu,KaiguoGao,LiWang,XuefenYang, (2015) Isoflavone Ameliorates H<sub>2</sub>O<sub>2</sub> Induced Injury by Activating the Antioxidant System of Sow Mammary Gland Cell. Natural Science,07,571-580. doi: 10.4236/ns.2015.712057</p></sec><sec id="s8"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.61473-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Lee, C.H., Yang, L., Xu, J.Z., Venus Yeung, S.Y., Huang, Y. and Chen, Z.Y. (2005) Relative Antioxidant Activity of Soybean Isoflavones and Their Glycosides. Food Chemistry, 90, 735-741.  
&lt;br&gt;http://dx.doi.org/10.1016/j.foodchem.2004.04.034</mixed-citation></ref><ref id="scirp.61473-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Win, W., Cao, Z.X., Peng, X.X., Trush, M.A. and Li, Y.B. (2002) Different Effects of Genistein and Resveratrol on Oxidative DNA Damage in Vitro. Mutation Research, 513, 113-120.  
&lt;br&gt;http://dx.doi.org/10.1016/S1383-5718(01)00303-5</mixed-citation></ref><ref id="scirp.61473-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Hernandez-Montes, E., Pollard, S.E., Vauzour, D., Jofre-Montseny, L., Rota, C., Rimbach, G., Weinberg, P.D. and Spencer, J.P. (2006) Activation of Glutathione Perox-idase via Nrf1 Mediates Genistein’s Protection against Oxidative Endothelial Cell Injury. Biochemical and Biophysical Research Communications, 346, 851-859.  
&lt;br&gt;http://dx.doi.org/10.1016/j.bbrc.2006.05.197</mixed-citation></ref><ref id="scirp.61473-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Schewe, T., Steffen, Y. and Sies, H. (2008) How Do Dietary Flavanols Improve Vascular Function? A Position Paper. Archives of Biochemistry and Biophysics, 476, 102-106. &lt;br&gt;http://dx.doi.org/10.1016/j.abb.2008.03.004</mixed-citation></ref><ref id="scirp.61473-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Steiner, C., Arnould, S., Scalbert, A. and Manach, C. (2008) Isoflavones and the Prevention of Breast and Prostate Cancer: New Perspectives Opened by Nutrigenomics. British Journal of Nutrition, 99, 78-108.  
&lt;br&gt;http://dx.doi.org/10.1017/S0007114508965788</mixed-citation></ref><ref id="scirp.61473-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Scalbert, A., Manach, C., Morand, C., Rémésy, C. and Jiménez, L. (2011) Dietarypolyphenols and the Prevention of Diseases. Critical Reviews in Food Science and Nutrition, 45, 287-306. &lt;br&gt;http://dx.doi.org/10.1080/1040869059096</mixed-citation></ref><ref id="scirp.61473-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Jiang, S.Q., Jiang, Z.Y., Lin, Y.C., Xi, P.B. and Ma, X.Y. (2007) Effects of Soy Isoflavone on Performance, Meat Quality and Antioxidative Property of Male Broilers Fed Oxidized Fish Oil. Asian-Australasion Journal of Animal Science, 20, 1252-1257. &lt;br&gt;http://dx.doi.org/10.5713/ajas.2007.1252</mixed-citation></ref><ref id="scirp.61473-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Yousef, M.I., Kamel, K.I., Esmail, A.M. and Baghdadi, H.H. (2004) Antioxidant Activities and Lipid Lowering Effects of Isoflavone in Malerabbits. Food and Chemical Toxicology, 42, 1497-1503.  
&lt;br&gt;http://dx.doi.org/10.1016/j.fct.2004.04.012</mixed-citation></ref><ref id="scirp.61473-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Liu, J.B., Chang Sam, K.C. and Wiesenborn, D. (2005) Antioxidant Properties of Soybean Isoflavone Extract and Tofu in Vitro and in Vivo. Journal of Agricultural and Food Chemistry, 53, 2333-2340. &lt;br&gt;http://dx.doi.org/10.1021/jf048552e</mixed-citation></ref><ref id="scirp.61473-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Hu, Y.J., Gao, K.G., Zheng, C.T., Wu, Z.J., Yang, X.F., Wang, L., Ma, X.Y., Zhou, A.G. and Jiang, Z.J. (2015) Effect of Dietary Supplementation with Glycitein during Late Pregnancy and Lactation on Antioxidative Indices and Performance of Primiparous Sows. Journal of Animal Sci-ence, 93, 2246-2254. &lt;br&gt;http://dx.doi.org/10.2527/jas.2014-7767</mixed-citation></ref><ref id="scirp.61473-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Chen, J., Duan, Y., Zhang, X., Ye, Y., Ge, B. and Chen, J. (2015) Genistein Induces Apoptosis by the Inactivation of the IGF-1R/p-Akt Signaling Pathway in MCF-7 Human Breast Cancer Cells. Food Function, 6, 995-1000.  
&lt;br&gt;http://dx.doi.org/10.1039/C4FO01141D</mixed-citation></ref><ref id="scirp.61473-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Peng, I.W. and Kuo, S.M. (2003) Flavonoid Structure Affects the Inhibition of Lipid Peroxidation in Caco-2 Intestinal Cells at Physiological Concentrations. Journal of Nutrition, 133, 2184-2187.</mixed-citation></ref><ref id="scirp.61473-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Mosmann, T. (1983) Rapid Colorimetric Assay for Cellular Growth and Survival: Application to Proliferation and Cytotoxicity Assays. Journal of Immunological Methods, 65, 55-63. &lt;br&gt;http://dx.doi.org/10.1016/0022-1759(83)90303-4</mixed-citation></ref><ref id="scirp.61473-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Sen, N., Das, B.B., Ganguly, A., Mukherjee, T., Bandyopadhyay, S. and Majumder, H.K. (2004) Camptothecin-Induced Imbalance in Intracellular Cation Homeostasis Regulates Programmed Cell Death in Unicellular Hemoflagellate Leishmania donovani. Journal of Biological Chemistry, 279, 52366-52375.  
&lt;br&gt;http://dx.doi.org/10.1074/jbc.M406705200</mixed-citation></ref><ref id="scirp.61473-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Matsukawa, Y., Marui, N., Sakai, T., Satomi, Y., Yoshida, M., Matsumoto, K., Nishino, H. and Aoike, A. (1993) Genistein Arrests Cell Cycle Progression at G2/M. Cancer Research, 53, 1328-1331.</mixed-citation></ref><ref id="scirp.61473-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Kumi-Diaka, J., Sanderson, N.A. and Hall, A. (2000) The Mediating Role of Caspase-3 Protease in the Intracellular Mechanism of Genistein-Induced Apoptosis in Human Prostatic Carcinoma Cell Lines, DU145 and LNCaP. Biology Cell, 92, 595-604. &lt;br&gt;http://dx.doi.org/10.1016/S0248-4900(00)01109-6</mixed-citation></ref><ref id="scirp.61473-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Davis, N., Kucuk, O. and Sarkar, F.H. (1999) Genistein Inhibits NF-κB Activation in Prostate Cancer Cells. Nutrition Cancer, 35, 167-174. &lt;br&gt;http://dx.doi.org/10.1207/S15327914NC352_11</mixed-citation></ref><ref id="scirp.61473-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Fotsis, T., Pepper, M.S., Aktas, E., Breit, S., Rasku, S., Adlercreutz, H., W?h?l?, K., Montesano, R. and Schweigerer, L. (1997) Flavonoids, Dietary Derived Inhibitors of Cell Proliferation and in Vitro Angiogenesis. Cancer Research, 57, 2916-2921. </mixed-citation></ref><ref id="scirp.61473-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Varbiro, G., Veres, B., Gallyas, F.J. and Sumegi, B. (2001) Direct Effect of Taxol on Free Radical Formation and Mitochondrial Permeability Transition. Free Radical Biology and Medicine, 31, 548-558.  
&lt;br&gt;http://dx.doi.org/10.1016/S0891-5849(01)00616-5</mixed-citation></ref><ref id="scirp.61473-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Polkowski, K. and Mazurek, A.P. (2000) Biological Properties of Genistein. A Review of in Vitro and in Vivo Data. Actapoloniae Pharmaceutica, 57, 135-155.</mixed-citation></ref><ref id="scirp.61473-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Setchell, K.D. and Cassidy, A. (1999) Dietary Isoflavones: Biological Effects and Relevance to Human Health. Journal of Nutrition, 129, 758S-767S.</mixed-citation></ref><ref id="scirp.61473-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Li, Y., Upadhyay, S., Bhuiyan, M. and Sarkar, F.H. (1999) Induction of Apoptosis in Breast Cancer Cells MDA. MB. 231 by Genistein. Oncogene, 18, 3166-3172. &lt;br&gt;http://dx.doi.org/10.1038/sj.onc.1202650</mixed-citation></ref><ref id="scirp.61473-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Alhasan, S.A., Pietrasczkiwicz, H., Alonso, M.D., Ensley, J. and Sarkar, F.H. (1999) Genistein Induced Cell Cycle Arrest and Apoptosis in a Head and Neck Squamous Cell Carcinoma Cell Line. Nutrition Cancer, 34, 12-19.  
&lt;br&gt;http://dx.doi.org/10.1207/S15327914NC340102</mixed-citation></ref><ref id="scirp.61473-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Castro, L. and Freeman, B.A. (2001) Reactive Oxygen Species in Human Health and Disease. Nutrition, 17, 161-165.  
&lt;br&gt;http://dx.doi.org/10.1016/s0899-9007(00)00570-0</mixed-citation></ref><ref id="scirp.61473-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Yousef, M., Kamel, K.I., Esmail, A.M. and Baghdadi, H.H. (2004) Antioxidant Activities and Lipid Lowering Effects of Isoflavone in Male Rabbits. Food Chemical Toxicology, 42, 1497-1503. &lt;br&gt;http://dx.doi.org/10.1016/j.fct.2004.04.012</mixed-citation></ref><ref id="scirp.61473-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Chan, W.H. and Yu, J.S. (2000) Inhibition of UV Irradiation Induced Oxidative Stresses and Apoptotic Biochemical Changes in Human Epidermal Carcinoma A431 Cells by Genistein. Journal of Cell Biochemistry, 78, 73-84.  
&lt;br&gt;http://dx.doi.org/10.1002/(SICI)1097-4644(20000701)78:1&lt;73::AID-JCB7&gt;3.0.CO;2-P</mixed-citation></ref><ref id="scirp.61473-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Liang, H.W., Qiu, S.F., Shen, J., Sun, L.N., Wang, J.Y., Bruce, I.C. and Xia, Q. (2008) Genistein Attenuates Oxidative Stress and Neuronal Damage Following Transient Global Cerebral Ischemia in Rat Hippocampus. Neuroscience Letters, 438, 116-120. &lt;br&gt;http://dx.doi.org/10.1016/j.neulet.2008.04.058</mixed-citation></ref><ref id="scirp.61473-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Sena, L.A. and Chandel, N.S. (2012) Physiological Roles of Mitochondrial Reactive Oxygen Species. Molecular Cell, 48, 158-167. &lt;br&gt;http://dx.doi.org/10.1016/j.molcel.2012.09.025</mixed-citation></ref><ref id="scirp.61473-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Fruehauf, J.P. and Meyskens Jr., F.L. (2007) Reactive Oxygen Species: A Breath of Life or Death? Clinical Cancer Research, 13, 789-794. &lt;br&gt;http://dx.doi.org/10.1158/1078-0432.CCR-06-2082</mixed-citation></ref><ref id="scirp.61473-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Ostuni, M.A., Gelinotte, M., Bizouarn, T., Baciou, L. and Houée-Levin, C. (2010) Targeting NADPH-Oxidase by Reactive Oxygen Species Reveals an Initial Sensitive Step in the Assembly Process. Free Radical Biology and Medicine, 49, 900-907. &lt;br&gt;http://dx.doi.org/10.1016/j.freeradbiomed.2010.06.021</mixed-citation></ref><ref id="scirp.61473-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Cho, K.J., Seo, J.M. and Kim, J.H. (2011) Bioactive Lipoxygenase Metabolites Stimulation of NADPH Oxidases and Reactive Oxygen Species. Molecular Cell, 32, 1-5. &lt;br&gt;http://dx.doi.org/10.1007/s10059-011-1021-7</mixed-citation></ref><ref id="scirp.61473-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Ye, F., Wu, J., Dunn, T., Yi, J., Tong, X. and Zhang, D. (2004) Inhibition of Cyclooxygenase-2 Activity in Head and Neck Cancer Cells by Genistein. Cancer Letter, 211, 39-46. &lt;br&gt;http://dx.doi.org/10.1016/j.canlet.2004.03.043</mixed-citation></ref><ref id="scirp.61473-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Elmarakby, A.A., Ibrahim, A.S., Faulkner, J., Mozaffari, M.S., Liou, G.I. and Abdelsayed, R. (2011) Tyrosine Kinase Inhibitor, Genistein, Reduces Renal Inflammation and Injury in Streptozotocin-Induced Diabetic Mice. Vascular Phar- macology, 55, 149-156. &lt;br&gt;http://dx.doi.org/10.1016/j.vph.2011.07.007</mixed-citation></ref><ref id="scirp.61473-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Bruzelius, K., Hoac, T., Sundler, R., Onning, G. and Akesson, B. (2007) Occurrence of Selenoprotein Enzymatic Activities and mRNA in Bovine Mammary Tissue. Journal of Dairy Science, 90, 918-927.  
&lt;br&gt;http://dx.doi.org/10.3168/jds.S0022-0302(07)71575-8</mixed-citation></ref><ref id="scirp.61473-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Choi, C., Cho, H., Park, J., Cho, C. and Song, Y. (2003) Suppressive Effects of Genistein Onoxidative Stress and NF-κB Activation in RAW 264.7 Macrophages. Bioscience, Biotechnology, and Biochemistry, 67, 1916-1922.  
&lt;br&gt;http://dx.doi.org/10.1271/bbb.67.1916</mixed-citation></ref><ref id="scirp.61473-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Arthur, J.R. (2000) The Glutathione Peroxidases. Cellular and Molecular Life Sciences, 57, 1825-1835.  
&lt;br&gt;http://dx.doi.org/10.1007/PL00000664</mixed-citation></ref><ref id="scirp.61473-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Brigelius-Flohe, R., Aumann, K.D., Blocker, H., Gross, G., Kiess, M., Kloopel, K.D., Maiorino, M., Roveri, A., Schuckelt, R. and Usani, F. (1994) Phospholipid-Hydroperoxide Glutathione Peroxidase-Genomic DNA, cDNA, and Deduced Amino Acid Sequence. Journal of Biological Chemistry, 269, 7342-7348.</mixed-citation></ref><ref id="scirp.61473-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Conrad, M., Schneider, M., Seiler, A. and Bornkamm, G.W. (2007) Physiological Role of Phospholipid Hydroperoxide Glutathione Peroxidase in Mammals. Biological Chemistry, 388, 1019-1025. &lt;br&gt;http://dx.doi.org/10.1515/BC.2007.130</mixed-citation></ref><ref id="scirp.61473-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Avissar, N., Slemmon, J.R., Palmer, I.S. and Cohen, H.J. (1991) Partial Sequence of Human Plasma Glutathione Peroxidase and Immunologic Identification of Milk Glutathione Peroxidase as the Plasma Enzyme. Journal of Nutrition, 121, 1243-1249.</mixed-citation></ref><ref id="scirp.61473-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Lindmark-Masson, H. and Akesson, B. (2001) Purification and Immunochemical Assay of Bovine Extracellular Glutathione Peroxidase. International Dairy Journal, 11, 649-655. &lt;br&gt;http://dx.doi.org/10.1016/S0958-6946(01)00098-X</mixed-citation></ref><ref id="scirp.61473-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Hill, K.E., Motley, A.K., Hu, M., Austin, L.M. and Burk, R.F. (2004) Deletion of Selenoprotein P in Female Mice Results in Poor Selenium Status of Their Fetuses and Neonates. FASEB Journal, 18, A849.</mixed-citation></ref><ref id="scirp.61473-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Chu, F.F., Esworthy, R.S., Doroshow, J.H., Doan, K. and Liu, X.F. (1992) Expression of Plasma Glutathione Peroxidase in Human Liver in Addition to Kidney, Heart, Lung, and Breast in Humans and Rodents. Blood, 79, 32-33.</mixed-citation></ref><ref id="scirp.61473-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Bruzelius, K., Sundler, R., Pagmantidis, V. and Akesson, B. (2010) Regulation of Selenoprotein mRNA Expression by Hormones and Retinoic Acid in Bovine Mammary Cells. Journal of Trace Elements in Medicine and Biology, 24, 251-256. &lt;br&gt;http://dx.doi.org/10.1016/j.jtemb.2010.08.001</mixed-citation></ref></ref-list></back></article>