<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">OJMS</journal-id><journal-title-group><journal-title>Open Journal of Marine Science</journal-title></journal-title-group><issn pub-type="epub">2161-7384</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ojms.2015.54032</article-id><article-id pub-id-type="publisher-id">OJMS-60255</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Earth&amp;Environmental Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Distribution of Chitinolytic Enzymes in the Organs and cDNA Cloning of Chitinase Isozymes from the Stomach of Two Species of Fish, Chub Mackerel (&lt;i&gt;Scomber japonicus&lt;/i&gt;) and Silver Croaker (&lt;i&gt;Pennahia argentata&lt;/i&gt;)
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>iromi</surname><given-names>Kakizaki</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Mana</surname><given-names>Ikeda</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Hideto</surname><given-names>Fukushima</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Masahiro</surname><given-names>Matsumiya</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>College of Bioresource Sciences, Nihon University, Fujisawa, Japan</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>matsumiya@brs.nihon-u.ac.jp(MM)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>17</day><month>09</month><year>2015</year></pub-date><volume>05</volume><issue>04</issue><fpage>398</fpage><lpage>411</lpage><history><date date-type="received"><day>26</day>	<month>August</month>	<year>2015</year></date><date date-type="rev-recd"><day>accepted</day>	<month>10</month>	<year>October</year>	</date><date date-type="accepted"><day>13</day>	<month>October</month>	<year>2015</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Chitinolytic activities were measured in two fish species having different feeding habits, chub mackerel (
  Scomber japonicus
  ) and silver croaker (
  Pennahia argentata
  ). Chitinase (an endo-type chitinolytic enzyme) activity was measured using pNP-(GlcNAc)
  <sub>n</sub>
   
  (n = 2, 3) as substrates; its level was significantly high in the stomachs of both species, as well as in the gills, intestine, pyloric appendage, testis, and liver of chub mackerel and in the spleen, kidney, pyloric appendage, ovaries, heart, and liver of silver croaker.
   
  β
  -
  N
  -Acetylhexosaminidase (an exo-type chitinolytic enzyme) activity was measured using pNP-(GlcNAc) as a substrate; it was detected at high levels in many parts apart from the digestive tracts of both species.
   
  The optimum pH for chitinase activity was 3.0 -
   
  5.0 in the stomachs of both species, 4.0 in the liver of chub mackerel, and 4.0 and 8.0 in the kidney of silver croaker. Full-length cDNAs encoding two chitinase isozymes were obtained from the stomachs of the two fish species:
   
  SjChi-
  1 (1604 bp) and
   
  SjChi-
  2 (1512 bp) from chub mackerel and
   
  PaChi-
  1 (1630 bp) and
   
  PaChi-
  2 (1606 bp) from silver croaker. Expression analysis of these genes in the organs of the two species revealed strong expression of
   
  SjChi-
  1 in the stomach of chub mackerel and that of
   
  PaChi-
  1 and
  PaChi-
  2 in the stomach of silver croaker. The difference in the expression pattern of these genes is likely attributed to the difference in the feeding habits of the two fish species. Our results suggested the presence of novel chitinases in the two species.
 
</p></abstract><kwd-group><kwd>Chitinolytic Enzyme</kwd><kwd> Chitinase</kwd><kwd> &lt;i&gt;β&lt;/i&gt;-&lt;i&gt;N&lt;/i&gt;-Acetylhexosaminidase</kwd><kwd> Distribution</kwd><kwd> Phylogenetic Tree Analysis</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Chitin is an amino polysaccharide containing N-acetyl-d-glucosamine (GlcNAc) units connected with β-1,4 linkages. It is a renewable biological resource that is abundantly present worldwide and is found in the exoskeletons of arthropods, cell walls of fungi, and the epidermis of nematodes [<xref ref-type="bibr" rid="scirp.60255-ref1">1</xref>] -[<xref ref-type="bibr" rid="scirp.60255-ref3">3</xref>] . The majority of naturally occurring chitin exists in the rigid, α-crystalline structure that is insoluble in common solvents, thus rendering it difficult for use [<xref ref-type="bibr" rid="scirp.60255-ref4">4</xref>] . However, degradation products of chitin exhibit various bioactivities, which have been attributed to the length and solubility of a polymer [<xref ref-type="bibr" rid="scirp.60255-ref5">5</xref>] ; these include the promotion of bifidobacteria proliferation and immunostimulatory effect in chitooligosaccharides ((GlcNAc)<sub>n</sub>) [<xref ref-type="bibr" rid="scirp.60255-ref6">6</xref>] and improvement of osteoarthritis in GlcNAc [<xref ref-type="bibr" rid="scirp.60255-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.60255-ref8">8</xref>] .</p><p>Chitinolytic enzymes degrade chitin and are classified according to the degradation mechanisms as endo-type chitinolytic enzyme, which produce (GlcNAc)<sub>n</sub> by randomly degrading chitin internally, and exo-type chitinolytic enzyme, which produce GlcNAc by degrading chitin sequentially from the nonreducing ends [<xref ref-type="bibr" rid="scirp.60255-ref9">9</xref>] . The former is referred to as chitinase (EC 3.2.1.14) and belongs to the glycoside hydrolase GH family 18 or 19 based on the amino acid sequence homology within the catalytic domain [<xref ref-type="bibr" rid="scirp.60255-ref10">10</xref>] . The latter is referred to as β-N-acetylhex- osaminidase (Hex) (EC 3.2.1.52) [<xref ref-type="bibr" rid="scirp.60255-ref11">11</xref>] .</p><p>Although the majority of studies on chitinase have been conducted on microorganisms [<xref ref-type="bibr" rid="scirp.60255-ref12">12</xref>] , chitinase is also found and has been investigated in many other biological species, including mammals [<xref ref-type="bibr" rid="scirp.60255-ref13">13</xref>] -[<xref ref-type="bibr" rid="scirp.60255-ref15">15</xref>] , fish [<xref ref-type="bibr" rid="scirp.60255-ref16">16</xref>] -[<xref ref-type="bibr" rid="scirp.60255-ref19">19</xref>] , mollusks [<xref ref-type="bibr" rid="scirp.60255-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.60255-ref21">21</xref>] , insects [<xref ref-type="bibr" rid="scirp.60255-ref22">22</xref>] -[<xref ref-type="bibr" rid="scirp.60255-ref24">24</xref>] , plants [<xref ref-type="bibr" rid="scirp.60255-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.60255-ref25">25</xref>] , and fungi [<xref ref-type="bibr" rid="scirp.60255-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.60255-ref22">22</xref>] . Since the physiological role of chitinase varies in these organisms, the mechanism and efficiency of chitinase degradation and the substrate specificity have been reported to vary. For instance, acidic mammalian chitinase expressed in the stomach of mammals [<xref ref-type="bibr" rid="scirp.60255-ref26">26</xref>] , and chitotriosidase produced by macrophages [<xref ref-type="bibr" rid="scirp.60255-ref14">14</xref>] [<xref ref-type="bibr" rid="scirp.60255-ref15">15</xref>] are thought to function in the digestion and absorption of food and defense against pathogens. In addition, chitinase has been detected at the onset of asthma and allergies, suggesting its involvement in diseases [<xref ref-type="bibr" rid="scirp.60255-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.60255-ref15">15</xref>] . In contrast, chitinase and Hex are also found in the digestive tracts of fish. The enzyme activities are generally associated with feeding habits, and their levels are high in fish that feed on organisms containing chitin [<xref ref-type="bibr" rid="scirp.60255-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.60255-ref27">27</xref>] . However, the distribution of chitinase and Hex in the body of fish is not known.</p><p>Our laboratory has been investigating the purification, characteristics, and cDNA cloning of chitinases by using various samples, including fish (osteichthyes [<xref ref-type="bibr" rid="scirp.60255-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.60255-ref28">28</xref>] -[<xref ref-type="bibr" rid="scirp.60255-ref30">30</xref>] and chondrichthyes [<xref ref-type="bibr" rid="scirp.60255-ref18">18</xref>] ), mollusca [<xref ref-type="bibr" rid="scirp.60255-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.60255-ref21">21</xref>] , and crustacea [<xref ref-type="bibr" rid="scirp.60255-ref31">31</xref>] . We purified chitinase isozymes that function at acidic pH and are involved in digestion from the stomachs of osteichthyes [<xref ref-type="bibr" rid="scirp.60255-ref28">28</xref>] -[<xref ref-type="bibr" rid="scirp.60255-ref30">30</xref>] . In addition, a subset of these chitinases was found to have superior degradation ability against crystalline α-chitin and broader substrate specificity compared to that of chitinases from other organisms [<xref ref-type="bibr" rid="scirp.60255-ref32">32</xref>] . Moreover, two genes encoding chitinase isozymes were found in the stomachs of these osteichthyes, and the deduced amino acid sequences revealed using phylogenetic analysis showed that these enzymes form two groups, acidic fish chitinase-1 (AFCase-1) and acidic fish chitinase-2 (AFCase-2), which are unique to fish [<xref ref-type="bibr" rid="scirp.60255-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.60255-ref28">28</xref>] . However, which of these chitinase isozymes, AFCase-1 or AFCase-2, act dominantly in response to habitat and feeding habits is not known.</p><p>In this study, we determined the distribution of chitinase and Hex activities in chub mackerel, which lives in the ocean surface and feeds on chitin from zooplankton [<xref ref-type="bibr" rid="scirp.60255-ref32">32</xref>] , and in silver croaker, which lives in the sandy, mud ocean floor and feeds on rigid chitin from shrimps and crabs [<xref ref-type="bibr" rid="scirp.60255-ref29">29</xref>] [<xref ref-type="bibr" rid="scirp.60255-ref30">30</xref>] : chitinase has been previously purified and characterized from the stomachs of both species. This study aimed to confirm the presence or absence of chitinase and Hex in the organs apart from the digestive tract. In addition, the optimum pH was measured in the stomach and liver of chub mackerel and the stomach and kidney of silver croaker, in which chitinase activities had been detected, in order to identify novel chitinases that are distinct from those found in the stomach and act under acidic conditions. cDNA cloning and organ expression analysis were also performed for the chitinase isozymes obtained from the stomachs of the two species, and the association between the expression of stomach chitinase isozymes and the feeding habits of fish was discussed.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Materials</title><p>Chub mackerel (mean body length: 40 cm) and silver croaker (mean body length: 25 cm) were freshly obtained on the day they were caught (June and August, respectively), and chitinolytic activity was measured and cDNA cloning were performed on the same day.</p></sec><sec id="s2_2"><title>2.2. Measurement of Chitinolytic Enzyme Activity</title><p>The organs to be analyzed were removed from the chub mackerel and silver croaker. Next, 0.5 g of each organ was homogenized in three volumes of 20 mM phosphate buffer (pH 7.3), and then the homogenate was centrifuged at 9000 &#215; g for 20 min. The supernatant was used as the crude enzyme solution. Chitinase and Hex activities were measured using p-nitrophenyl (GlcNAc)<sub>n</sub>, (pNP-(GlcNAc)<sub>n</sub>) (n = 2, 3) (Seikagaku, Tokyo, Japan) and pNP-GlcNAc (Seikagaku), respectively, as substrates according to the method described by Ohtakara [<xref ref-type="bibr" rid="scirp.60255-ref33">33</xref>] , with slight modification. Briefly, 2.5 μL of crude enzyme solution and 2.5 μL of substrate solution were added to 6.5 μL of 0.2 M phosphate-0.1 M citrate buffer (pH 6.0), and then the solution was incubated at 37˚C for 20 min. After incubation, 65 μL of 0.2 M sodium carbonate solution was added to the solution, and the absorbance of released p-nitrophenol was measured at 420 nm. A unit of chitinolytic enzyme activity (U) was defined as the amount of enzyme that liberated 1 μmol of p-nitrophenol per minute and was expressed as the activity per gram of the organs.</p></sec><sec id="s2_3"><title>2.3. The Effect of pH of Chitinase and Hex Activity</title><p>The optimum pH was measured for the crude enzyme solutions obtained from the stomach and liver of chub mackerel and the stomach and kidney of silver croaker by using 0.2 M phosphate-0.1 M citrate buffer (pH = 2 - 8) and the mixture of 0.1 M glycine and 0.1 M NaCl-0.1 M NaOH (pH = 9), respectively, by using the same technique as was used for the measurement of chitinolytic activity.</p></sec><sec id="s2_4"><title>2.4. cDNA Cloning of Chitinases Obtained from the Stomachs of Chub Mackerel and Silver Croaker</title><p>Total RNA was extracted from the stomachs of the chub mackerel and silver croaker by using ISOGEN (Nippon Gene, Tokyo, Japan) according to the manufacturer’s instructions. The extracted total RNA was treated with RQ1 RNase-Free DNase (Promega, Madison, WI) according to the manufacturer’s instructions. Next, cDNA was synthesized using 1.0 μg of total RNA; a reverse transcriptase M-MLV (Takara Bio, Shiga, Japan); and an oligo dT primer (<xref ref-type="table" rid="table1">Table 1</xref>). The reaction conditions were 65˚C for 5 min, 42˚C for 60 min, and 70˚C for 10 min. Full-length cDNA from the chub mackerel and silver croaker stomach chitinases was amplified. The primers used are listed in <xref ref-type="table" rid="table1">Table 1</xref>, and the primer combinations are shown in <xref ref-type="fig" rid="fig1">Figure 1</xref>. Internal sequences were amplified using a solution containing the synthesized cDNA, Takara Ex Taq (Takara Bio), and degenerate primers designed using the conserved amino acid sequences of GH family 18 chitinases from several organisms. PCR parameters for the first PCR were as follows: initial denaturation at 95˚C for 30 s, followed by 35 cycles of 95˚C for 30 s, 55˚C for 1 min, and 72˚C for 2 min. Nested PCR was performed using the same PCR parameters except that the sample was 10-fold diluted for the first PCR products. Forward and reverse primers were designed from the chitinase gene sequences obtained by the internal sequence amplification, and the upstream (5ʹ) and downstream (3ʹ) regions were amplified using rapid amplification of cDNA ends (RACE) method. The 5ʹ and 3ʹRACE analyses were performed using kits provided by Invitrogen (Carlsbad, CA) according to the manufacturer’s instructions. Internal sequences and PCR products obtained by RACE were electrophoresed on 2% agarose gel, and DNA was extracted using Quantum Prep<sup>&#174;</sup> Freeze’N Squeeze spin columns (Bio Rad, Hercules, CA) and ligated into the pGEM-T Easy Vector (Promega). Full-length chitinase genes obtained from the stomach of chub mackerel (SjChi-1 and SjChi-2) and the stomach of silver croaker (PaChi-1 and PaChi-2) were amplified using platinum<sup>&#174;</sup> pfx DNA polymerase (Invitrogen), which has proofreading activity. The protocol was 35 cycles of 94˚C for 15 s, 55˚C for 30 s, and 68˚C for 2 min. The full-length genes obtained were extracted using the same method that was used for the internal sequence amplification and ligated into the pCR<sup>&#174;</sup> Blunt II-TOPO<sup>&#174;</sup> vector (Invitrogen). Base sequences were determined using the Big Dye Terminator Cycle Sequencing FS Ready Reaction Kit (Applied Biosystems, Foster City, CA).</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Primers used in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" >Primer name</th><th align="center" valign="middle" >Sequence (5'-3')</th><th align="center" valign="middle" >Length</th><th align="center" valign="middle" >Usage</th></tr></thead><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Oligo dT</td><td align="center" valign="middle" >CTGTGAATGCTGCGACTACGATTTTTTTTTTTTTTTTTTT</td><td align="center" valign="middle" >40mer</td><td align="center" valign="middle" >cDNA synthesis</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Chi-a (F)</td><td align="center" valign="middle" >TGYTAYTTYACNAAYTGG</td><td align="center" valign="middle" >19mer</td><td align="center" valign="middle" >Conserved region PCR</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Chi-b (F)</td><td align="center" valign="middle" >GAYATHGAYTGGGARTAYCC</td><td align="center" valign="middle" >19mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >Chi-c (R)</td><td align="center" valign="middle" >TTCCARTARTTCATNGCRTARTC</td><td align="center" valign="middle" >19mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >3’RACE (R)</td><td align="center" valign="middle" >CTGTGAATGCGACTACGAT</td><td align="center" valign="middle" >19mer</td><td align="center" valign="middle" >3'RACE PCR</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >AAP (F)</td><td align="center" valign="middle" >GGCCACGCGTCGACTAGTACGGGIIGGGIIGGGIIG</td><td align="center" valign="middle" >36mer</td><td align="center" valign="middle" >5'RACE PCR</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >AUAP (F)</td><td align="center" valign="middle" >GGCCACGCGTCGACTAGTACC</td><td align="center" valign="middle" >21mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >β-actin 1 (F)</td><td align="center" valign="middle" >AGCCAACAGAGGAGGCTCTTA</td><td align="center" valign="middle" >21mer</td><td align="center" valign="middle" >Tissue expression PCR</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >β-actin 2 (R)</td><td align="center" valign="middle" >GATTCCTAAGAGTGAATG</td><td align="center" valign="middle" >18mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Chub mackerel</td><td align="center" valign="middle" >SjChi1-1(F)</td><td align="center" valign="middle" >ACCAACATTGACCCATGTCTCTGTG</td><td align="center" valign="middle" >25mer</td><td align="center" valign="middle" >3'RACE PCR</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi1-2(F)</td><td align="center" valign="middle" >ATGGACAACAACATGATCAAGAC</td><td align="center" valign="middle" >23mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi2-1(F)</td><td align="center" valign="middle" >GGTGAGTGCAGTCCCCTGTTCA</td><td align="center" valign="middle" >22mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi1-3(R)</td><td align="center" valign="middle" >CTCCAATGGCCAACAGAGTCTTCA</td><td align="center" valign="middle" >24mer</td><td align="center" valign="middle" >5'RACE PCR</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi1-4(R)</td><td align="center" valign="middle" >TGGAACTGTCCGTAGAGTTTTTC</td><td align="center" valign="middle" >23mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi1-5(R)</td><td align="center" valign="middle" >GTTGTTGTCCATTGATGCAAAGG</td><td align="center" valign="middle" >23mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi1-6(R)</td><td align="center" valign="middle" >GGTCAATGTTGGTGGGTAGGTACT</td><td align="center" valign="middle" >24mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi2-2(R)</td><td align="center" valign="middle" >AAGACGAATAGTCTAAGGGTT</td><td align="center" valign="middle" >21mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi2-3(R)</td><td align="center" valign="middle" >GAATCAATGGTGTCCTTTCCA</td><td align="center" valign="middle" >21mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi2-4(R)</td><td align="center" valign="middle" >ACAGCAGCAGACATCAGAAGACG</td><td align="center" valign="middle" >24mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi1-7(F)</td><td align="center" valign="middle" >TACAGAAGCAATATGGGCAAACTACTC</td><td align="center" valign="middle" >27mer</td><td align="center" valign="middle" >Full length amplification</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi1-8(R)</td><td align="center" valign="middle" >AGTGGAATGGTCTTGTGTTTCATGATA</td><td align="center" valign="middle" >27mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi2-5(F)</td><td align="center" valign="middle" >CGGTAGCCATGGGGAAAGTACTG</td><td align="center" valign="middle" >23mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi2-6(R)</td><td align="center" valign="middle" >ACAACAGTTATCCAGTCAATTTAT</td><td align="center" valign="middle" >24mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi1-9(F)</td><td align="center" valign="middle" >CATCCACGTCATGTCCTACGA</td><td align="center" valign="middle" >21mer</td><td align="center" valign="middle" >Tissue expression PCR</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi1-10(R)</td><td align="center" valign="middle" >CGTTGTTGTAGGCATATGGCA</td><td align="center" valign="middle" >21mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi2-8(F)</td><td align="center" valign="middle" >GTCATATGACTTCCATGGCTC</td><td align="center" valign="middle" >21mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >SjChi2-9(R)</td><td align="center" valign="middle" >CCCACTGATTTCCCTTGTAAG</td><td align="center" valign="middle" >21mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >Silver croaker</td><td align="center" valign="middle" >PaChi1-1(F)</td><td align="center" valign="middle" >GGACTACTTCCACGTCATG</td><td align="center" valign="middle" >19mer</td><td align="center" valign="middle" >3’RACE PCR</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi2-1(F)</td><td align="center" valign="middle" >TGTGGACTACGCCATGAACTAC</td><td align="center" valign="middle" >19mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi1-2(R)</td><td align="center" valign="middle" >CCACATTGAAGTAGATCAT</td><td align="center" valign="middle" >19mer</td><td align="center" valign="middle" >5’RACE PCR</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi1-3(R)</td><td align="center" valign="middle" >CATGACGTGGAAGTAGTCC</td><td align="center" valign="middle" >19mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi1-4(R)</td><td align="center" valign="middle" >GCGAGGACGGTTGGTCTTCT</td><td align="center" valign="middle" >20mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi2-3(R)</td><td align="center" valign="middle" >GTAGTTCATGGCGTAGTCCACA</td><td align="center" valign="middle" >22mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi2-4(R)</td><td align="center" valign="middle" >GAAATAGATGAAGCCACCC</td><td align="center" valign="middle" >19mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi2-5(R)</td><td align="center" valign="middle" >GGCCGAGCTTGGGGATCTGAT</td><td align="center" valign="middle" >21mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi1-5(F)</td><td align="center" valign="middle" >TACAGAAGCACCATGGGCAAGCTAC</td><td align="center" valign="middle" >25mer</td><td align="center" valign="middle" >Full length amplification</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi1-6(R)</td><td align="center" valign="middle" >GCTTTAAATGCGACGTTTATTTAA</td><td align="center" valign="middle" >24mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi2-6(F)</td><td align="center" valign="middle" >TACACGGTAGCCATGGGGAAA</td><td align="center" valign="middle" >21mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi2-7(R)</td><td align="center" valign="middle" >GCTTTCAAATCAACCACTCAAGACG</td><td align="center" valign="middle" >25mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi1-7(F)</td><td align="center" valign="middle" >GAGCACAATGTCGGAGAGAAC</td><td align="center" valign="middle" >21mer</td><td align="center" valign="middle" >Tissue expression PCR</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi1-8(R)</td><td align="center" valign="middle" >ACCACTCTGCTTCAGCCACTG</td><td align="center" valign="middle" >21mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi2-8(F)</td><td align="center" valign="middle" >GACCCCATGACTGGTGAGTGC</td><td align="center" valign="middle" >21mer</td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >PaChi2-9(R)</td><td align="center" valign="middle" >GTTACTCTTAGTCAGCCAGTC</td><td align="center" valign="middle" >21mer</td><td align="center" valign="middle" ></td></tr></tbody></table></table-wrap><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Primers position. (a) Chub mackerel; (b) Silver croaker</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-1470215x6.png"/></fig></sec><sec id="s2_5"><title>2.5. Expression of SjChi-1, SjChi-2, PaChi-1, and PaChi-2 in the Organs</title><p>Total RNA was extracted from the organs of chub mackerel and silver croaker. cDNA was synthesized using 0.5 μg of total RNA obtained from each tissue and an oligo dT primer and amplified using PCR by using 1.0 μg of the synthesized cDNA; primers for SjChi-1, SjChi-2, PaChi-1, and PaChi-2; and fish β-actin amplification primers (<xref ref-type="table" rid="table1">Table 1</xref>) in the combinations shown in <xref ref-type="fig" rid="fig1">Figure 1</xref>. The PCR included 30 cycles of 94˚C for 30 s, 55˚C for 1 min, and 72˚C for 2 min.</p></sec><sec id="s2_6"><title>2.6. Phylogenetic Analysis of the Chitinases</title><p>Phylogenetic tree analysis, based on the deduced amino acid sequences of the full-length genes of SjChi-1, SjChi-2, PaChi-1, and PaChi-2, was performed using the chitinase genes obtained from many organisms. The analysis was performed using ClustalW2 (EMBL-EBI) and Tree view programs.</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><sec id="s3_1"><title>3.1. Distribution of Chitinolytic Enzymes</title><p>Chitinolytic activity showed the highest levels of chitinase activity against pNP-(GlcNAc)<sub>2</sub> and pNP-(GlcNAc)<sub>3</sub> in the stomachs of chub mackerel and silver croaker. Chitinase activity was also detected in the gills, intestine, pyloric appendage, testes, and liver of chub mackerel (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)) and in the spleen, kidney, pyloric appendage, ovaries, heart, and liver of silver croaker (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)). The results are consistent with those of a previous study in which chitinase activity was found to be high in the stomach, a part of the digestive tract, in fish [<xref ref-type="bibr" rid="scirp.60255-ref16">16</xref>] . In addition, to our knowledge, this is the first study showing that chitinase activity is distributed beyond the digestive tract in the gills, testes, and liver of chub mackerel and in the spleen, kidney, ovaries, heart, and liver in silver croaker. In contrast, high levels of Hex activity were detected in all organs except the gills and heart in both species, which showed slightly lower activities (<xref ref-type="fig" rid="fig2">Figure 2</xref>(c), <xref ref-type="fig" rid="fig2">Figure 2</xref>(d)). Thus, the two species likely digest dietary chitin down to GlcNAc owing to the high levels of chitinase activity in the stomachs, as well as Hex activity in the subsequent pyloric appendage, where food is digested after passing through the stomach, and in the intestine. In addition, in chub mackerel, chitinase activity was observed in the pyloric appendage, which is significantly developed as a part of the digestive system, suggesting that chitinase contributes to the digestion of dietary chitin in the pyloric appendage as well. Moreover, the presence of chitinase and Hex activities in the organs apart from the digestive tract suggests that fish use chitinolytic enzymes for other physiological functions in addition to the digestion of dietary chitin.</p><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> The distribution of the chitinolytic activities in the organs. (a) Chub mackerel; (b) silver croaker; (c) chub mackerel; (d) silver croaker. Results show the average of three individuals. Bars represent the standard deviation. (■) pNP-(GlcNAc)<sub>2</sub>, (□) pNP-(GlcNAc)<sub>3</sub>, (▧) pNP-(GlcNAc)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-1470215x7.png"/></fig></sec><sec id="s3_2"><title>3.2. The Effect of pH on Chitinase Activities</title><p>The effect of pH on chitinase activities was determined in the stomach and liver of chub mackerel and the stomach and kidney of silver croaker in order to compare the optimum pH for chitinase activity in the digestive tract and the other organs. Maximum activity was observed at pH of 3.0 against pNP-(GlcNAc)<sub>2</sub> and at pH 5.0 against pNP-(GlcNAc)<sub>3</sub> in the stomach of chub mackerel, whereas, at pH 7.0, the activity against the two substrates remained less than 35% of the maximum activity. In contrast, the optimum pH was found to be 4.0 against both substrates in the liver of chub mackerel, and approximately 70% of the maximum activity was retained even at pH 7.0. More than 80% of the maximum activity was observed at pH 3.0 to 6.0 against the two substrates in the stomach of silver croaker, whereas the activity reduced to less than 15% of the maximum activity at pH 8.0. Maximum activity was observed at pH 4.0 and 8.0 against both substrates in the kidney (<xref ref-type="fig" rid="fig3">Figure 3</xref>). For Hex activity, the optimum pH was found to be around 4.0 to 5.0 in both organs of the two species (data not shown).</p><p>The acidic optimum pH for chitinase activity observed in the stomachs of the two species, liver of chub mackerel, and kidney of silver croaker was similar to that observed for chitinase isozymes purified from the stomachs of marbled rockfish [<xref ref-type="bibr" rid="scirp.60255-ref17">17</xref>] , threeline grunt [<xref ref-type="bibr" rid="scirp.60255-ref28">28</xref>] , and silver croaker [<xref ref-type="bibr" rid="scirp.60255-ref29">29</xref>] [<xref ref-type="bibr" rid="scirp.60255-ref30">30</xref>] . However, the presence of a chitinase with novel characteristics that retains its activity at around neutral pH was suggested in the liver of chub mackerel. Some chitinases have double optimum pH values toward long substrate, glycol chitin and/or colloidal chitin, but those chitinase have single optimal pH value toward short substrate used this study, pNP- (GlcNAc)<sub>2</sub> and pNP-(GlcNAc)<sub>3</sub> [<xref ref-type="bibr" rid="scirp.60255-ref29">29</xref>] -[<xref ref-type="bibr" rid="scirp.60255-ref31">31</xref>] . The optimum pH of 8.0 for chitinase activity observed in the kidney of</p><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Effect of pH on chitinase activity. The optimum pH when pNP-(GlcNAc)<sub>2</sub> and pNP-(GlcNAc)<sub>3</sub> were used as the substrate was measured by incubating the enzyme-substrate complex at 37˚C for 20 min in 0.2 M sodium phosphate-0.1 M citric acid buffer (pH 2.0 - 8.0) and 0.1 M glycine + 0.1 M NaCl-0.1 M NaOH buffer (pH 9.0). (●) pNP-(GlcNAc)<sub>2</sub>, (△) pNP-(GlcNAc)<sub>3</sub>. (a) Stomach, chub mackerel; (b) liver, chub mackerel; (c) stomach, silver croaker; (d) kidney, silver croaker</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-1470215x8.png"/></fig><p>silver croaker was similar to that of 7.0 and 9.0 for chitinase activity in the serum of Nile tilapia [<xref ref-type="bibr" rid="scirp.60255-ref34">34</xref>] . This suggests the presence of a chitinase isozyme in the kidney of silver croaker that acts at pH 8.0, in addition to the chitinase isozyme similar to those expressed in the stomach that act under acidic conditions.</p></sec><sec id="s3_3"><title>3.3. cDNA Cloning of Chitinases Obtained from Chub Mackerel and Silver Croaker</title><p>Two genes of approximately 350 bp were obtained after amplification of the internal sequence of chitinase genes obtained from the stomachs of chub mackerel and silver croaker. Sequence analysis by NCBI Blast revealed high degrees of homology with threeline grunt stomach chitinase genes (PtChi-1 and PtChi-2) [<xref ref-type="bibr" rid="scirp.60255-ref28">28</xref>] and marbled rockfish stomach chitinase genes (SmChi-1 and SmChi-2) [<xref ref-type="bibr" rid="scirp.60255-ref17">17</xref>] . Thus, the upstream and downstream regions of chitinase genes were amplified using RACE method. The start and stop codons were found in the upstream and downstream regions, respectively, of all four genes obtained. Full-length cDNAs were then amplified using Platinum<sup>&#174;</sup>Pfx DNA polymerase. Thus, full-length cDNAs of two genes, SjChi-1 (1604 bp) and SjChi-2 (1512 bp), were obtained from the stomach of chub mackerel, which contained 1422 bp and 1467 bp open reading frames (ORFs), respectively (<xref ref-type="fig" rid="fig4">Figure 4</xref>). In addition, full-length cDNAs of two genes, PaChi-1 (1630 bp) and PaChi-2 (1606 bp), were obtained from the stomach of silver croaker, which contained 1446 bp and 1470 bp ORFs, respectively (<xref ref-type="fig" rid="fig5">Figure 5</xref>). The deduced amino acid sequence revealed that the genes consisted of a signal peptide, GH 18 catalytic domain, linker region, and chitin-binding domain, and the GH 18 catalytic domain contained a sequence unique to the active site of GH family 18 chitinase of vertebrates. Moreover, sections of the amino acid sequence for SjChi-1, PaChi-1, and PaChi-2 were found to match the N-terminus amino acid sequences for SjChi [<xref ref-type="bibr" rid="scirp.60255-ref32">32</xref>] , PaChiA [<xref ref-type="bibr" rid="scirp.60255-ref29">29</xref>] , and PaChiB [<xref ref-type="bibr" rid="scirp.60255-ref30">30</xref>] , respectively, that were previously purified at our laboratory, suggesting that the three genes encoded SjChi, PaChiA, and PaChiB, respectively. DDBJ accession numbers have been obtained for the four full-length genetic sequences: AB686657 for SjChi-1, AB689022 for SjChi-2, AB605774 for PaChi-1, and AB605775 for PaChi-2.</p></sec><sec id="s3_4"><title>3.4. Phylogenetic Analysis of Chitinases from Different Species</title><p>Phylogenetic tree analysis was performed based on sequence homology among the amino acid sequences of SjChi-1, SjChi-2, PaChi-2, and PaChi-2 as well as those of chitinases from other biological species, where SjChi-1 and SjChi-2 as well as PaChi-1 and PaChi-2 were found to be classified into AFCase-1 and AFCase-2, respectively, that include fish stomach chitinases (<xref ref-type="fig" rid="fig6">Figure 6</xref>). These results strongly support the hypothesis that chitinases from fish form distinct groups (AFCase-1 and AFC-2) [<xref ref-type="bibr" rid="scirp.60255-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.60255-ref28">28</xref>] .</p></sec><sec id="s3_5"><title>3.5. Expression of SjChi-1, SjChi-2, PaChi-1, and PaChi-2 in the Organs</title><p>The expression of SjChi-1, SjChi-2, PaChi-1, and PaChi-2 was examined in the organs of chub mackerel and silver croaker. SjChi-1 was strongly expressed in the stomach of chub mackerel, whereas the expression of SjChi-2 was insignificant. This suggests that chub mackerel, which lives in the ocean surface, mainly uses SjChi-1 for the degradation of α-chitin, which is a structural component of zooplankton exoskeletons. In addition, the expression of SjChi-1 was observed in the pyloric appendage, in which chitinase activity was detected, suggesting that SjChi-1 is an enzyme involved in the digestion of chitin in the pyloric appendage. In contrast, both PaChi-1 and PaChi-2chitinases were found to be strongly expressed in the stomach of silver croaker (<xref ref-type="fig" rid="fig7">Figure 7</xref>). We previously reported that chitinase isozymes PaChiA and PaChiB, purified from the stomach of silver croaker, possess degradation ability against a broad range of insoluble polymer substrates [<xref ref-type="bibr" rid="scirp.60255-ref29">29</xref>] [<xref ref-type="bibr" rid="scirp.60255-ref30">30</xref>] . Silver croaker, which lives in the sandy, mud ocean floor, likely expresses both chitinase isozymes for the digestion of chitin from diverse biological species, including α-chitin from crustacean such as shrimps and crabs as well as β-chitin from cephalopods such as squid and polychaetes such as ragworm. The weak expression of PaChi-1 in the ovaries suggests that the chitinase isozyme PaChiA also has a possibility to plays a role in the defense against the entry of nematodes that have chitin in their epidermis.</p><p>In the present study, chitinase activity was observed in the organ where the expression of chitinase genes of the two fish species was not detected, suggesting the presence of novel chitinases that are distinct from those encoded by chitinases belonging to AFCase-1 and AFCase-2. This finding, together with the results shown in <xref ref-type="fig" rid="fig3">Figure 3</xref>, implies that novel chitinase isozymes likely act under acidic and neutral conditions, and that the genes encoding these chitinases are likely involved in the defense mechanisms, as has been reported for chitinase 3 in</p><fig-group id="fig4"><label><xref ref-type="fig" rid="fig4">Figure 4</xref></label><caption><title>Deduced amino acid sequences and bases for SjChi-1 and SjChi-2.DDBJ accession Nos.:SjChi-1,AB686657;SjChi-2,AB689022.Underlined text indicates the N-terminal amino acid sequences of purified siChi.</title></caption><fig id ="fig4_1"><label></label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-1470215x9.png"/></fig></fig-group><fig-group id="fig5"><label><xref ref-type="fig" rid="fig5">Figure 5</xref></label><caption><title>Deduced amino acid sequences and bases for PaChi-1 and PaChi-2.DDBJ accession Nos.:PaChi-1,AB605774;PaChi-2,AB605775.Underlined text indicates the N-terminal amino acid sequences of purified PaChiA and PaChiB.</title></caption><fig id ="fig5_1"><label></label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-1470215x10.png"/></fig></fig-group><fig-group id="fig6"><label><xref ref-type="fig" rid="fig6">Figure 6</xref></label><caption><title> Phylogenetic tree for chitinase amino acid sequences developed using the neighbor joining method in the ClustalW program. Right table lists the scientific name, information and accession No. of chitinase used in phylogenetic tree analysis. The numbers in phylogenetic tree and table correspond each other. A chitinase from Serratia marcescens was used as an outgroup. The scale bar indicates the substitution rate per residue.</title></caption><fig id ="fig6_1"><label></label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-1470215x11.png"/></fig></fig-group><fig id="fig7"  position="float"><label><xref ref-type="fig" rid="fig7">Figure 7</xref></label><caption><title> Chitinase and β-actin expressions in various tissues (M, marker; 1, stomach; 2, gill; 3, intestine; 4, spleen; 5, kidney; 6, pyloric appendage; 7, ovaries; 8, heart; 9, liver; B, blank). (a) Chub mackerel; (b) silver croaker</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-1470215x12.png"/></fig><p>flounders [<xref ref-type="bibr" rid="scirp.60255-ref35">35</xref>] and chitotriosidase in the lungs of mammals [<xref ref-type="bibr" rid="scirp.60255-ref14">14</xref>] . cDNA cloning and expression analysis of novel chitinase genes are currently in progress.</p></sec></sec><sec id="s4"><title>4. Conclusion</title><p>The distribution patterns of chitinolytic enzymes in chub mackerel and silver croaker revealed, to our knowledge, for the first time that chitinase activities are broadly distributed in the organs of the two species, in addition to the digestive tract, including the stomach. Measurement of optimum pH for chitinase activity in chub mackerel and silver croaker revealed the presence of a chitinase that shows maximum activity at pH 4.0 and 70% of the maximum activity at pH 7.0 in the liver of chub mackerel, and a chitinase that shows maximum activity at pH 4.0 and 8.0 in the kidney of silver croaker. This suggests the presence of novel chitinases in the two fish species that act at around neutral pH, in addition to enzymes that are analogous to the previously reported fish stomach chitinases that have the optimum pH in the range of 3.0 to 5.0. Full-length cDNAs encoding the two chitinase genes for each species, SjChi1 and SjChi2, as well as PaChi1 and PaChi2, were obtained from the stomachs of the two species; these genes belong to AFCase-1 and AFCase-2, respectively. Expression analysis of these chitinase genes in the organs of the two fish species showed significant differences in the expression pattern in the stomachs, which was likely attributed to the difference in the feeding habits between the two species. In addition, the expression of these genes was observed only in some of the organs in which chitinase activity was detected, suggesting the presence of novel chitinases that are distinct from those encoded by genes belonging to AFCase-1 and AFCase-2.</p></sec><sec id="s5"><title>Acknowledgements</title><p>This work was supported in a part by a Grant-in-Aid for Scientific Research (C) (no. 25450309).</p></sec><sec id="s6"><title>Cite this paper</title><p>HiromiKakizaki,ManaIkeda,HidetoFukushima,MasahiroMatsumiya, (2015) Distribution of Chitinolytic Enzymes in the Organs and cDNA Cloning of Chitinase Isozymes from the Stomach of Two Species of Fish, Chub Mackerel (Scomber japonicus) and Silver Croaker (Pennahia argentata). Open Journal of Marine Science,05,398-411. doi: 10.4236/ojms.2015.54032</p></sec><sec id="s7"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.60255-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Karthik, N., Akanksha, K., Binod, P. and Pandey, A. (2014) Production, Purification and Properties of Fungal Chitinases—A Review. Indian Journal of Experimental Biology, 52, 1025-1035.</mixed-citation></ref><ref id="scirp.60255-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Khoushab, F. and Yamabhai, M. (2010) Chitin Research Revisited. Marine Drugs, 8, 1988-2012.  
http://dx.doi.org/10.3390/md8071988</mixed-citation></ref><ref id="scirp.60255-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Rinaudo, M. (2006) Chitin and Chitosan: Properties and Applications. Progress in Polymer Science, 31, 603-632.  
http://dx.doi.org/10.1016/j.progpolymsci.2006.06.001</mixed-citation></ref><ref id="scirp.60255-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Ravi Kumar, M.N.V. (2000) A Review of Chitin and Chitosan Applications. Reactive and Functional Polymers, 46, 1-27. http://dx.doi.org/10.1016/S1381-5148(00)00038-9</mixed-citation></ref><ref id="scirp.60255-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Liu, C.-L., Lan, C.-Y., Fu, C.-C. and Juang, R.-S. (2014) Production of Hexaoligochitin from Colloidal Chitin Using a Chitinase from Aeromonas schubertii. International Journal of Biological Macromolecules, 69, 59-63.  
http://dx.doi.org/10.1016/j.ijbiomac.2014.05.028</mixed-citation></ref><ref id="scirp.60255-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Mei, Y.-X., Chen, H.-X., Zhang, J., Zhang, X.-D. and Liang, Y.-X. (2013) Protective Effect of Chitooligosaccharides against Cyclophosphamide-Induced Immunosuppression in Mice. International Journal of Biological Macromolecules, 62, 330-335. http://dx.doi.org/10.1016/j.ijbiomac.2013.09.038</mixed-citation></ref><ref id="scirp.60255-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Kakizaki, H., Hamaguchi, K., Ikeda, M. and Matsumiya, M. (2014) Cloning of a Novel Chitinase cDNA from the Stomach of the Coelacanth Latimeria chalumnae (sarcopterygii). Journal of Chitin and Chitosan Science, 2, 123-129.  
http://dx.doi.org/10.1166/jcc.2014.1051</mixed-citation></ref><ref id="scirp.60255-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Kurita, K. (2006) Chitin and Chitosan: Functional Biopolymers from Marine Crustaceans. Marine Biotechnology, 8, 203-226. http://dx.doi.org/10.1007/s10126-005-0097-5</mixed-citation></ref><ref id="scirp.60255-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Patil, R.S., Ghormade, V. and Deshpande, M.V. (2000) Chitinolytic Enzymes: An Exploration. Enzyme and Microbial Technology, 26, 473-483. http://dx.doi.org/10.1016/S0141-0229(00)00134-4</mixed-citation></ref><ref id="scirp.60255-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Koch, B.E.V., Stougaard, J. and Spaink, H.P. (2014) Spatial and Temporal Expression Patterns of Chitinase Genes in Developing Zebrafish Embryos. Gene Expression Patterns, 14, 69-77. http://dx.doi.org/10.1016/j.gep.2014.01.001</mixed-citation></ref><ref id="scirp.60255-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Slamova, K., Bojarova, P., Petraskova, L. and Kren, V. (2010) β-N-Acetylhexosaminidase: What’s in a Name…? Biotechnology Advances, 28, 682-693. http://dx.doi.org/10.1016/j.biotechadv.2010.04.004</mixed-citation></ref><ref id="scirp.60255-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Bhattacharya, D., Nagpure, A. and Gupta, R.K. (2007) Bacterial Chitinases: Properties and Potential. Critical Reviews in Biotechnology, 27, 21-28. http://dx.doi.org/10.1080/07388550601168223</mixed-citation></ref><ref id="scirp.60255-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Shuhui, L., Mok, Y.-K. and Wong, W.S.F. (2009) Role of Mammalian Chitinase in Asthma. International Archives of Allergy and Immunology, 149, 369-377. http://dx.doi.org/10.1159/000205583</mixed-citation></ref><ref id="scirp.60255-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Boot, R.G., Blommaart, E.F.C., Swart, E., Vlugt, K.G.V.D., Bijl, N., Moe, C., Place, A. and Aerts, J.M.F.G. (2001) Identification of a Novel Acidic Mammalian Chitinase Distinct from Chitotriosidase. Journal of Biological Chemistry, 276, 6770-6778. http://dx.doi.org/10.1074/jbc.M009886200</mixed-citation></ref><ref id="scirp.60255-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Boot, R.G., Renkema, H., Strijland, A., Zonneveld, A.J.V. and Aerts, J.M.F.G. (1995) Cloning of a cDNA Encoding Chitotriosidase, a Human Chitinase Produced by Macrophages. Journal of Biological Chemistry, 270, 26252-26256. 
http://dx.doi.org/10.1074/jbc.270.44.26252</mixed-citation></ref><ref id="scirp.60255-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Matsumiya, M. and Mochizuki, A. (1996) Distribution of Chitinase and β-N-Acerylhexosaminidase in the Organs of Several Fishes. Fisheries Science, 62, 150-151. http://doi.org/10.2331/fishsci.62.150</mixed-citation></ref><ref id="scirp.60255-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Ikeda, M., Shirase, D., Sato, T., Ueda, M., Hirabayashi, S. and Matsumiya, M. (2014) Primary Structure and Enzymatic Properties of Chitinase Isozymes Purified from the Stomach of the Marbled Rockfish Sebastiscus marmoratus. Journal of Chitin and Chitosan Science, 2, 106-116. http://dx.doi.org/10.1166/jcc.2014.1048</mixed-citation></ref><ref id="scirp.60255-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Suzuki, T., Kakizaki, H., Ikeda, M. and Matsumiya, M. (2014) Molecular Cloning of a Novel Chitinase Gene from Blue Shark (Prionace glauca; Chondrichthyes) Stomach. Journal of Chitin and Chitosan Science, 2, 143-148. 
http://dx.doi.org/10.1166/jcc.2014.1050</mixed-citation></ref><ref id="scirp.60255-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Teng, Z., Sun, C., Liu, S., Wang, H. and Zhang, S. (2014) Functional Characterization of Chitinase-3 Reveals Involvement of Chitinases in Early Embryo Immunity in Zebrafish. Developmental &amp; Comparative Immunology, 46, 489-498. http://dx.doi.org/10.1016/j.dci.2014.06.008</mixed-citation></ref><ref id="scirp.60255-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Ogino, T., Tabata, H., Ikeda, M., Kakizaki, H. and Matsumiya, M. (2014) Purification of a Chitinase from the Posterior Salivary Gland of Common Octopus Octopus vulgaris and Its Properties. Journal of Chitin and Chitosan Science, 2, 135-142. http://dx.doi.org/10.1166/jcc.2014.1049</mixed-citation></ref><ref id="scirp.60255-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Nishino, R., Suyama, A., Ikeda, M., Kakizaki, H. and Matsumiya, M. (2014) Purification and Characterization of a Liver Chitinase from Golden Cuttlefish, Sepia esculenta. Journal of Chitin and Chitosan Science, 2, 238-243. 
http://dx.doi.org/10.1166/jcc.2014.1065</mixed-citation></ref><ref id="scirp.60255-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Adrangi, S. and Faramarzi, M.A. (2013) From Bacteria to Human: A Journey into the World of Chitinases. Biotechnology Advances, 31, 1786-1795. http://dx.doi.org/10.1016/j.biotechadv.2013.09.012</mixed-citation></ref><ref id="scirp.60255-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Merzendorfer, H. and Zimoch, L. (2003) Chitin Metabolism in Insects: Structure, Function and Regulation of Chitin Synthases and Chitinases. Journal of Experimental Biology, 206, 4393-4412. http://dx.doi.org/10.1242/jeb.00709</mixed-citation></ref><ref id="scirp.60255-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Kramer, K.J. and Muthukrishnan, S. (1997) Insect Chitinases: Molecular Biology and Potential Use as Biopesticides. Insect Biochemistry and Molecular Biology, 27, 887-900. http://dx.doi.org/10.1016/S0965-1748(97)00078-7</mixed-citation></ref><ref id="scirp.60255-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Ahmed, N.U., Park, J.I., Jung, H.J., Kang, K.K., Hur, Y., Lim, Y.P. and Nou, I.S. (2012) Molecular Characterization of Stress Resistance-Related Chitinase Genes of Brassica rapa. Plant Physiology and Biochemistry, 58, 106-115. 
http://dx.doi.org/10.1016/j.plaphy.2012.06.015</mixed-citation></ref><ref id="scirp.60255-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Muzzarelli, R.A.A., Boudrant, J., Meyer, D., Manno, N., Demarchis, M. and Paoletti, M.G. (2012) Current Views on Fungal Chitin/Chitosan, Human Chitinases, Food Preservation, Glucans, Pectins and Inulin: A Tribute to Henribraconnot, Precursor of the Carbohydrate Polymers Science, on the Chitin Bicentennial. Carbohydrate Polymers, 87, 995-1012. http://dx.doi.org/10.1016/j.carbpol.2011.09.063</mixed-citation></ref><ref id="scirp.60255-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Gutowska, M.A., Drazen, J.C. and Robinson, B.H. (2004) Digestive Chitinolytic Activity in Marine Fishes of Monterey Bay, California. Comparative Biochemistry and Physiology Part A, 139, 351-358. 
http://dx.doi.org/10.1016/j.cbpb.2004.09.020</mixed-citation></ref><ref id="scirp.60255-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Ikeda, M., Kondo, Y. and Matsumiya, M. (2013) Purification, Characterization, and Molecular Cloning of Chitinases from the Stomach of the Threeline Grunt Parapristipoma trilineatum. Process Biochemistry, 48, 1324-1334.  
http://dx.doi.org/10.1016/j.procbio.2013.06.016</mixed-citation></ref><ref id="scirp.60255-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Ikeda, M., Miyauchi, K., Mochizuki, A. and Matsumiya, M. (2009) Purification and Characterization of Chitinase from the Stomach of Silver Croaker Pennahia argentatus. Protein Expression and Purification, 65, 214-222. 
http://dx.doi.org/10.1016/j.pep.2009.01.015</mixed-citation></ref><ref id="scirp.60255-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Ikeda, M., Miyauchi, K. and Matsumiya, M. (2012) Purification and Characterization of a 56 kDa Chitinase Isozyme (PaChiB) from the Stomach of the Silver Croaker, Pennahia argentatus. Bioscience, Biotechnology and Biochemistry, 76, 971-979. http://dx.doi.org/10.1271/bbb.110989</mixed-citation></ref><ref id="scirp.60255-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Fujitani, N., Hasegawa, H., Kakizaki, H., Ikeda, M. and Matsumiya, M. (2014) Molecular Cloning of Multiple Chitinase Genes in Swimming Crab Portunus trituberculatus. Journal of Chitin and Chitosan Science, 2, 149-156. 
http://dx.doi.org/10.1166/jcc.2014.1046</mixed-citation></ref><ref id="scirp.60255-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Matsumiya, M., Arakane, Y., Haga, A., Muthukrishnan, S. and Kramer, K.J. (2006) Substrate Specificity of Chitinases from Two Species of Fish, Greenling, Hexagrammos otakii, and Common Mackerel, Scomber japonicus, and the Insect, Tobacco Hornworm, Manduca sexta. Bioscience, Biotechnology and Biochemistry, 70, 971-979. 
http://dx.doi.org/10.1271/bbb.70.971</mixed-citation></ref><ref id="scirp.60255-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Ohtakara, A. (1988) Chitinase and β-N-Acetylhexosaminidase from Pycnoporus cinnabarinus. Methods in Enzymology, 161, 462-470. http://dx.doi.org/doi:10.1016/0076-6879(88)61059-7</mixed-citation></ref><ref id="scirp.60255-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Molinari, L.M., Pedroso, R.B., Scoaris, D.O., Ueda-Nakamura, T., Nakamura, C.V. and Filho, B.P.D. (2007) Identification and Partial Characterization of a Chitinase from Nile Tilapia, Oreochromis niloticus. Comparative Biochemistry and Physiology Part B, 146, 81-87. http://dx.doi.org/10.1016/j.cbpb.2006.09.004</mixed-citation></ref><ref id="scirp.60255-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Kurokawa, T., Uji, S. and Suzuki, T. (2004) Molecular Cloning of Multiple Chitinase Genes in Japanese Flounder, Paralichthys olivaseus. Comparative Biochemistry and Physiology Part B, 138, 255-264. 
http://dx.doi.org/doi:10.1016/j.cbpc.2004.03.015</mixed-citation></ref></ref-list></back></article>