<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AS</journal-id><journal-title-group><journal-title>Agricultural Sciences</journal-title></journal-title-group><issn pub-type="epub">2156-8553</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/as.2015.69087</article-id><article-id pub-id-type="publisher-id">AS-59487</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject><subject> Earth&amp;Environmental Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  The Influence of Photoperiod on the Regulation of Root and Callus Initiation of Perle Noir (&lt;i&gt;V. vinifera&lt;/i&gt; L.): Expression of MADS-Box Gene
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>enda</surname><given-names>Cheikhrouhou</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Manel</surname><given-names>Zrida</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Bechir</surname><given-names>Ezzili</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Center of Biotechnology Borj Cedria, Hammamlif, Tunisia</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>hendacheikh@gmail.com(EC)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>07</day><month>09</month><year>2015</year></pub-date><volume>06</volume><issue>09</issue><fpage>908</fpage><lpage>915</lpage><history><date date-type="received"><day>9</day>	<month>June</month>	<year>2015</year></date><date date-type="rev-recd"><day>accepted</day>	<month>6</month>	<year>September</year>	</date><date date-type="accepted"><day>9</day>	<month>September</month>	<year>2015</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  To study the influence of photoperiod on roots differentiation in the Tunisian grapevine (
  <em>Vitis vinifera</em> L.) cultivar Perle noir, roots and callus initiation were analyzed under three different conditions of day length: long day (LD), short day (SD) and darkness (D). The photoperiod influenced the number of callus and roots per cuttings; it has a significant effect on the roots and callus initiation. Expression profile analysis of six MADS-box genes (
  <em>VTM8</em>, 
  <em>VSEP</em>2, 
  <em>VAG</em>12, 
  <em>VAG</em>17-1, 
  <em>VAG</em>17-2 and 
  <em>VSOC</em>1.3) during root and callus development is in agreement with the above-mentioned observation. The expression of the MADS-box genes during root and callus development fluctuated in a tissue-dependent manner. These data suggest that all genes are expressed in roots under three photoperiods. Total darkness gives the number of the most important root per cutting compared to the other two conditions. This photoperiodic condition gave the most important expression of the studied genes 
  <em>VAG</em>12, 
  <em>VAG</em>17-2, 
  <em>VAG</em>17-1, 
  <em>VTM</em>8 and 
  <em>VSEP</em>2 transcripts were not found in callus grown in the dark or in LD conditions, respectively. 
  <em>VSOC</em>1.3 transcripts were not found in callus grown in the dark or in SD conditions, respectively. Transcript abundance of 
  <em>VTM</em>8 and 
  <em>VSOC</em>1 was highest in LD.
 
</p></abstract><kwd-group><kwd>Grapevine</kwd><kwd> Root</kwd><kwd> Photoperiod</kwd><kwd> MADS-Box Genes</kwd><kwd> Callus</kwd><kwd> &lt;i&gt;Vitis vinifera&lt;/i&gt; L.</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Certain shoot and root cells can be activated to produce a new one, each with a new meristem at its tip. The number and location of this organ are not predetermined. Therefore, each plant can integrate information from its environment into the decision about root and shout formation. Plants are dependent on the resources that are available in their immediate vicinity. Nutriment availability and distribution are in constant flux in the environment. Plants must be able to sense these changes and respond appropriately. The presence of active stem cell population and the ability to generate new ones allow the plant to adapt its morphology to its unique and changeable environment [<xref ref-type="bibr" rid="scirp.59487-ref1">1</xref>] . The formation of the lateral roots in the root system provides a good model for studying how plant development is coordinated with environment. For Arabidopsis, lateral roots originate from mature non-dividing pericycle cells arrested in the G2 phase of cell cycle [<xref ref-type="bibr" rid="scirp.59487-ref2">2</xref>] . The primordium then enlarges through the parent tissues to develop a meristem at the tip, and begins to grow as a mature lateral root [<xref ref-type="bibr" rid="scirp.59487-ref3">3</xref>] . The first visible event in lateral root is a series of anticlinal divisions in the root pericycle [<xref ref-type="bibr" rid="scirp.59487-ref4">4</xref>] [<xref ref-type="bibr" rid="scirp.59487-ref5">5</xref>] . The passage from pericycle cell to lateral root is unknown. Some studies suggest that specific pericycle cell exists. This suggests that environmental conditions influence lateral root formation [<xref ref-type="bibr" rid="scirp.59487-ref6">6</xref>] . Auxins play a central role and may interact with endogenous factors stimuli such as light [<xref ref-type="bibr" rid="scirp.59487-ref7">7</xref>] . Author [<xref ref-type="bibr" rid="scirp.59487-ref8">8</xref>] chooses two classes of Arabidopsis thaliana mutants altered in adventitious root formation. The super root mutant spontaneously makes adventitious roots and the argaunote 1 (Ago 1) mutants, which unlike super root is barely able to form adventitious roots. The defect in adventitious root observed in Ago 1 is correlated with light hypersensitivity and the deregulation of auxin homeostasis specifically in the apical part of the seedlings. The authors conclude that adventitious roots are regulated by GH3 genes and therefore perturbing auxin homeostasis in a light-dependent manner. Light may intervene to control adventitious root of Arabidopsis. Plants must be able to sense fluxing in grapevine that were notably absent through the 20th century [<xref ref-type="bibr" rid="scirp.59487-ref9">9</xref>] . Most of the information on adventitious formation in Vitis spesis, their hybrids, and rootstocks has been proprietary [<xref ref-type="bibr" rid="scirp.59487-ref10">10</xref>] . Grape Canes (Vitis vinifera L) does not contain preformed adventitious root primordia [<xref ref-type="bibr" rid="scirp.59487-ref11">11</xref>] . Favre (1973) [<xref ref-type="bibr" rid="scirp.59487-ref12">12</xref>] was the first to study the histological detail of adventitious root formation in Vitis canes, and identify the initial step as the appearance of “swelling” or hypertropic nuclei within clusters of cells of the interfascicular cambium. The second stage was identified as the initiation of periclinal divisions among the cambium cells followed by the third stage identified as the organization of morphogenetic fields. The formation of adventitious root is correlated with the convergence of multiple environmental and endogenous factors like internal compounds type PGRs auxin, cytokinin, spermine, spermidine; carbohydrates sugar as well as genetic background [<xref ref-type="bibr" rid="scirp.59487-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.59487-ref14">14</xref>] . Plants use light as a source of information to optimally adapt growth and development to the ambient environment. The most prominent process regulated by photoperiod is the flowering induction, but photoperiod has also been reported to control a wide variety of other developmental processes, including stem elongation, bud dormancy, axillary branching, leaf growth, and the formation of storage organs [<xref ref-type="bibr" rid="scirp.59487-ref15">15</xref>] . MADS-box genes encode transcription factors, the expression analysis of these genes reveals a close link with the grapevine growth and development process. In grapevine, Expression of MADS-box genes has been detected in reproductive and vegetative organs [<xref ref-type="bibr" rid="scirp.59487-ref16">16</xref>] . Expression of VAGL12 was detected in roots and fruits and during flower development. The expression level of VAGL12 and VAGL17 [<xref ref-type="bibr" rid="scirp.59487-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.59487-ref18">18</xref>] suggested their role in vegetative development, which had later been evidenced for some of them in root development [<xref ref-type="bibr" rid="scirp.59487-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.59487-ref20">20</xref>] . Expression of VAGL17-1 and VAGL17-2 was detected in roots and during reproductive development in grapevine and Arabidopsis [<xref ref-type="bibr" rid="scirp.59487-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.59487-ref18">18</xref>] . Here, we report our studies detailing the influence of the photoperiod on the regulation of root initiation of Perle noir cultivar (V. vinifera L.). We were further interested in understanding of the genetic and molecular control of root initiation in the grapevine.</p></sec><sec id="s2"><title>2. Material and Methods</title><sec id="s2_1"><title>2.1. Plant Material</title><p>Grapevine V. vinifera L. cv. Perle noir grafted onto the rootstocks of Richter 99 resulting from a mass selection in Tunisia was collected in January in the vineyards of GOVPF (Groupement Obligatoire Des Viticulteurs et Producteurs De Fruits).The vineyards are located in the region of Belli in the Governorate of Nabeul (latitude 10˚25', longitude 36˚37', 20 meters above sea level). Fertilization and further manipulations in the vineyard were performed according to commercial standards. Cuttings were collected at the proximal part of the cane and limited to three nodes, successively named N0 (the proximal), N1 and N2. The length of the cuttings was standardized to 21 cm, the thickness was approximately 10 mm, and only the eighth bud (when counting from the base) was retained. A thousand cuttings were directly put after the collect in 1.5-L beakers containing tap water and transferred to a culture chamber with a constant temperature of 25˚C.</p></sec><sec id="s2_2"><title>2.2. Growth Conditions</title><p>The canes were kept in three different photoperiods with an irradiance of 10,000 μE∙m<sup>−2</sup>∙s<sup>−1</sup>: 8 h light/16 h dark (Short Day), 16 h light/8 h dark (Long Day) and continuous darkness (Darkness). One hundred cuttings were used in each day length. Buds reaching the stage of budburst (T0) were recorded every day. The plant material was divided into two parts: the first was reserved for physiology studies and the second for molecular studies. Roots and callus were counted and collected 40 days after budburst. Statistical analyses were carried out using ANOVA and the LSD test to determine the effect of photoperiod on the number of roots and the number of calli per cuttings. All statistical analyses were performed using 100 samples.</p></sec><sec id="s2_3"><title>2.3. Analysis of Transcript Level</title>RNA Extraction<p>Total RNA was isolated from approximately 100 g of roots and callus frozen tissue powder using the SpectrumTM Plant Total RNA Kit (Sigma-Aldrich Switzerland located in Buchs, St Gallen, Switzerland) according to the manufacturer’s instructions. The quality and quantity of the total RNA prepared was determined by spectrophotometer analysis. The RNA was diluted in distilled water and measured the absorbance at 260, 280 and 320 nm. One μg of RNA was treated with RNase-free DNase (Fermentas) according to the manufacturer’s instructions, one unit of the enzyme completely degrades 1 &#181;g of DNA in 10 min at 37˚C, and the remaining RNA was reverse transcribed using an oligo dT primer and the Invitrogen Reverse Transcriptase. Total RNA (1 mg) was reverse transcribed in a reaction mixture of 20 ml containing PCR buffer (Invitrogen), 5 mM MgCl<sub>2</sub>, 1 mM deoxynucleoside triphosphates, 20 units of RNase inhibitor, 50 units of reverse transcriptase (Invitrogen), 2.5 mM oligo(dT)18 and diethyl pyrocarbonate-treated water. Quantitative Real-Time Polymerase Chain Reaction (qRT-PCR) was performed as follows. Diluted cDNA (2 μL) were used for qRT-PCR reactions to detect VTM8, VSEP2, VAG12, VAG17-1, VAG17-2 and VSOC1.3. Each experiment included three technical replicates for each three biological replicates for each photoperiod. Transcript levels were determined by qRT-PCR using the 7300 Real-Time PCR System (Bio-Rad) and SYBR Green dye (Bio-Rad). Reactions were performed in a final volume of 15 μl containing 7.5 μl of 23 Power SYBR Green PCR Master Mix, 333 nM of forward and reverse specific primers and a 1:10 dilution of cDNA. After enzyme activation at 95˚C for 10 min, amplification was carried out in a two-step PCR procedure with 40 cycles of 15 s at 95˚C for denaturation and 1 min at 60˚C for annealing/extension Transcript levels were calculated using the standard curve method and normalized against the grapevine εF-1α gene for expression analyses (<xref ref-type="table" rid="table1">Table 1</xref>).</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> List of primers used for RT PCR εF-1α was chosen as a reference gene</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene</th><th align="center" valign="middle" >Primers</th><th align="center" valign="middle" >Annealing Temperature (˚C)</th></tr></thead><tr><td align="center" valign="middle" >VTM8</td><td align="center" valign="middle" >5’GTCTAAACATGGGTGGGACTT3’ 5’CATCCAAGGTGGGAGGGATA3’</td><td align="center" valign="middle" >55</td></tr><tr><td align="center" valign="middle" >VSEP2</td><td align="center" valign="middle" >5’CTTCAATAACCAACGGGAAGA3’ 5’TCTCAAACTAATGGCACACAGT3’</td><td align="center" valign="middle" >55</td></tr><tr><td align="center" valign="middle" >VAG12</td><td align="center" valign="middle" >5’GTTTGTTGTGTGCTCCAAGC3’ 5’CGAAATGAATGTATGGGCAAG3’</td><td align="center" valign="middle" >55</td></tr><tr><td align="center" valign="middle" >VAG17.1</td><td align="center" valign="middle" >5’TAATTTAGTAGGTGATGCTGCTGCT3 5’AGATGGAGTATATGTGGTTGGTAGA3’</td><td align="center" valign="middle" >55</td></tr><tr><td align="center" valign="middle" >VAG17.2</td><td align="center" valign="middle" >5’CTTCAATAACCAACGGGAAGA3’ 5’TCTCAAACTAATGGCACACAGT3’</td><td align="center" valign="middle" >55</td></tr><tr><td align="center" valign="middle" >SOC1.3</td><td align="center" valign="middle" >5’GTTCATAGGACCACCAGAAAGA3’ 5’GCTAGTGCTGCTGTTAGACT3’</td><td align="center" valign="middle" >55</td></tr><tr><td align="center" valign="middle" >εF-1α</td><td align="center" valign="middle" >5’-GAACGTTGCTGTGAAGGATCTC-3’ 5’-CGCCTGTCAACCTTGGTCAGTA-3’</td><td align="center" valign="middle" >55</td></tr></tbody></table></table-wrap></sec></sec><sec id="s3"><title>3. Results</title><p>Our experiment shows that some cuttings give calls, others give both callus and roots and further give only callus (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p><sec id="s3_1"><title>3.1. Effect of Photoperiod on the Number of Roots</title><p>The numbers of roots in the grapevine cv. Perle noir fluctuated depending upon the photoperiod. The two statistical analysis including and excluding the cuttings without roots showed that there were significant differences between cuttings grown under D and LD conditions and between D and SD conditions respectively (<xref ref-type="table" rid="table2">Table 2</xref>) but there were no significant differences between cuttings grown under SD and LD conditions. Darkness conditions induce an increase of root number per cutting.</p></sec><sec id="s3_2"><title>3.2. Effect of Photoperiod on the Number of Callus</title><p>We investigated the effect of photoperiod on the numbers of callus in each of the cuttings in this cultivar. Long day conditions induced an increase in callus number; it was significantly higher in cuttings grown in LD conditions than in cuttings grown in SD and D conditions respectively (<xref ref-type="table" rid="table2">Table 2</xref>). We showed that the highest number of roots per cuttings for Perle noir cultivar was obtained in the total darkness. The SD and the LD conditions has a median number per equivalent cuttings root. The percentage of rooting is also most important in total darkness conditions (<xref ref-type="table" rid="table2">Table 2</xref>).</p></sec><sec id="s3_3"><title>3.3. Analysis of MADS-BOX Genes</title><p>Quantitative RT-PCR was used to determine the expression level of MADS-box genes in roots upon changes in photoperiod.</p><sec id="s3_3_1"><title>3.3.1. Analysis of VTM8, VSEP2, VAG12, VAG17-1, VAG17-2, and VSOC1.3 Transcripts in Roots</title><p>MADS-box genes expression level in roots is according with the results of Riquelme et al. 2009 [<xref ref-type="bibr" rid="scirp.59487-ref16">16</xref>] which studied vine chromosome genes and their implications in different organs. The transcriptional expression levels of these genes fluctuated differently in each tissue depending on the photoperiod. The expression of all genes was higher in D than in SD or LD conditions (<xref ref-type="fig" rid="fig2">Figure 2</xref>). The highest expression was found in the total darkness. It was 10.5 times higher for VAG17-2, 10.5 times for VSEP2, 9 times for VAG17-1, 6.9 times for VAG12, 10 times</p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Roots and callus obtained in our experience</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-3001139x6.png"/></fig><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Number of root and callus per cutting under three photoperiod conditions</title></caption><table><tbody><thead><tr><th align="center" valign="middle" ></th><th align="center" valign="middle" >Darkness</th><th align="center" valign="middle" >Short Day</th><th align="center" valign="middle" >Long Day</th></tr></thead><tr><td align="center" valign="middle" >Number root per cutting</td><td align="center" valign="middle" >8.20 &#177; 1.33</td><td align="center" valign="middle" >5.21 &#177; 0.91</td><td align="center" valign="middle" >5.13 &#177; 1.17</td></tr><tr><td align="center" valign="middle" >Number callus per cutting</td><td align="center" valign="middle" >5.20 &#177; 0.83</td><td align="center" valign="middle" >3.95 &#177; 0.95</td><td align="center" valign="middle" >6.05 &#177; 0.83</td></tr><tr><td align="center" valign="middle" >% rooting</td><td align="center" valign="middle" >71</td><td align="center" valign="middle" >52</td><td align="center" valign="middle" >56</td></tr><tr><td align="center" valign="middle" >% calling</td><td align="center" valign="middle" >32</td><td align="center" valign="middle" >28</td><td align="center" valign="middle" >38</td></tr></tbody></table></table-wrap><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Expression of VAG17-2, VSEP2, VAG17-1, VSOC1.3, VTM8 and VAG12, and during root development under LD, SD and D conditions. The relative expression of the genes was estimated by quantitative RT PCR analysis using εF-1α as a reference gene. Error bars = SD of three PCR reaction. Each bar represents measurement from 3 technical replicates for each three biological replicates &#177; SEM</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-3001139x7.png"/></fig><p>for VSOC-3, 4.5 times for VTM8 than in the SD and LD conditions. The light limits the expression of these genes but not in the same manner. Transcripts of VAG17-2 were detected in roots in all three photoperiods. Compared to SD, the switch to LD resulted in an increase in the expression of this transcription factor ((<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)). The transcript abundance of VSOC1.3 was highest in roots grown in dark (<xref ref-type="fig" rid="fig2">Figure 2</xref>(d)). Moreover, the expression levels of VAG12 mRNA observed was two times higher in LD grown cuttings than the SD grown cuttings (<xref ref-type="fig" rid="fig2">Figure 2</xref>(f)). Whereas, the transcript abundance of VSEP2 was two times higher in SD grown cuttings than in LD grown cuttings (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)).</p></sec><sec id="s3_3_2"><title>3.3.2. Analysis of VTM8, VSEP2, VAG12, VAG17-1, VAG17-2, and VSOC1.3 Transcripts in Callus</title><p>The expression level was also analyzed in the callus under the three photoperiods. The gene expression level of these genes fluctuates differently depending on the photoperiod (<xref ref-type="fig" rid="fig3">Figure 3</xref>). Transcripts of VAG17.1, VTM8 and VSOC1.3 were detected only in the callus grown in LD condition (<xref ref-type="fig" rid="fig3">Figure 3</xref>(a), <xref ref-type="fig" rid="fig3">Figure 3</xref>(d)), it indicate that these genes are maybe specifically associated with callus development. The expression of VAG17.1 was important in Darkness and LD condition, it was two times higher in D (favorable condition of roots) grown cuttings than in LD (favorable condition of callus) grown cuttings and almost undetectable in SD grown cuttings (<xref ref-type="fig" rid="fig3">Figure 3</xref>(b)). The transcript levels of VAG17.2 mRNA were observed only in SD grown cuttings (<xref ref-type="fig" rid="fig3">Figure 3</xref>(c)). Transcript abundance of VAG12 and VSEP2 was highest in Darkness (optimum condition of the roots) than the SD and almost undetectable in LD (<xref ref-type="fig" rid="fig3">Figure 3</xref>(e) and <xref ref-type="fig" rid="fig3">Figure 3</xref>(f)).</p><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Expression of VTM8, VAG17-1, AG17-2, VSOC1.3, VAG12 and VSEP2, during call development under LD, SD and D conditions. The relative expression of the genes was estimated by quantitative RT PCR analysis using εF-1α as a reference gene. Error bars = SD of three PCR reaction. Each bar represents measurement from 3 technical replicates for each three biological replicates &#177; SEM</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/3-3001139x8.png"/></fig><p>Light is an important factor it increase or decrease the expression of the MADS-box genes. The expression for the calluses is 27 times greater for VAG17-1 that the roots, both VAG12 156 and 882 times higher for VSEP2 in total darkness that the roots. The intensity of the expression of VTM8 is 118 times for the callus that the roots and it is 138 times for VAG17-1 in long day. The intensity is almost identical for VAG17-2 call and VAG17-2 root short day. The order of magnitude is not the same; there is much in favor of callus for the roots. On the other hand expression presents a significant variability in total darkness dependent genes. The intensity of expression is as important in long day but never equaled optimal expression obtained in total darkness. In short day it is almost identical. We have seen that the genes studied are expressed roots. Their maximum values are obtained in total darkness. Three of these genes are also expressed in the callus, and also have maximum values at total darkness which is similar to the roots. There is a gene that has the maximum value in total darkness and the maximum value along the day condition for optimal expression calluses. Through these results we can hypothesize the common origin of roots and calluses. But the discrepancy is found mostly in non-expression of the three genes in complete darkness, the important expression of two genes in long day and another in short day. The physiological conditions of expressing roots is identical and reproducible for the 6 genes studied, the fact is with the cal. Added to this the very high values obtained only in the calluses. In the roots, the studied genes are expressed independently of photoperiod used. The intensity of the expression is always up to total darkness for callus, the intensity of the expression is generally much larger than in roots. Unlike the roots, the expression is absent VTM8 and VSOC1-3 in short day and total darkness. It is also absent for the gene VAG17.1 short day. For VAG17-2 gene expression is absent long day and total darkness. The expression is absent in long day and short day for VAG12 and VSEP2. If for roots, photoperiod conditions influence gene expression are reproducible, it is not the same for the calluses which actually poses the problem of similarity of these organs.</p></sec></sec></sec><sec id="s4"><title>4. Discussion</title><p>The highest number of roots per cuttings for Perle noir cultivar was obtained in the total darkness. The SD and the LD conditions have a median number per equivalent cuttings root. The percentage of root is also most important in total darkness conditions than the LD and SD conditions. The MADS-box genes selected from the study of Riquelme et al. 2009 [<xref ref-type="bibr" rid="scirp.59487-ref16">16</xref>] were found in the roots of Perle noir cultivar, which supported the results of the authors mentioned above. Our results show that the intensity of the gene transcripts is variable with the photoperiod and they have a maximum value in the total darkness. The expression of the six genes is in the same direction as the physiological result namely that the number of root is most important in the total darkness.</p><p>The highest number of callus was found under LD conditions, the level expression of the studied genes in root fluctuated differently in callus. VTM8 and VSOC1.3 gene have the highest expression in the LD and are probably associated with the physiological response and give the most important the number of callus. On a fundamental level, the study of the influence of the photoperiod on the number of roots and callus of the cuttings of Perle noir cultivar should be compared with the results obtained by Husen 2008 [<xref ref-type="bibr" rid="scirp.59487-ref21">21</xref>] .</p><p>Husen 2008 [<xref ref-type="bibr" rid="scirp.59487-ref21">21</xref>] found the highest number of roots per bud under the total darkness conditions; on the other hand, the long day gives the highest number of callus per bud. Our results show that the expression level of 6 MADS-box gene studied in the roots goes in the same direction as the physiological results. For callus, the results would give the particular importance for genes VTM8 and VSOC1-3.</p></sec><sec id="s5"><title>Cite this paper</title><p>HendaCheikhrouhou,ManelZrida,BechirEzzili, (2015) The Influence of Photoperiod on the Regulation of Root and Callus Initiation of Perle Noir (V. viniferaL.): Expression of MADS-Box Gene. Agricultural Sciences,06,908-915. doi: 10.4236/as.2015.69087</p></sec><sec id="s6"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.59487-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Malamy, J.E. and Ryan, K.S. (2001) Environmental Regulation of Lateral Root Initiation in Arabidopsis. Plant Physiology, 127, 899-909. http://dx.doi.org/10.1104/pp.010406</mixed-citation></ref><ref id="scirp.59487-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Beeckman, T., Burssens, S. and Inze, D. (2001) The Peri-Cell-Cycle in Arabidopsis. Journal of Experimental Botany, 52,403-411. http://dx.doi.org/10.1093/jexbot/52.suppl_1.403</mixed-citation></ref><ref id="scirp.59487-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Malamy, J.E. and Benfey, P.N. (1997) Analysis of SCARECROW Expression Using a Rapid System for Assessing Transgene Expression in Arabidopsis roots. Plant journal, 12, 957-963.  
http://dx.doi.org/10.1046/j.1365-313X.1997.12040957.x</mixed-citation></ref><ref id="scirp.59487-ref4"><label>4</label><mixed-citation publication-type="book" xlink:type="simple">Charlton, W.A. (1991) Lateral Root Initiation. In: Half, H., Waisel, Y., Eshel, A. and Kafkafi, A. Eds., Plant Roots, Marcel Dekker, New York, 103-128</mixed-citation></ref><ref id="scirp.59487-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Malamy, J.E. and Benfey, P.N. (1997) Organization and Cell Differentiation in Lateral Roots of Arabidopsis thaliana. Developpment, 124, 33-44</mixed-citation></ref><ref id="scirp.59487-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Dubrovsky, J.G., Doerner, P.W., Colon-Carmona, A. and Rost, T.L. (2000) Pericycle Cell Proliferation and Lateral Root Initiation in Arabidopsis. Plant Physiology, 124, 1648-1657. http://dx.doi.org/10.1104/pp.124.4.1648</mixed-citation></ref><ref id="scirp.59487-ref7"><label>7</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Blaskeley</surname><given-names> D. </given-names></name>,<etal>et al</etal>. (<year>1994</year>)<article-title>Auxin Metabolism and Adventitious Root Initiation</article-title><source> Biology of Adventitious Root Formation</source><volume> 62</volume>,<fpage> 143</fpage>-<lpage>154</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.59487-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Sorin, C. and Bussell, J.D (2005) Auxin and Light Control of Adventitious Rooting in Arabidopsis Require ARGONAUTE1. Plant Cell, 17, 1343-1359. http://dx.doi.org/10.1105/tpc.105.031625</mixed-citation></ref><ref id="scirp.59487-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Smart, D.R., Kocsis, L., Walker, M.A. and Stockert, C. (2003) Dormant Buds and Adventitious Root Formation by Vitis and Other Woody Plants. Journal of Plant Growth Regulation, 21, 296-314.</mixed-citation></ref><ref id="scirp.59487-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Galet, P. (1988) Grapes and Vineyards of France. Cépages et Vignobles de France. Déhan: Montpellierp 533. d’Abidjan, 100.</mixed-citation></ref><ref id="scirp.59487-ref11"><label>11</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Van der leek</surname><given-names> H.A.A. </given-names></name>,<etal>et al</etal>. (<year>1924</year>)<article-title>Root Development in Woody Cuttings</article-title><source> Mededelingen Landbouwhogeschool Wageningen</source><volume> 28</volume>,<fpage> 211</fpage>-<lpage>230</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.59487-ref12"><label>12</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Favre</surname><given-names> J.M. </given-names></name>,<etal>et al</etal>. (<year>1973</year>)<article-title>Correlative Effects of Internal and External Factors on Rooting Clone of a Vine (Vitis riparia x Vitis rupestris) in Vitro [Effets corrélatifs des facteurs internes et externs sur la rhizogenèse d’un clone de vigne (Vitis riparia x Vitis rupestris) in Vitro]</article-title><source> Revue Générale de Botanique</source><volume> 80</volume>,<fpage> 279</fpage>-<lpage>361</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.59487-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Kozlowski, T.T. (1992) Carbohydrate Sources and Sinks in Woody Plants. Botany Review, 58, 108-222. 
http://dx.doi.org/10.1007/BF02858600</mixed-citation></ref><ref id="scirp.59487-ref14"><label>14</label><mixed-citation publication-type="book" xlink:type="simple">Howord, B.H. (1994) Manipulating Rooting Potentia in Stock Plants before Collecting Cuttings. In: Davis, T.D., Haissig, B.E., Eds., Biology of Adventitiuos Root Formation, Plenum Press, New York and London, 123-142. 
http://dx.doi.org/10.1007/978-1-4757-9492-2_10</mixed-citation></ref><ref id="scirp.59487-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Thomas, B. (2006) Light Signals and Flowering. The Journal of Experimental Botany, 57, 3387-3393. 
http://dx.doi.org/10.1093/jxb/erl071</mixed-citation></ref><ref id="scirp.59487-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Díaz-Riquelme, J.D., Lijavetzky, D., Martinez-Zapater, J.M. and Carmona, J.M. (2009) Genome-Wide Analysis of MIKCC-Type MADS-Box Genes in Grapevine. Plant Physiology, 149, 354-369.  
http://dx.doi.org/10.1104/pp.108.131052</mixed-citation></ref><ref id="scirp.59487-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Rounsley, S.D., Ditta, G.S. and Yanofski, M.F. (1995) Diverse Roles of MADS-Box Genes in Arabidopsis Development. Plant Cell, 7, 1259-1269. http://dx.doi.org/10.1105/tpc.7.8.1259</mixed-citation></ref><ref id="scirp.59487-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Burgeff, C., Liljegren, S., Tapia-López, R., Yanofski, M. and Alvarez-Buylla, E. (2002) MADS-Box Gene Expression in Lateral Primordia, Meristems and Differentiated Tissues of Arabidopsis thaliana Roots. Planta, 214, 365-372. 
http://dx.doi.org/10.1007/s004250100637</mixed-citation></ref><ref id="scirp.59487-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, H. and Forde, B.G. (2000) Regulation of Arabidopsis Root Development by Nitrate Availability. The Journal of Experimental Botany, 51, 51-59. http://dx.doi.org/10.1093/jexbot/51.342.51</mixed-citation></ref><ref id="scirp.59487-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Tapia-López, R., García-Ponce, B., Dubrovsky, J.G., Garay-Arroyo, A., Pérez-Ruiz, R.V., Kim, S.H., Acevedo, F, Pélaz, S. and Alvarez-Buylla, E.R. (2008) An AGAMOUS-Related MADS-Box Gene, XAL1 (AGL12), Regulates Root Meristem Cell Proliferation and Flowering Transition in Arabidopsis. Plant Physiology, 146, 1182-1192. 
http://dx.doi.org/10.1104/pp.107.108647</mixed-citation></ref><ref id="scirp.59487-ref21"><label>21</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Husen</surname><given-names> A. </given-names></name>,<etal>et al</etal>. (<year>2008</year>)<article-title>Stock-Plantetiolation Causes Drifts in Total Soluble Sugars and Anthraquinone and Promotes Adventitious Root Formation in Teak (Tectona grandis) Coppice Shoots</article-title><source> Plant Growth Regulator</source><volume> 54</volume>,<fpage> 12</fpage>-<lpage>21</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref></ref-list></back></article>