<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2015.613217</article-id><article-id pub-id-type="publisher-id">AJPS-59243</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Exploration, Characterization and Phylogenetic Studies in Wild &lt;i&gt;Mangifera indica&lt;/i&gt; Relatives
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>akki</surname><given-names>Ramachandra Dinesh</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Kundapura</surname><given-names>Venkataramana Ravishankar</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>P.</surname><given-names>Nischita</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>B.</surname><given-names>S. Sandya</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>B.</surname><given-names>Padmakar</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>S.</surname><given-names>Ganeshan</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>R.</surname><given-names>Chithiraichelvan</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>T.</surname><given-names>V. R. S. Sharma</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib></contrib-group><aff id="aff4"><addr-line>Retired Principal Scientist, Central Agricultural Research Institute South Andaman, 
Andaman &amp;amp; Nicobar Islands, India</addr-line></aff><aff id="aff1"><addr-line>Division of Fruit Crops, Indian Institute of Horticultural Research, Hesaraghatta Lake Post, Bengaluru, India</addr-line></aff><aff id="aff2"><addr-line>Division of Biotechnology, Indian Institute of Horticultural Research, Hesaraghatta Lake Post, Bengaluru, India</addr-line></aff><aff id="aff3"><addr-line>Division of Plant Genetic Resource, Indian Institute of Horticultural Research, Hesaraghatta Lake Post, 
Bengaluru, India</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>mrdinesh@iihr.ernet.in(ARD)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>26</day><month>08</month><year>2015</year></pub-date><volume>06</volume><issue>13</issue><fpage>2151</fpage><lpage>2160</lpage><history><date date-type="received"><day>25</day>	<month>June</month>	<year>2015</year></date><date date-type="rev-recd"><day>accepted</day>	<month>23</month>	<year>August</year>	</date><date date-type="accepted"><day>28</day>	<month>August</month>	<year>2015</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Exploratory surveys were carried out in the Andamans and Nicobar group of islands during 2006 and 2014 to locate wild species viz. 
  
  Mangifera andamanica King, 
  
  Mangifera camptosperma Pierre and 
  
  Mangifera griffithii Hook. Not much variation was observed for fruit shape and size for the species 
  
  Mangifera andamanica, which was endemic to this region. The species 
  
  M. griffithii has been reported to be only in Mt. Harriet. However, another plant of M. griffithii in the Shoalbay region was found during the second survey. The foliage &amp; fruit characteristics of the two specimens were similar, with a slight difference in the morphological features, which could be attributed to their origin from seeds. The DNA finger printing carried out showed minor changes in the species. The phylogenetic relationships amongst five 
  
  Mangifera species viz. 
  
  M. indica, M. griffithii, M. camptosperma, M. odorata and 
  
  M. andamanica were analyzed by employing chloroplast markers viz., petB-petD intergenic spacer, rps16 gene, trnL-trnF intergenic spacer and nuclear marker—External Transcribed Spacer (ETS). The nuclear markers and chloroplast markers based on phylogenetic analysis showed that the common mango 
  
  M. indica L. was closely related to 
  
  M. griffithii and 
  
  M. camptosperma, which belonged to subgenus 
  
  Mangifera. However, 
  
  M. odorata that belonged to subgenus 
  
  Limus was grouped separately along with 
  
  M. andamanica. The above results are in congruent with the accepted classification of genus 
  
  Mangifera reported by Kostermans and Bompard with the exception of 
  
  M. andamanica, which has been earlier classified under subgenus 
  
  Mangifera. Results clearly indicated that classification of 
  
  M. andamanica under subgenus needed to be reconsidered.
 
</p></abstract><kwd-group><kwd>Characterization</kwd><kwd> Diversity</kwd><kwd> Exploration</kwd><kwd> ETS</kwd><kwd> Mango</kwd><kwd> petB-D</kwd><kwd> trnL-F</kwd><kwd> rps16</kwd><kwd> Phylogeny</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The genus Mangifera is one of the 68 genera in the family Anacardiaceae [<xref ref-type="bibr" rid="scirp.59243-ref1">1</xref>] . Mangifera indica L. is the most important species in this genus for commercial fruit production in tropical and sub-tropical regions of the world. The genus Mangifera is believed to have originated somewhere in Myanmar, Thailand, Indo-China and Malaya during the Eocene or an earlier period in the Cretaceous, and then the species have spread to India and Sri Lanka in the west, and to Eastern Malaysia and the Philippines in the east [<xref ref-type="bibr" rid="scirp.59243-ref2">2</xref>] . The center of diversity of this genus is thought to be South East Asia, with increased diversity in Peninsular Malaysia. The highest number of Mangifera species is now found in Borneo, Sumatra, Java and Malay Peninsula [<xref ref-type="bibr" rid="scirp.59243-ref3">3</xref>] . The most acceptable classification of the genus Mangifera is reported by Kostermans and Bompard [<xref ref-type="bibr" rid="scirp.59243-ref4">4</xref>] who described 69 species in the genus based on the morphological characteristics and classified 58 species into two subgenera Mangifera and Limus with several sections. The 11 remaining species were placed in an uncertain position in the classification. India is reported to be the home of four other species viz., Mangifera andamanica, Mangifera khasiana, Mangifera sylvatica and Mangifera camptosperma [<xref ref-type="bibr" rid="scirp.59243-ref5">5</xref>] . Two exploration surveys were carried out at Andamans, one in 2006 and another in 2014 to collect the species viz., Mangifera andamanica, Mangifera camptosperma and Mangifera griffithii. Hence, survey was undertaken to locate diversity and distribution of wild/related Mangifera species within the Andamans.</p><p>The phylogenetic relationships among Mangifera species have been described earlier by using genomic restriction fragment length polymorphisms (RFLPs) and amplification of chloroplast DNA (cpDNA) [<xref ref-type="bibr" rid="scirp.59243-ref6">6</xref>] . Additionally the sequence analysis of External Transcribed Spacer (ETS) has also been reported to be involved in the construction of phylogeny in plants [<xref ref-type="bibr" rid="scirp.59243-ref7">7</xref>] - [<xref ref-type="bibr" rid="scirp.59243-ref11">11</xref>] . For phylogenetic studies at lower taxonomic levels noncoding chloroplast regions have been used frequently and successfully [<xref ref-type="bibr" rid="scirp.59243-ref11">11</xref>] - [<xref ref-type="bibr" rid="scirp.59243-ref13">13</xref>] . The rationale behind using noncoding regions is the assumption that they are phylogenetically more informative because they are under less functional constraints [<xref ref-type="bibr" rid="scirp.59243-ref14">14</xref>] .</p><p>In the present study, morphological (foliage &amp; fruits) and molecular characterization (SSR, ETs and Chloroplast markers) was carried out to infer the evolutionary relationships among the Mangifera Species including Mangifera indica, Mangifera griffithii, Mangifera camptosperma, Mangifera odorata and Mangifera andamanica.</p></sec><sec id="s2"><title>2. Plant Materials and Methods</title><p>An exploration was undertaken in greater Andaman Islands, India to study the genetic diversity of Mangifera species during 2006. Observations were made on the morphological characters of the tree, leaves and fruits wherever it was available. The fruits of the three species of Mangifera viz., Mangifera andamanica, Mangifera camptosperma and Mangifera griffithii were collected and the observations were recorded on fruit weight, fruit length, fruit breadth and total soluble solids. An exploratory mission was again undertaken during 2014 to survey Shoalbay, Chauldhari, Naya Shahar and Chidiyatapu regions besides Mount Harriet, of the Andaman Islands. Wild species like Mangifera andamanica, Mangifera camptosperma and Mangifera griffithii were found distributed in specific isolated pockets, which were identified based on taxonomic keys. Bud sticks and leaf samples were collected from voucher accessions and foliage characteristics were recorded. In situ evaluation of leaf characters for samples collected from these regions and molecular characterization was carried out using total genomic Deoxyribonucleic acid-DNA isolated by the Cetytrimethylammonium Bromide―CTAB method [<xref ref-type="bibr" rid="scirp.59243-ref15">15</xref>] , including Mangifera indica cultivars namely Kurukkan, Muvandan, Olour, Alphonso, Raspuri and Langra for phylogenesis; as DNA yields more phylogenetic information among the biomolecules.</p>PCR Amplification, Sequencing and Analysis<p>Fluorescence based PCR method [<xref ref-type="bibr" rid="scirp.59243-ref16">16</xref>] was used to amplify the microsatellites in a quick, accurate and efficient manner. Eight microsatellite markers of mango showing high PIC [<xref ref-type="bibr" rid="scirp.59243-ref17">17</xref>] were employed for amplification. SSR markers were amplified in 10 &#181;l volume containing 25 - 50 ng mango DNA-3 &#181;l, Taq Buffer 10&#215; (pH 9.0, 10 mM Tris with 15 mM MgCl<sub>2</sub>, 50 mM KCl, 0.01% Gelatin)-1.0 &#181;l, 1mM dNTPs-1.0 &#181;l, 25 mM MgCl<sub>2</sub>-0.3 &#181;l, forward labelled specific primer (5 &#181;M)-0.1 &#181;l each thus mixed four PCR products labelled with different fluorophores (FAM, VIC, NED and PET), reverse primer (5 &#181;M)-0.1 &#181;l each, nuclease free water 3.6 &#181;l and 0.3 &#181;l of Taq DNA polymerase (Bangalore Genei, India). PCR was performed on Life Pro Thermocycler (Bioer, Hangzhou, China) with the following temperature profile: 94˚C for 2 min followed by 35 cycles at 94˚C for 30 s, 30 s annealing temperature of 55˚C and 72˚C for 1 min. A final extension reaction was allowed to proceed at 72˚C for 5 min. Amplified products were initially separated on 3% agarose gel for confirmation of the amplification. These samples were separated on the automatic 96 capillary automated DNA Sequencer (ABI 3730) at M/s Eurofin Ltd. facility at Bengaluru. The molecular data was used to generate dendrogram with DARwin 5.0 (<xref ref-type="fig" rid="fig1">Figure 1</xref>) [<xref ref-type="bibr" rid="scirp.59243-ref18">18</xref>] .</p><p>The phylogeny study comprised of five different Mangifera species, namely M.indica, M. griffithii, M. camptosperma, M. odorata and M. andamanica. Within M. indica a total of six cultivars; three polyembryonic cultivars viz Kurukkan, Muvandan and Olour and 3 monoembryonic cultivars viz Alphonso, Raspuri and Langra, were taken for the study.</p><p>The PCR reaction mixture compositions and amplification conditions varied among the markers (petB-petD; trnC-trnF; rps16 and ETS) taken for the study.</p><p>The rps16 intron was amplified with the rps16F and rps16R2 primers as described [<xref ref-type="bibr" rid="scirp.59243-ref19">19</xref>] . For the trnL-trnF intergenic spacer, we used the primers from [<xref ref-type="bibr" rid="scirp.59243-ref20">20</xref>] . The petD region was amplified with the forward primer PIpetB1365F and the reverse primer PIpetD738R [<xref ref-type="bibr" rid="scirp.59243-ref21">21</xref>] . The PCR reaction mixture and conditions were used according to [<xref ref-type="bibr" rid="scirp.59243-ref22">22</xref>] for rps16 and trnL-trnF, and [<xref ref-type="bibr" rid="scirp.59243-ref21">21</xref>] for petB-petD intergenic spacer. Amplification of ETS region</p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Dendrogram analysis of nine Mangifera species from Andaman by NJ method. 1 Mangifera camptosperma, 2 Mangifera camptosperma (Grafted), 3 Mangifera andamanica (Nayashahar), 4 Mangifera griffithii (Near School), 5 Mangifera andamanica (Biopark-1), 6 Mangifera andamanica (Biopark-2), 7 Mangifera andamanica (Biopark gate), 8 Mangifera camptosperma (Bio Park), 9 Mangifera griffithii (Mount Harriet)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2602172x6.png"/></fig><p>was done according to [<xref ref-type="bibr" rid="scirp.59243-ref23">23</xref>] . All the PCR products were separated on 3% agarose gel electrophoresis to check for efficiency of amplification and to ensure that only a single product of the expected size was present, PCR products were purified by MinElute PCR Purification Kit (Qiagen). PCR cleanup products were then sequenced using the same primers as used in initial PCR amplification using in ABI 3730 XL automated sequencer through Big Dye terminator sequencing technology.</p><p>Sequence data of all the products were first confirmed through the homology search BLAST of NCBI database and aligned using ClustalW program [<xref ref-type="bibr" rid="scirp.59243-ref24">24</xref>] of BioEdit. Then these aligned files were further converted to. meg file, exported to the MEGA 4.0 software environment for further analysis to construct the phylograms.</p><p>The aligned sequence data matrix was analyzed using the Molecular Evolutionary Genetic Analysis (MEGA) 4.0 software program [<xref ref-type="bibr" rid="scirp.59243-ref25">25</xref>] . The phylogeny was analyzed using Maximum Parsimony (MP) method, which is a character based on computational approach. The bootstrap test of Phylogeny was computed for all the nuclear and chloroplast markers with 2000 iterations.</p></sec><sec id="s3"><title>3. Results and Discussion</title><p>Identification of Mangifera species involves the observation of vegetative and fruit characteristics. The initial identification is carried out based on the growth habit of the tree, other morphological features and the vernacular names. One of the main problems in the identification is the variation in the morphological characters because of the seedling origin of the progenies and the in-built heterozygosity. The trees belonging to the Mangifera genus are generally tall growing. The phylogenetic taxonomy carried out has shown that the species are included under two sections, depending on the presence or absence of a prominent disc in between the stamen and the carpel [<xref ref-type="bibr" rid="scirp.59243-ref5">5</xref>] .</p><sec id="s3_1"><title>3.1. Morphological Analysis</title><p>The first survey was carried out during 2006 in the South Andamans and Middle Andaman. Several Mangifera indica varieties were observed in these regions. The survey of Chauldhari and Jirkhatang regions resulted in locating one and two specimens of M. andamanica respectively. One tree of Mangifera camptosperma was located near the coastal region almost by the side of sea at Jirkhatang. In Chidiya Tapu region, one tree of Mangifera griffithii was located. The specimen was evaluated for leaf characteristics and passport data was recorded (<xref ref-type="table" rid="table1">Table 1</xref>; <xref ref-type="table" rid="table2">Table 2</xref>), these were further characterised by using microsatellitre markers (<xref ref-type="table" rid="table3">Table 3</xref>). And compared with other wild species M. odorata maintained in the field genebank.</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Leaf parameters of M. griffithii</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Sl. No</th><th align="center" valign="middle" >Species</th><th align="center" valign="middle" >Leaf length (cm)</th><th align="center" valign="middle" >Leaf width (cm)</th></tr></thead><tr><td align="center" valign="middle" >1</td><td align="center" valign="middle" >M griffithii (near school at Shoalbay)</td><td align="center" valign="middle" >3.4</td><td align="center" valign="middle" >2.7</td></tr><tr><td align="center" valign="middle" >2</td><td align="center" valign="middle" >M griffithii (Mt. Harriet)</td><td align="center" valign="middle" >3.9</td><td align="center" valign="middle" >3.8</td></tr></tbody></table></table-wrap><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Passport data of the Mangifera griffithii located at Shoalbay and Mount Harriet</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Village</th><th align="center" valign="middle" >Shoalbay</th><th align="center" valign="middle" >Mt. Harriett</th></tr></thead><tr><td align="center" valign="middle" >Block</td><td align="center" valign="middle" >Ferrargunj</td><td align="center" valign="middle" >Ferrargunj</td></tr><tr><td align="center" valign="middle" >District</td><td align="center" valign="middle" >Andamans</td><td align="center" valign="middle" >Andamans</td></tr><tr><td align="center" valign="middle" >State</td><td align="center" valign="middle" >Andaman &amp; Nicobar Islands</td><td align="center" valign="middle" >Andaman &amp; Nicobar Islands</td></tr><tr><td align="center" valign="middle" >Country</td><td align="center" valign="middle" >India</td><td align="center" valign="middle" >India</td></tr><tr><td align="center" valign="middle" >Continent</td><td align="center" valign="middle" >Asia</td><td align="center" valign="middle" >Asia</td></tr><tr><td align="center" valign="middle" >Latitude</td><td align="center" valign="middle" >11˚67'N</td><td align="center" valign="middle" >32˚43'N</td></tr><tr><td align="center" valign="middle" >Longitude</td><td align="center" valign="middle" >92˚76'E</td><td align="center" valign="middle" >152˚10'E</td></tr></tbody></table></table-wrap><table-wrap id="table3" ><label><xref ref-type="table" rid="table3">Table 3</xref></label><caption><title> Locus name and sequence of the eight SSR markers used in this study (Ravishankar et al., 2011)</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Primer 5’ - 3’</th><th align="center" valign="middle" >Primer name</th></tr></thead><tr><td align="center" valign="middle" >F: GCTTGCTTCCAACTGAGACC R: GCAAAATGCTCGGAGAAGAC</td><td align="center" valign="middle" >MiIIHR17</td></tr><tr><td align="center" valign="middle" >F: TCTGACGTCACCTCCTTTCA R: ATACTCGTGCCTCGTCCTGT</td><td align="center" valign="middle" >MiIIHR18</td></tr><tr><td align="center" valign="middle" >F: TCTGACCCAACAAAGAACCA R: TCCTCCTCGTCCTCATCATC</td><td align="center" valign="middle" >MiIIHR23</td></tr><tr><td align="center" valign="middle" >F: GCGAAAGAGGAGAGTGCAAG R: TCTATAAGTGCCCCCTCACG</td><td align="center" valign="middle" >MiIIHR26</td></tr><tr><td align="center" valign="middle" >F: AGCTATCGCCACAGCAAATC R: GTCTTCTTCTGGCTGCCAAC</td><td align="center" valign="middle" >MiIIHR30</td></tr><tr><td align="center" valign="middle" >F: TTCTGTTAGTGGCGGTGTTG R: CACCTCCTCCTCCTCCTCTT</td><td align="center" valign="middle" >MiIIHR31</td></tr><tr><td align="center" valign="middle" >F: CTGAGTTTGGCAAGGGAGAG R: TTGATCCTTCACCACCATCA</td><td align="center" valign="middle" >MiIIHR34</td></tr><tr><td align="center" valign="middle" >F: TCTATAAGTGCCCCCTCACG R: ACTGCCACCGTGGAAAGTAG</td><td align="center" valign="middle" >MiIIHR36</td></tr></tbody></table></table-wrap><p>Mangifera andamanica (<xref ref-type="fig" rid="fig3">Figure 3</xref>(a)): It is a huge tree with oval shaped fruits borne in clusters. The peel of the fruits was observed to be thin, orange coloured. The pulp is fibrous and juicy with sweet taste (TSS: 22˚ Brix) and yellow in colour. The average weight of fruits was 11.57 g. The leaf tip was found to be acute and the leaf base was cuneate with flat margin. The leaf length and breadth were found to be 17.7 and 4.8 cm respectively. The fruit length and breadth were observed to be 3.15 cm and 2.07 cm respectively.</p><p>Mangifera camptosperma (<xref ref-type="fig" rid="fig3">Figure 3</xref>(b)): It is a tall tree with sparse foliage and fruits were found to be totally flat and round in shape. The fruit pulp was found to be very fibrous and non-edible. The fruit weight was around 51.8 g. The fruit length and fruit breadth were around 9.86 g and 29.5 g respectively. The pulp recovery was 23% with hardly any edible pulp.</p><p>Mangifera griffithii (<xref ref-type="fig" rid="fig3">Figure 3</xref>(c)): The species Mangifera griffithii was located on the hill top of Mt. Hariett. The tree was found to be moderately vigorous. The leaves resembled the leaves of Anacardium occidentale leaves with obtuse base and round tip. The leaves were also leathery, with a length of 13.5 cm and a breadth of 4.3 cm. The fruits were small oval shaped with attractive purple peel color. The fruit weight was observed to be 11.2 g and the pulp recovery was 12%. Although the fruits were observed to have very little pulp, they were juicy with sweet taste (22.6˚ Brix).</p><p>Mangifera odorata (<xref ref-type="fig" rid="fig3">Figure 3</xref>(d)): The species Mangifera odorata is characterized by the distinct odour of the fruit. It possibly represents hybrid forms between M. indica and M. foetida (Ding Hou, 1978). The fruits on an average weigh about 200 g and the TSS is about 21.4˚ Brix. The pulp recovery is less than 55 per cent. The fruits on ripening have greenish purple peel colour and yellow pulp colour. The panicle is characterized by sparse flowers contrary to the dense flowers of Mangifera indica. Mangifera odorata is also polyembryonic in nature; compared to other wild species the edible quality in M. odorata is far superior, although, much inferior to Mangifera indica.</p><p>Mangifera indica (<xref ref-type="fig" rid="fig3">Figure 3</xref>(e)): It is a native of the Indian Peninsula with a spreading tree of 20 - 45 m; all parts glabrous except inflorescence. Leaves were thinly coriaceous or membranaceous varied in size and shape. Fruit is Drupe large, oblong or subreniform; flesh thick with sweet juice; highly variable in size, shape and coloration of the epicarp in the different cultivated varieties; stone fibrous, very hard, the fibrous are very long in the wild types and inferior cultivated types; cotyledons two, rarely many, unequal. M. indica is economically the most important species of the genus, as it bears one of the most delicious tropical fruits, the mangoes.</p><p>In the second exploratory survey carried out in the Andaman Islands, resulted in locating the variants of M. griffithii, in Shoalbay region apart from Mt Harriet. The leaf and fruit characteristics of the two specimens were observed to be similar. The original specimen of M. griffithii from Mt. Harriet (<xref ref-type="fig" rid="fig2">Figure 2</xref> and <xref ref-type="fig" rid="fig3">Figure 3</xref>) had slightly longer, wider leaf than the ones observed near the Shoalbay School. The apex of the leaves (<xref ref-type="fig" rid="fig3">Figure 3</xref>) observed near the Shoalbay School was slightly more pointed compared to the Mt Harriet leaf sample. The fruits were observed to be similar in both the types but the tree near Shoalbay School was taller compared to the one at</p><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Mangifrera griffithii tree, leaf and fruit found near Shoalbay Schoo</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2602172x7.png"/></fig><fig-group id="fig3"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Tree, leaf, fruit and stone characteristics of Mangifera species studied. (a) Mangifera andamanica; (b) Mangifera camptosperma; (c) Mangifera griffithii; (d) Mangifera odorata; (e) Mangifera indica.</title></caption><fig id ="fig3_1"><label>(b)</label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2602172x8.png"/></fig><fig id ="fig3_2"><label>(c)</label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2602172x9.png"/></fig><fig id ="fig3_3"><label>(d)</label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2602172x10.png"/></fig><fig id ="fig3_4"><label>(e)</label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2602172x11.png"/></fig><fig id ="fig3_5"><label></label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2602172x12.png"/></fig></fig-group><p>Mt. Harriet. Survey carried out previously by several workers [<xref ref-type="bibr" rid="scirp.59243-ref26">26</xref>] - [<xref ref-type="bibr" rid="scirp.59243-ref28">28</xref>] in the diversity rich regions of Mangifera indica has resulted in several seedling selections in mango, which shows that there is every chance that seedling variants with desirable traits can be identified. The exploratory surveys help in the location of useful types be it wild species or varieties having desirable traits in the places of their diversity. They also help in conserving these types in situ as well as ex situ.</p></sec><sec id="s3_2"><title>3.2. Molecular Analysis</title><p>The nucleotide sequence data generated from chloroplast and nuclear markers has been deposited in DDBJ with the accession numbers DDBJ: AB597999 - DDBJ: AB598008 for petB-petD intergenic spacer; DDBJ: AB598010 - DDBJ: AB598019 for trnL-trnF intergenic spacer; DDBJ: AB598021 - DDBJ: AB598030 for rps16 gene; and DDBJ: AB598032 - DDBJ: AB598041 for ETS region.</p></sec><sec id="s3_3"><title>3.3. Chloroplast Markers</title><p>The Phylograms that are generated for all the 3 chloroplast makers, used in the present study are in congruent to each other by resulting in similar clustering of Mangifera species.</p><sec id="s3_3_1"><title>3.3.1. petB-petD</title><p>The phylogram of MP (<xref ref-type="fig" rid="fig4">Figure 4</xref>) method resulted into two clusters of which M. odorata and M.andamanica have been clustered into one group leaving the rest 3 species into another that have been further subgrouped into 2 subclusters. Here M. camptosperma has been grouped into one subcluster leaving, M. griffithii and M. indica into the other.</p></sec><sec id="s3_3_2"><title>3.3.2. trnL-trnF</title><p>The phylogram of MP (<xref ref-type="fig" rid="fig5">Figure 5</xref>) method resulted into two clusters of which M. andamanica clustered into one leaving the rest 4 species into another that have been further subgrouped into 3 subclusters leaving M. odorata and M. camptosperma into two individual subclusters with M. griffithii and M. indica into the other.</p><fig id="fig4"  position="float"><label><xref ref-type="fig" rid="fig4">Figure 4</xref></label><caption><title> Phylogram of Mangifera species generated from petB-petD marker using Maximum Parsimony method, with a Bootstrap value of 2000 iterations, of Molecular Evolutionary Genetic Analysis (MEGA) 4.0 program</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2602172x13.png"/></fig><fig id="fig5"  position="float"><label><xref ref-type="fig" rid="fig5">Figure 5</xref></label><caption><title> Phylogram of Mangifera species generated from trnL-trnF marker using Maximum Parsimony method, with a Bootstrap value of 2000 iterations, of Molecular Evolutionary Genetic Analysis (MEGA) 4.0 program</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2602172x14.png"/></fig></sec><sec id="s3_3_3"><title>3.3.3. rps16</title><p>The clustering pattern of rps16 is similar to that of trnL-trnF. The phylogram by MP (<xref ref-type="fig" rid="fig6">Figure 6</xref>) method resulted into two clusters of which M. andamanica clustered into separate group leaving the rest 4 species into another that have been further subgrouped into 3 subclusters leaving M. odorata and M. camptosperma into two individual subclusters with M. griffithii and M. indica into the other.</p></sec></sec><sec id="s3_4"><title>3.4. Nuclear Markers</title><sec id="s3_4_1"><title>3.4.1. ETS</title><p>The clustering pattern of ETS using MP (<xref ref-type="fig" rid="fig7">Figure 7</xref>) method resulted in the phylograms showing two main clusters containing M. andamanica in one cluster leaving the rest 4 species into another that have been further subgrouped into 2 subclusters leaving M. odorata into one subcluster and M. camptosperma, M. griffithii and M. indica into the other.</p></sec><sec id="s3_4_2"><title>3.4.2. Phylogenetic Relationships among Mangifera Species</title><p>The phylogenetic relationships among Mangifera spp was earlier reported by [<xref ref-type="bibr" rid="scirp.59243-ref2">2</xref>] based on the morphology where he mentioned the existence of 41 valid species of Mangifera that had been classified into two different</p><fig id="fig6"  position="float"><label><xref ref-type="fig" rid="fig6">Figure 6</xref></label><caption><title> Phylogram of Mangifera species generated from rps16 marker using Maximum Parsimony method, with a Bootstrap value of 2000 iterations, of Molecular Evolutionary Genetic Analysis (MEGA) 4.0 program</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2602172x15.png"/></fig><fig id="fig7"  position="float"><label><xref ref-type="fig" rid="fig7">Figure 7</xref></label><caption><title> Phylogram of Mangifera species generated from ETS marker using Maximum Parsimony method, with a Bootstrap value of 2000 iterations, of Molecular Evolutionary Genetic Analysis (MEGA) 4.0 program</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2602172x16.png"/></fig><p>sections viz section I and section II. Again in 1993 the most acceptable classification of Mangifera species has been described by [<xref ref-type="bibr" rid="scirp.59243-ref4">4</xref>] , which includes 69 species of which 58 species have been classified into subgenera Mangifera and Limus with several sections Marchandra, Euantherae, Rawa and Mangifera under Mangifera subgenus and sections Deciduae and Perennis for the subgenus Limus. According to this classification M.odorata was classified as the section Perennis of the subgenus Limus leaving the other 3 species of the present study, which were classified into the two sections of the subgenus Mangifera; the section Mangifera for M.indica and the section Rawa for M. griffithii and M. andamanica. The remaining final Mangifera species taken in the study is M.camptosperma whose position was not mentioned in this classification.</p><p>The results of the present study are in congruence with Kosterman’s classification by clustering M. indica and M. griffithii, belonging to the subgenus Mangifera, when compared to M. odorata which belongs to subgenus Limus. The clustering pattern of M.camptosperma with M. indica and M. griffithii shows that they share common ancestry and are evolutionary related hence the position of M. camptosperma has to be considered under the subgenus Mangifera. All the marker analysis in this study showed that M. andamanica grouped separately from the other Mangifera species of subgenus Mangifera showing that it doesn’t belong to the genus Mangifera as earlier stated [<xref ref-type="bibr" rid="scirp.59243-ref29">29</xref>] . The fruits of M. andamanica are very inferior in quality without any pulp. The shape of the fruits does not resemble any of the indica varieties and fruits have no edible pulp, being juicy and fibrous. The present study results indicate that the taxonomic position of M. andamanica should be reconsidered.</p></sec></sec></sec><sec id="s4"><title>4. Conclusion</title><p>Chloroplast markers (petB-petD; trnL-trnF; rps16) and nuclear marker (ETS) clearly show that M. andamanica is not closely related to M. indica and M. griffithii which belong to subgenus Mangifera. This re-confirms the earlier objections which were raised by Mukherjee [<xref ref-type="bibr" rid="scirp.59243-ref29">29</xref>] about M. andamanica taxonomical position in this subgenus. This study also classifies M. camptosperma under subgenus Mangifera based on our analysis, whose position was not assigned earlier. Thus, finally we conclude that classification of M. andamanica under genus Mangifera needs reconsideration and M. camptosperma has to be included in the subgenus Mangifera. The climatic requirement for these species is very specific. The surveys carried out have shown that the tree observed in Shoalbay region is also M. griffithii. Due to the propagation by seeds, there is difference in certain morphological features between the two specimens. The in situ evaluation, collection and ex situ conservation has to be taken up on priority; otherwise we may lose these species.</p></sec><sec id="s5"><title>Acknowledgements</title><p>The authors gratefully acknowledge the support received by the Director, Indian Institute of Horticultural Research for the exploration and Department of Biotechnology (DBT), New Delhi, India for their financial support.</p></sec><sec id="s6"><title>Cite this paper</title><p>Makki RamachandraDinesh,Kundapura VenkataramanaRavishankar,P.Nischita,B. S.Sandya,B.Padmakar, S.Ganeshan,R.Chithiraichelvan,T. V. R.S. Sharma, (2015) Exploration, Characterization and Phylogenetic Studies in Wild Mangifera indica Relatives. American Journal of Plant Sciences,06,2151-2160. doi: 10.4236/ajps.2015.613217</p></sec><sec id="s7"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.59243-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Hyam, R. and Pankhurst, R. (1995) Plants and Their Names: A Concise Dictionary. Oxford University Press, Oxford.</mixed-citation></ref><ref id="scirp.59243-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Mukherjee, S.K. (1953) Origin, Distribution and Phylogenetic Affinity of the Species of Mangifera L. Journal of the Linnean Society of London, Botany, 55, 65-83. http://dx.doi.org/10.1111/j.1095-8339.1953.tb00004.x</mixed-citation></ref><ref id="scirp.59243-ref3"><label>3</label><mixed-citation publication-type="book" xlink:type="simple">Bompard, J.M. and Schnell, R.J. (1997) Taxonomy and Systematics. In: Litz, R.E., Ed., The Mango: Botany, Production and Uses, CAB Intl., Wallingford, 21-47.</mixed-citation></ref><ref id="scirp.59243-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Kostermans, A.J.G.H. and Bompard, J.M. (1993) The Mangoes: Their Botany, Nomenclature, Horticulture and Utilization. Academic Press, Waltham.</mixed-citation></ref><ref id="scirp.59243-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Mukherjee, S.K. (1985) Systematic and Ecogeographic Studies on Crop Genepool: Mangifera L. International Board for Plant Genetic Resources, Rome, 86.</mixed-citation></ref><ref id="scirp.59243-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Eiadthong, W., Yonemori, K., Sugiura, A., Utsunomiya, N. and Subhadrabandhu, S. (1999) Analysis of Phylogenetic Relationships in Mangifera by Restriction Site Analysis of an Amplified Region of cpDNA. Scientia Horticulturae, 80, 145-155. http://dx.doi.org/10.1016/S0304-4238(98)00222-2</mixed-citation></ref><ref id="scirp.59243-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Volkov, R.A., Kostishin, S., Ehrendorfer, F. and Schweizer, D. (1996) Molecular Organization and Evolution of the External Transcribed rDNA Spacer Region in Two Diploid Relatives of Nicotiana tabacum (Solanaceae). Plant Systematics and Evolution, 201, 117-129. http://dx.doi.org/10.1007/BF00989055</mixed-citation></ref><ref id="scirp.59243-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Baldwin, B.G. and Markos, S. (1998) Phylogenetic Utility of the External Transcribed Spacer (ETS) of 18S-26S rDNA; Congruence of ETS and ITS Trees of Calycadenia (Compositae). Molecular Phylogenetics and Evolution, 10, 449-463. 
http://dx.doi.org/10.1006/mpev.1998.0545</mixed-citation></ref><ref id="scirp.59243-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Linder, C.R., Goertzen, L.R., Heuvel, B.V., Francisco-Ortega, J. and Jansen, R.K. (2000) The Complete External Transcribed Spacer of 18S-26S rDNA: Amplification and Phylogenetic Utility at Low Taxonomic Levels in Asteraceae and Closely Allied Families. Molecular Phylogenetics and Evolution, 14, 285-303.  
http://dx.doi.org/10.1006/mpev.1999.0706</mixed-citation></ref><ref id="scirp.59243-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Sallares, R. and Brown, T.A. (2004) Phylogenetic Analysis of Complete 5’ External Transcribed Spacers of the 18S Ribosomal RNA Genes of Diploid Aegilops and Related Species (Triticeae, Poaceae). Genetic Resources and Crop Evolution, 51, 710-712. http://dx.doi.org/10.1023/B:GRES.0000034576.34036.a1</mixed-citation></ref><ref id="scirp.59243-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Jesper, K., Groeninckx, I., Steven, D., Timothy, J.M. and Brigitta, B. (2008) The Phylogenetic Utility of Chloroplast and Nuclear DNA Markers and the Phylogeny of the Rubiaceae Tribe Spermacoceae. Molecular Phylogenetics and Evolution, 49, 843-866. http://dx.doi.org/10.1016/j.ympev.2008.09.025</mixed-citation></ref><ref id="scirp.59243-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Shaw, J., Lickey, E.B., Beck, J.T., Farmer, S.B., Liu, W., Miller, J., Siripun, K.C., Winder, C.T., Schilling, E.E. and Small, R.L. (2005) The Tortoise and the Hare II: Relative Utility of 21 Noncoding Chloroplast DNA Sequences for Phylogenetic Analysis. American Journal of Botany, 92, 142-166. http://dx.doi.org/10.3732/ajb.92.1.142</mixed-citation></ref><ref id="scirp.59243-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Shaw, J., Lickey, E.B., Schilling, E.E. and Small, R.L. (2007) Comparison of Whole Chloroplast Genome Sequences to Choose Noncoding Regions for Phylogenetic Studies in Angiosperms: The Tortoise and the Hare III. American Journal of Botany, 94, 275-288. http://dx.doi.org/10.3732/ajb.94.3.275</mixed-citation></ref><ref id="scirp.59243-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Gielly, L. and Taberlet, P. (1994) The Use of Chloroplast DNA to Resolve Plant Phylogenies: Noncoding versus rbcL Sequences. Molecular Biology and Evolution, 11, 769-777.</mixed-citation></ref><ref id="scirp.59243-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Ravishankar, K.V., Lalitha, A. and Dinesh, M.R. (2000) Assessment of Genetic Relatedness among Mango Cultivars of India Using RAPD Markers. The Journal of Horticultural Science and Biotechnology, 13, 26-28.</mixed-citation></ref><ref id="scirp.59243-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Schuelke, M. (2000) An Economic Method for the Fluorescent Labelling of PCR Fragments. Nature Biotechnology, 18, 233-234. http://dx.doi.org/10.1038/72708</mixed-citation></ref><ref id="scirp.59243-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Ravishankar, K.V., Mani, B.H.R., Anand, L. and Dinesh, M.R. (2011) Development of New Microsatellite Markers from Mango (Mangifera indica) and Cross Species Amplification. American Journal of Botany, 98, e96-e99. 
http://dx.doi.org/10.3732/ajb.1000263</mixed-citation></ref><ref id="scirp.59243-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Perrier, X. and Jacquemoud-Collet, J.P. (2006) DARwin Software. http://darwin.cirad.fr/</mixed-citation></ref><ref id="scirp.59243-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Oxelman, B., Liden, M. and Berglund, D. (1997) Chloroplast rps16 Intron Phylogeny of the Tribe Sileneae (Caryophyllaceae). Plant Systematics and Evolution, 206, 393-410. http://dx.doi.org/10.1007/BF00987959</mixed-citation></ref><ref id="scirp.59243-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Taberlet, P., Gielly, L., Pautou, G. and Bouvet, J. (1991) Universal Primers for Amplification of Three Non-Coding Regions of Chloroplast DNA. Plant Molecular Biology, 17, 1105-1109. http://dx.doi.org/10.1007/BF00037152</mixed-citation></ref><ref id="scirp.59243-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">L&amp;oumlhne, C. and Borsch, T. (2005) Molecular Evolution and Phylogenetic Utility of the petD Group II Intron: A Case Study in Basal Angiosperms. Molecular Biology and Evolution, 22, 317-332. http://dx.doi.org/10.1093/molbev/msi019</mixed-citation></ref><ref id="scirp.59243-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Wang, F.Y., Gong, X., Hu, C.M. and Hao, G. (2008) Phylogeography of an Alpine Species Primula secundiflora Inferred from the Chloroplast DNA Sequence Variation. Journal of Systematics and Evolution, 46, 13-22.</mixed-citation></ref><ref id="scirp.59243-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Boonruangrod, R., Silvia, F. and Kornel, B. (2009) Elucidation of Origin of the Present Day Hybrid Banana Cultivars Using the 5’ETS rDNA Sequence Information. Molecular Breeding, 24, 77-91. 
http://dx.doi.org/10.1007/s11032-009-9273-z</mixed-citation></ref><ref id="scirp.59243-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Thompson, J.D., Higgins, D.G. and Gibson, T.J. (1994) CLUSTAL W: Improving the Sensitivity of Progressive Multiple Sequence Alignment through Sequence Weighting, Position-Specific Gap Penalties and Weight Matrix Choice. Nucleic Acids Research, 22, 673-695. http://dx.doi.org/10.1093/nar/22.22.4673</mixed-citation></ref><ref id="scirp.59243-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Tamura, K., Dudley, J., Nei, M. and Kumar, S. (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0. Molecular Biology and Evolution, 24, 1596-1599. http://dx.doi.org/10.1093/molbev/msm092</mixed-citation></ref><ref id="scirp.59243-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Rajan, S. and Lal, B. (1999) Solar Radiation Plays Role in Colour Development on Dashehari Fruits. 6th International Mango Symposium at Pattayaa, Thailand, 6-9 April 1999, 99.</mixed-citation></ref><ref id="scirp.59243-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Desai, A.R. and Dhandar, D.G. (2000) Variation in Physico-Chemical and Morphogenetic Characters of Some Mango Varieties of Goa. Acta Horticulturae, 509, 243-249.</mixed-citation></ref><ref id="scirp.59243-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Dinesh, M.R. and Vasugi, C. (2002) Catalogue of Mango Germplasm. IIHR, Bengaluru.</mixed-citation></ref><ref id="scirp.59243-ref29"><label>29</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Mukherjee</surname><given-names> S.K. </given-names></name>,<etal>et al</etal>. (<year>1949</year>)<article-title>A Monograph on the Genus Mangifera</article-title><source> Lloydia</source><volume> 12</volume>,<fpage> 73</fpage>-<lpage>136</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref></ref-list></back></article>