Colloidal chitin was prepared according modified method as described by Faramarzi et al. [11] . Ten grams of chitin from shrimp shell flake were added into 100 ml concentrated HCl (37%) and kept in vigorous stirring for 2 h at room temperature or until chitin completely dissolved. The suspension was precipited by slowly added to 500 ml of ice-cold absolute ethanol. Then pH of suspension was neutralized with 10 N NaOH. Suspension was centrifuged at 8000 rpm for 10 min and the precipitate was ready to use as medium substrate.

Solid waste (shrimp-shells) and shrimp wastewater aseptically collected from PT. Bumi Menara Internusa (08˚13'03.08''S, 112˚44'49.1''E). Chitinolytic bacteria were isolated using spread plate method in CCA medium (Colloidal Chitin Agar) which consist of (g/L): Na₂HPO₄ (6); KH₂PO₄ (3); NH₄Cl (1); NaCl (0.5); yeast extract (0.05); agar (15) and colloidal chitin 0.5% (w/v). Chitinolytic bacteria showed by clear zones surrounding colonies after 72 h of incubations at 30˚C [8] .

Primary screening was performed by disc diffusion modified method of Jiang [12] with three replications. A loopfull of bacteria inoculated in colloidal chitin broth containing 1% colloidal chitin (w/v) and incubated for 24 h, 180 rpm, 30˚C [9] . Cultures of each isolate (10⁷ cells/ml) was inoculated to sterile paper disc (d = 5 mm, Whatmann filter paper No. 1) and put on medium agar surface supplemented with 1% colloidal chitin and incubated at 30˚C [5] . Chitinolytic index data (ratio of clear zone and colony sizediameter) were recorded up to 7 days incubations [11] . Data of chitinolytic index were analyzed using analysis of variance (ANOVA) that continued with Games-Howel test (α = 0.05) using SPSS for Windows V.16.

Chitinase activity was determined using colorimetric method as described by Monreal and Reese [13] with three replications. Reaction mix consist of 1 ml crude enzyme, 1.5 ml of 1% colloidal chitin substrate in 200 mM potassium phosphate buffer (pH 6.0). The mixture was incubated at 30˚C for 2 h, boiled for 10 min to stop reaction, and centrifuged at 8000 rpm for 20 min. Then 1 ml of test supernatant was added to 1 ml of DNS (Dinitrosalicylic Acid), boiled for 5 min, and cooling down at room temperature. Released of GlcNAc (N- acetylglucosamine) was measured at 540 nm. Standard curve of GlcNAc was plotted between GlcNAc con- centration and GlcNAc absorbance. One unit of chitinase activity was described as the amount of enzyme which liberate 1.0 mg GlcNAc per hour from chitin substrate under reaction condition. Data of chitinase activity were analyzed with Independent Sample T-test analysis statistic (α = 0.05) using SPSS for Windows V.16.

Two loopfull of chitinolytic bacteria was inoculated in Luria Bertani broth (Merck) and incubated for 24 hours, 120 rpm, 30˚C. Whole genome extraction was carried out by Ausubel method [14] .

Sequences of 16S rDNA was amplified with universal primers 27F (5’GAGAGTTTGATCCTGGCTCAG3’) and 1492R (5’CTACGGCTACCTTGTTACGA3’) [15] . PCR master mix solution was prepared as described by Intron Biotechnology [16] as shown in Table 1, PCR reaction condition was based on method of Mulhardt [17] and Zarei et al. [18] as shown in Table 2. Amplicon of 16S rDNA was separated by 1% electrophoresis agarose gels [10] . Amplicon of partial 16S rDNA was purified and sequenced for further process in First Base, Malaysia. Sequencing was carried out using same primers. Partial sequences was matched with nucleotide database in Gene Bank (http://www.ncbi.nlm.nih.gov) using BLASTN to identify bacteria isolate based on highest % nucleotide similarity.

Sequences of 16S rDNA was matched with sequences of reference strains (Table 3) in GenBank database (http://www.ncbi.nlm.nih.gov) and was aligned through Clustal W Multiple Alignment tool. Phylogeny tree was constructed using phylogeny tool in MEGAV.6 program, inferenced using Maximum Likelihood method, and analyzed with evolutionary distance using Tamura-Nei model [19] . Outgroup of phylogeny tree was choosed according to similar genus and has been reported as chitinolytic bacteria.

Eighteen isolates with different morphology of colonies were isolated from shrimp waste, 14 isolates from wastewater, and 4 isolates from shrimp-shells waste. Wastewater aeration can support more bacterial growth. During aeration, bacteria will grow and survive by using oxygen to breakdown wastewater compound and combine with organic matter in wastewater to form an activated sludge [20] . Based on primary screening, two of 18 isolates showed the highest chitinolytic index (CI > 2), there were isolates PBK 2 and SA 1.2 with chitino- lytic index 2.069 dan 2.084 respectively. Clear zone surrounding the colony indicates chitinase activity to break- down chitin compound in medium [8] . From primary screening result, isolate PBK 2 and SA 1.2 were selected for chitinase activity assay.

As shown in Figure 1, isolate PBK 2 and SA 1.2 showed almost similar chitinase activity (0.213 and 0.219 U/ml respectively). Chitinase activity is amount of product which is produced from chitin substrate derivation.

Chitin is substrate which can induce exochitinase and endochitinase formation in microorganisms [21] . Rate of chitin waste degradation is influenced by chitinase activity, enviromental factors, indigenous microorganisms metabolism from carbon utilization as source of energy, protein synthesis, and releasing cell metabolism pro- ducts [22] .

Chitinase activity of microorganisms is different from each other depends on various factors such as time of enzymatic reaction, enzyme and substrate concentation, incubation time, and pH of medium [23] . Based on Lamine et al. [24] Serratia marcescens DSM 30121^T has the highest chitinase activity (0.556 U/ml) when was cultured in medium containing 1% colloidal chitin concentration, at 30˚C, and pH-value of 6. Based on Saleem et al. [25] Bacillus thuringiensis isolate CMBL-Bt4 has the highest chitinase activity than 12 of others Bacillus thuringiensis (0.23 U/ml) after 4 days incubation at 37˚C with pH value 7 for culture medium. Meanwhile, according to Saadoun et al. [26] isolate Streptomyces sp. S₂₄₂ has the highest chitinase activity (0.162 U/ml) after 4 days incubation at 30˚C with pH value 7 for culture medium.

Amplicon 16S rDNA sequences of isolate PBK 2 and SA 1.2 on 1% agarose gels showed in 1500 bp (Figure 2). According to Nocker et al. [27] amplification 16S rDNA sequences of bacteria can produce 1500 - 1600 bp amplicon. Analysis of DNA sequences showed that isolate of PBK 2 was identified as Acinetobacter johnsonii 3-1, whereas SA 1.2 identified as Bacillus amyloliquefaciens GR53 with 99.78% similarity respectively. Identi- fication criteria at species level consist of strains which have 16S rDNA sequences similarity more than 97%, whereas sequences similarity more than 99% include in strain level [28] .

Genus Acinetobacter and Bacillus were dominant bacteria in industrial wastewater especially in activated sludge flocs which involved in denitrification process with other genus such as Pseudomonas, Spirillum, Hyphomicrobium, Agrobacterium, Propionibacterium, Rhizobium, Corynebacterium, Cytophaga, Thiobacillus, and Alcaligenes [29] . Genus Acinetobacter is one of the phosporus accumulating microorganisms in wastewater such as Acinetobacter johnsonii [30] and Acinetobacter calcoaceticus [31] . Those bacteria will accumulate phosphorus as polyphosphate in granules in aerobic condition for cell synthesis and energy transportation, this stage can reduce phosphorus in wastewater 10% - 30%, then inorganic phosphate was released in anaerobic condition [29] .

As shown in Figure 3, isolate PBK 2 revealed close phylogenetic relationship with Acinetobacter johnsonii 3-1, whereas isolate SA 1.2 revealed close phylogenetic relationship with Bacillus amyloliquefaciens GR53. Based on microscopic characterization, isolate PBK 2 was Gram negative bacteria with coccibacil-shape and non-endospore forming accordance with Acinetobacter johnsonii, meanwhile isolate SA 1.2 was Gram positive, endospore forming, and rod-shape bacteria accordance with Bacillus amyloliquefaciens. Chitinase activity of Bacillus amyloliquefaciens was reported for the first time by Sabry [32] . Those bacteria can utilize shrimp shell

to produce chitinase. According to Wang et al. [33] . Gram positive bacteria which identified as Bacillus amyloliquefaciens V656 based on analysis 16S rDNA can produced antifungal enzyme. This enzyme showed extra- celullar chitinase activities against fungi. Acinetobacter johnsonii was reported as one of the chitinase-producing bacteria isolated from proximal intestine of Atlantic Salmon. Genus Acinetobacter and Bacillus were dominant enzyme-producing bacteria in the intestine of fish with chitin diet treatment [34] .