<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">OJMM</journal-id><journal-title-group><journal-title>Open Journal of Medical Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3372</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ojmm.2015.52008</article-id><article-id pub-id-type="publisher-id">OJMM-56852</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Medicine&amp;Healthcare</subject></subj-group></article-categories><title-group><article-title>
 
 
  Frequency of &lt;i&gt;Staphylococcal&lt;/i&gt; Cassette Chromosome &lt;i&gt;mec&lt;/i&gt; Type IV and Type V in Clinical Isolates of Methicillin Resistant &lt;i&gt;Staphylococcus aureus&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>bdul</surname><given-names>Hannan</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Faqeeha</surname><given-names>Javed</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Sidrah</surname><given-names>Saleem</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Khadija</surname><given-names>Tahira</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Shah</surname><given-names>Jahan</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Department of Microbiology, University of Health sciences, Lahore, Pakistan</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>faqehaaz@hotmail.com(BH)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>02</day><month>06</month><year>2015</year></pub-date><volume>05</volume><issue>02</issue><fpage>69</fpage><lpage>75</lpage><history><date date-type="received"><day>24</day>	<month>February</month>	<year>2015</year></date><date date-type="rev-recd"><day>accepted</day>	<month>30</month>	<year>May</year>	</date><date date-type="accepted"><day>2</day>	<month>June</month>	<year>2015</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  MRSA is able to generate a modified variety of penicillin binding protein named as PBP2a instead of PBP which makes it resistant against penicillin and methicillin. Production of PBP2a is due to the presence of a gene on 
  Staphylococcal cassette chromosome or SCC termed as “
  mec-A gene”. SCC is a mobile genetic element carrying many resistance genes. It is because of current antibiotic selection pressure that by now there are eight types (I - VIII) of SCC
  mec. This research has been designed to determine frequency of SCC
  mec type IV and V in clinical isolates of MRSA. A total of 70 presumptive MRSA isolates collected from a tertiary care hospital of Lahore were cultured on blood agar, incubated overnight at 37&amp;degC aerobically. Next day, they were examined for cultural characteristics, colonial morphology, gram stain, and biochemical profile. Confirmation of MRSA was done by phenotypic disk diffusion method according to (CLSI) 2013 guidelines. 
  mecA gene was also detected at molecular level. Molecular identification of SCC
  mec type IV and V was done by Nested PCR strategy. A total of 50 isolates were confirmed to be MRSA Molecular detection of SCC
  mec type IV and V revealed that 11 isolates (22%) possess SCC
  mec type IV and only 2 isolate (4%) carries SCC
  mec type V. It is obvious from results that SCC
  mec type IV and V are present in our population too. Larger study (with larger sample size) might be undertaken to find out actual emergence of SCC
  mec type IV and V in our population.
 
</p></abstract><kwd-group><kwd>MRSA</kwd><kwd> SCC&lt;i&gt;mec&lt;/i&gt; Type IV</kwd><kwd> SCC&lt;i&gt;mec&lt;/i&gt; Type V</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Distribution of methicillin resistant staphylococcus aureus (MRSA) is worldwide and its incidence varies depending upon geographical location of various regions. A survey report documented the prevalence of MRSA from 42% to 51% in Pakistan [<xref ref-type="bibr" rid="scirp.56852-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.56852-ref2">2</xref>] . Main causative agent responsible for this resistance is carriage by the MRSA strains mecA gene. mecA gene encodes an extra penicillin-binding protein (PBP2a). It has low affinity for all β-lactam antibiotics [<xref ref-type="bibr" rid="scirp.56852-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.56852-ref4">4</xref>] . Many techniques have been used for epidemiological typing of MRSA which helps to study evolutionary relationship of different MRSA strains. However, there is very little epidemiological data about frequency of SCCmec type IV and V in Pakistan.</p><p>Staphylococcal cassette chromosome mec is a mobile genetic element which is characterized by presence of two genetic elements mec gene complex, ccr gene complex and Junkyard regions. mec gene complex is composed of IS431mec, mecA, and its regulatory genes mecR1and mecl. Two important ccr gene complexes have been reported one carrying two adjacent ccr genes, ccrA and ccrB, and the second carrying ccrC. The ccrA and ccrB genes identified have been classified into four and five types respectively resulting in five classes of mec complex (A, B, C1, C2, and E), corresponding to which eight SCCmec types (I - VII) have been described [<xref ref-type="bibr" rid="scirp.56852-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.56852-ref6">6</xref>] . Ccr gene encodes cassette chromosome recombinase which integrates or excise the SCCmec into the recipient chromosome.</p><p>Type IV SCCmec is one of the most challenging types, which carries mecA gene and lack other resistance genes. Its structure is smaller than the other SCCmec types and carries functional recombinases, being shortest and most mobile it spreads in community more rapidly than other SCCmec types [<xref ref-type="bibr" rid="scirp.56852-ref7">7</xref>] . SCCmec type V structurally resembles SCCmec type IV as it lacks other resistance genes except mecA [<xref ref-type="bibr" rid="scirp.56852-ref6">6</xref>] . It has been reported that SCCmec type IV and V are replacing other SCCmec types I, II and III in hospital setting [<xref ref-type="bibr" rid="scirp.56852-ref8">8</xref>] . It is reported that 90% of SCCmec IV and 62% of SCCmec V strains carry PVL<sup> </sup>gene [<xref ref-type="bibr" rid="scirp.56852-ref9">9</xref>] . PVL cytotoxin is responsible for serious MRSA associated infections. Prevalence of SCCmec type IV and V has not yet reported in Pakistan. Herein we report frequency of SCCmec type IV and V from clinical isolates of MRSA. To best of our knowledge, this is the first study from our setup.</p></sec><sec id="s2"><title>2. Material and Methods</title><p>This descriptive study was carried out in microbiology and resource laboratory at University of Health Sciences, Lahore, Pakistan. A total of 70 presumptive MRSA isolates were collected from a tertiary care hospital of Lahore. These isolates were obtained from various clinical specimens including blood (n = 5), pus (n = 45), sputum (n = 10), cardiovascular tip (n = 4), and tracheal aspirate (n = 6). All the isolates were cultured on blood agar and incubated overnight at 37˚C aerobically. After 24 hours they were examined for cultural characteristics, colonial morphology, Gram stain, and biochemical profile. 50 isolates were identified as MRSA using Gram stain catalase, coagulase and Dnase test. Methicillin resistance was confirmed using (30 μg) disc of cefoxitin by phenotypic disk diffusion method according to CLSI guidelines 2013. Following interpretive criteria was used to identify MRSA as: MRSA = ≤ 27 mm and MSSA = ≥ 27 mm.</p></sec><sec id="s3"><title>3. DNA Extraction</title><p>DNA extraction was performed using suspension of isolated colonies prepared in sterile distilled water following protocol of bacterial DNA extraction kit (DNA<sub>zol</sub> <sup>R</sup> BD, USA).Two or three well isolated colonies of each confirmed MRSA isolate were suspended in 0.5 ml autoclaved distilled water. One ml of DNAzol was added in bacterial suspension. The mixture was vortexed vigorously for 15 - 20 seconds and stored at room temperature for 5 minutes then centrifuged for 1 min at 8000 g. 0.4 ml of isopropanol was added to the lysate for precipitation of DNA. The precipitated DNA was sedimented by centrifugation at 6000 g for 5 minutes, supernatant was removed and 0.5 ml of DNAzol was added to the DNA pellet. The DNA pellet was vortexed until it was completely dispersed. It was centrifuged at 6000 g for 5 minutes. The supernatant was removed and washed the DNA pellet by mixing it with 1ml of 75% chilled ethanol. Again it was centrifuged at 7000 g for 5 minutes. The ethanol wash was decanted and stored the eppendrof vertically for 15 minutes to evaporate any residual ethanol. The DNA pellet was dissolved in 50 ul molecular grade water</p></sec><sec id="s4"><title>4. Amplification of SCCmec Type IV and V</title><p>Amplification of DNA was done by Conventional PCR strategy using specific primers (<xref ref-type="table" rid="table1">Table 1</xref>) for SCCmec</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Sequences of primers used for PCR amplification of loci</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Target gene</th><th align="center" valign="middle" >Primers</th><th align="center" valign="middle" >Primer sequences</th><th align="center" valign="middle" >Amplicon size</th><th align="center" valign="middle" >References</th></tr></thead><tr><td align="center" valign="middle"  rowspan="2"  >mecA gene</td><td align="center" valign="middle" >mecA-F</td><td align="center" valign="middle" >5’-AAAATCGATGGTAAAGGTTGGC-3’</td><td align="center" valign="middle"  rowspan="2"  >533 bp</td><td align="center" valign="middle"  rowspan="2"  >[<xref ref-type="bibr" rid="scirp.56852-ref26">26</xref>]</td></tr><tr><td align="center" valign="middle" >mecA-R</td><td align="center" valign="middle" >5’-AGTTCTGCAGTACCGGATTTGC-3’</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >SCCmec type IV</td><td align="center" valign="middle" >SCCmec type IV-F</td><td align="center" valign="middle" >5’-AGTTTCTCAGAATTCGAACG-3’</td><td align="center" valign="middle"  rowspan="2"  >311 bp</td><td align="center" valign="middle"  rowspan="2"  >[<xref ref-type="bibr" rid="scirp.56852-ref27">27</xref>]</td></tr><tr><td align="center" valign="middle" >SCCmec type IV-R</td><td align="center" valign="middle" >5’CCGATATAGAATGGGTTAGC-3’</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >SCCmec type V<sup> </sup></td><td align="center" valign="middle" >SCCmec type V-F</td><td align="center" valign="middle" >5’-TTCTCCATTCTTGTTCATCC-3’</td><td align="center" valign="middle"  rowspan="2"  >377 bp</td><td align="center" valign="middle"  rowspan="2"  >(Milheirico et al., 2007)</td></tr><tr><td align="center" valign="middle" >SCCmec type V-R</td><td align="center" valign="middle" >5’AGAGACTACTGACTTAAGTGG3’</td></tr></tbody></table></table-wrap><p>type IV and V that were commercially synthesized by Gene link. Commercially prepared master mix provided by Fermentas was used in reaction mixture. PCR Reaction was performed in 25 ul reaction volume composition of reaction mixture is given as, Master mix (2x) = 12.5 ul, DNA template = 5 ul, Forward primer (100 pmol) = 1.2 ul, Reverse primer (100 pmol) = 1.2 ul, ddH<sub>2</sub>O = Upto 25 ul. PCR was optimized by predanaturation at 94˚C for 3 min followed by 94˚C for 45 s, 35 cycles of 51˚C for 45 s, 72˚C for 1min ending with final extension step at 72˚C for 10min and hold at 4˚C. The products were electrophoresed in 2% agarose stained with ethidium bromide, and video images obtained using gel documentation system (Becton Dickinson, USA).</p></sec><sec id="s5"><title>5. Results</title><sec id="s5_1"><title>5.1. Bacterial Isolates</title><p>A total of 70 S. aureus isolates were collected out of these 70, 50 were confirmed to be MRSA, 12 strains were confirmed to be MSSA. The rest 8 were neither MRSA nor MSSA and they were not proceeded further. Those 50 MRSA strains were isolated from different sources including Pus (92%); sputum (4%), blood (2%); tracheal aspirate (2%); cardiovascular tip (2%)</p></sec><sec id="s5_2"><title>5.2. CLSI Phenotypic Detection of MRSA</title><p>・ These isolates were methicillin resistant phenotypically (<xref ref-type="fig" rid="fig1">Figure 1</xref>) and also found to have mecA gene by PCR (<xref ref-type="fig" rid="fig2">Figure 2</xref>).</p></sec><sec id="s5_3"><title>5.3. Molecular Detection of SCCmec Type IV and V</title><p>A few PCR amplified representative mecA, SCCmec type IV and V genes are presented in <xref ref-type="fig" rid="fig3">Figure 3</xref> and <xref ref-type="fig" rid="fig4">Figure 4</xref> respectively.</p><p>The Molecular detection of SCCmec type IV and V revealed that 11 isolates (22%) possess SCCmec type IV and only 2 isolate (4%) carries SCCmec type V as given in <xref ref-type="fig" rid="fig5">Figure 5</xref>.</p><fig-group id="fig1"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> (a) Disc diffusion test showing no clear zone of inhibition for cefoxitin disc; for S. aureus (MRSA). (b) Disc diffusion test showing a clear zone of inhibition for cefoxitin disc 27mm in diameter for S. aureus (MSSA).</title></caption><fig id ="fig1_1"><label> (b)</label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-2260170x6.png"/></fig><fig id ="fig1_2"><label></label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-2260170x7.png"/></fig></fig-group><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Ethidium bromide stained agarose gel demonstrating the PCR amplification of mecA gene. Lane M, DNA molecular size marker (100 bp DNA ladder; Biorad) Lane 1, negative control. Lane 2, positive control. Lane 3, mecA gene positive</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-2260170x8.png"/></fig><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Ethidium bromide stained agarose gel demonstrating the PCR amplification of SCCmec type IV gene. Lane M, DNA molecular size marker (100 bp DNA ladder; Biorad) Lane 1, negative control. Lane 2, positive control. Lane 3-8, SCCmec type IV gene positive</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-2260170x9.png"/></fig><fig id="fig4"  position="float"><label><xref ref-type="fig" rid="fig4">Figure 4</xref></label><caption><title> Ethidium bromide stained agarose gel demonstrating the PCR amplification of SCCmec type V gene. Lane M, DNA molecular size marker (100 bp DNA ladder; Bio-Rad) Lane 1, positive control. Lane 2, SCCmec type V gene positive, Lane 3 negative control</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-2260170x10.png"/></fig><fig id="fig5"  position="float"><label><xref ref-type="fig" rid="fig5">Figure 5</xref></label><caption><title> Frequency of SCCmec type IV and Type V amongst MRSA strains n = 50</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/2-2260170x11.png"/></fig></sec></sec><sec id="s6"><title>6. Discussion</title><p>In many countries including Pakistan there is an increasing trend towards the usage of antibiotics [<xref ref-type="bibr" rid="scirp.56852-ref10">10</xref>] . Improper use of antibiotics has resulted in the evolution of many resistant pathogens like MRSA. mecA gene which encodes an extra penicillin-binding protein (PBP2a) leads towards the resistance to β-lactam antibiotics. The mecA gene is located on the Staphylococcal cassette chromosome mec (SCCmec), which carries methicillin-resistance gene and other antibiotic resistance genes integrated in the S.aureus chromosome. Detailed molecular characterization of SCCmec types has not been done in Pakistan; therefore, this study is designed to detect the genotypes SCCmec type IV and V. In this study, the frequency of SCCmec type IV and V is evaluated and the results showed SCCmec type IV = 12 (21%) and V = 2 (4%) in our 50 clinical MRSA isolates. Frequency was determined by PCR strategy as it is more sensitive and specific method used for the detection of different microbiological and viral pathogens.</p><p>We first identified the isolates on the basis of morphological and biochemical characteristics followed by the detection of MRSA by disc diffusion method using 30 &#181;g disc of cefoxitin as recommended by CLSI. As molecular methods were found to be 94% sensitive and specific in detecting MRSA isolates [<xref ref-type="bibr" rid="scirp.56852-ref11">11</xref>] therefore, MRSA was also tested for the presence of mecA gene by using PCR. Results showed 533-bp fragment of mecA gene which was amplified from DNA of all the isolates. PCR results were consistent with phenotypic detection method of MRSA and in complete agreement with a similar study [<xref ref-type="bibr" rid="scirp.56852-ref12">12</xref>] . These isolates were used for subtyping SCCmec by using specific primers. We isolated type IV and V solely from pus specimens. This finding is similar to a study conducted in India where highest number of these types was isolated from patients suffering from Skin and Soft Tissue Infections (SSTI) [<xref ref-type="bibr" rid="scirp.56852-ref13">13</xref>] . Ali and co workers also had reported highest number of these strains from pus specimen [<xref ref-type="bibr" rid="scirp.56852-ref14">14</xref>] .</p><p>Among eleven Asian countries, nine have reported the most prevalent type SCCmec type III while SCCmec type IV has been reported in Korea (n = 2), Philippine (n = 2) and Taiwan (n = 2) [<xref ref-type="bibr" rid="scirp.56852-ref15">15</xref>] . A study in Iran reports prevalence of type IV or V about 14.8% [<xref ref-type="bibr" rid="scirp.56852-ref16">16</xref>] . One of the first reports about MRSA in Pakistan, from AKUH, Karachi, showed the prevalence of two SCCmec types i.e. type III from HA-MRSA and type IV from CA- MRSA [<xref ref-type="bibr" rid="scirp.56852-ref15">15</xref>] . A combined study on MRSA isolates from India and Pakistan revealed that 38% isolates belonged to SCCmec type IV, which were solely isolated from Pakistan while Indian isolates carried SCCmec type III and IIIa [<xref ref-type="bibr" rid="scirp.56852-ref17">17</xref>] . In our results, PCR based genotypic detection of SCCmec type IV and V revealed that SCCmec type IV was more prevalent.</p><p>SCCmec type V isolated in present study is not yet reported in other Asian countries such as Pakistan, Philippines, Singapore, Thailand, Vietnam and Saudi Arabia, Japan, Taiwan and Indonesia [<xref ref-type="bibr" rid="scirp.56852-ref15">15</xref>] . However in Mumbai, India, SCCmec V has also been documented along with SCCmec IV as SCCmec V = 41% and SCCmec IV = 34% [<xref ref-type="bibr" rid="scirp.56852-ref9">9</xref>] . A study from Switzerland has reported 78% SCCmec type IV and 15% SCCmec type V [<xref ref-type="bibr" rid="scirp.56852-ref18">18</xref>] . In USA, Japan and Korea, the most prevalent SCCmec types were I and II [<xref ref-type="bibr" rid="scirp.56852-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.56852-ref20">20</xref>] .</p><p>The number of SCCmec IV and V MRSA strains isolated in the laboratory have been increasing every year from 2006 to 2009; it is apparent that these clones may be replacing other clones in the hospital setting [<xref ref-type="bibr" rid="scirp.56852-ref21">21</xref>] - [<xref ref-type="bibr" rid="scirp.56852-ref23">23</xref>] . Many studies conducted in hospital setting show that MRSA strains SCCmec IV and V which were thought to be associated predominantly with CA-MRSA are also prevailing in hospitals [<xref ref-type="bibr" rid="scirp.56852-ref24">24</xref>] . Just as SCCmec IV has spread over Europe and Asia, SCCmec V may also turn out to be a powerful global epidemic MRSA strain in the next few years [<xref ref-type="bibr" rid="scirp.56852-ref9">9</xref>] . So, for these reasons, our study was very significant not only to detect MRSA, but also to identify SCCmec type V.</p><p>It might be investigated whether patients with type IV and V strains had some risk factors for MRSA infections or not. As reported by De’souza, patients having type IV strains, 24% had risk factors and 76% had no documented risk factors. 32% of the patients with SCCmec type V strain carried MRSA infections because of some risk factor while the rest had no risk factors [<xref ref-type="bibr" rid="scirp.56852-ref25">25</xref>] . Keeping in view, the increasing rate of SCCmec type IV and V in Pakistan and neighbouring countries it should be investigated that either these types are circulators or persisting invaders. Sub typing of SCCmec type IV needs to be done to identify the most frequent subtype native to Pakistan. Further molecular analysis of these MRSA isolates by pulsed field gel electrophoresis or MLST (Multi Locus Sequence Typing) may provide much useful information regarding origin and epidemiology of local isolates.</p><p>New strains which seem to be imported from expanding community or from other countries are adding up in our SCCmec pool. Infections caused by these pathogens lead to prolonged period of illness, financial burden, less number of drugs as choice for treatment and increased risk of mortality. Although antibiotic resistance is a natural phenomenon, yet this process is accelerated by misuse of antibiotics. Unnecessary recommendation of antibiotics should be avoided so that we can somehow reduce the emergence of pan-resistance pathogens like VRSA, otherwise we would not be left with any choice of antibiotics [<xref ref-type="bibr" rid="scirp.56852-ref10">10</xref>] .</p></sec><sec id="s7"><title>7. Conclusion</title><p>SCCmec type IV and V are present in our population too. A larger study (with larger sample size) might be undertaken in future to find out actual emergence of SCCmec type IV and V in our population.</p></sec><sec id="s8"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.56852-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Perwaiz, S., Barakzi, Q., Farooqi, B.J., Khursheed, N. and Sabir, N. (2007) Antimicrobial Susceptibility Pattern of Clinical Isolates of Methicillin Resistant Staphylococcus aureus. Journal of Pakistan Medical Association, 57, 2-4.</mixed-citation></ref><ref id="scirp.56852-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Butt, T., Ahmad, R.N., Usman, M. and Mahmood, A. (2004) Methicillin-Resistant Staphylococcus aureus, Pakistan, 1996-2003. Emerging Infectious Diseases Journal, 10, 1691-1692. http://dx.doi.org/10.3201/eid1009.030844</mixed-citation></ref><ref id="scirp.56852-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Deurenberg, R.H. and Stobberingh, E.E. (2008) The Evolution of Staphylococcus aureus. Infection, Genetics and Evolution, 8, 747-763. http://dx.doi.org/10.1016/j.meegid.2008.07.007</mixed-citation></ref><ref id="scirp.56852-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Berger-Bachi, B. and Rohrer, S. (2002) Factors Influencing Methicillin Resistance in Staphylococci. Archives of Microbiology, 178, 165-171. http://dx.doi.org/10.1007/s00203-002-0436-0</mixed-citation></ref><ref id="scirp.56852-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Katayama, Y., Ito, T. and Hiramatsu, K. (2000) A New Class of Genetic Element, Staphylococcus Cassette Chromosome mec, Encodes Methicillin Resistance in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy, 44, 1549-1555. http://dx.doi.org/10.1128/AAC.44.6.1549-1555.2000</mixed-citation></ref><ref id="scirp.56852-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Berglund, C., Ito, T., Ikeda, M., Ma, X.X., S&amp;oumlderquist, B. and Hiramatsu, K. (2008) Novel Type of Staphylococcal Cassette Chromosome mec in a Methicillin-Resistant Staphylococcus aureus Strain Isolated in Sweden. Antimicrobial Agents and Chemotherapy, 52, 3512-3516. http://dx.doi.org/10.1128/AAC.00087-08</mixed-citation></ref><ref id="scirp.56852-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Liu, Y., Kong, F.R., Xiao, M., Wang, Q.N., O’Sullivan, M., Sintchenko, V., Ma, L. and Gilbert, G.L. (2010) Unexpected Diversity of Staphylococcal Cassette Chromosome mec Type IV in Methicillin-Resistant Staphylococcus aureus Strains. Journal of Clinical Microbiology, 48, 3628-3634. http://dx.doi.org/10.1128/JCM.00351-10</mixed-citation></ref><ref id="scirp.56852-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Stranden, A.M., Frei, R., Adler, H., Flückiger, U. and Widmer, A.F. (2009) Emergence of SCCmec Type IV as the Most Common Type of Methicillin-Resistant Staphylococcus aureus in a University Hospital. Infection, 37, 44-48. http://dx.doi.org/10.1007/s15010-008-7430-7</mixed-citation></ref><ref id="scirp.56852-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">D’Souza, N., Rodrigues, C. and Mehta, A. (2010) Molecular Characterization of Methicillin-Resistant Staphylococcus aureus with Emergence of Epidemic Clones of Sequence Type (ST) 22 and ST 772 in Mumbai, India. Journal of Clinical Microbiology, 48, 1806-1811. http://dx.doi.org/10.1128/JCM.01867-09</mixed-citation></ref><ref id="scirp.56852-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Spellberg, B., Guidos, R., Gilbert, D., Bradley, J., Boucher, H.W., Scheld, W.M., et al. (2008) The Epidemic of Antibiotic-Resistant Infections: A Call to Action for the Medical Community from the Infectious Diseases Society of America. Clinical Infectious Diseases, 46, 155-164. http://dx.doi.org/10.1086/524891</mixed-citation></ref><ref id="scirp.56852-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">El-Sharif, A. and Ashour, H.M. (2008) Community-Acquired Methicillin-Resistant Staphylococcus aureus (CA-MRSA) Colonization and Infection in Intravenous and Inhalational Opiate Drug Abusers. Experimental Biology and Medicine, 233, 874-880. http://dx.doi.org/10.3181/0711-RM-294</mixed-citation></ref><ref id="scirp.56852-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Sakoulas, G., Gold, H.S., Venkataraman, L., DeGirolami, P.C., Eliopoulos, G.M. and Qian, Q. (2001) Methicillin-Resistant Staphylococcus aureus: Comparison of Susceptibility Testing Methods and Analysis of mecA-Positive Susceptible Strains. Journal of Clinical Microbiology, 39, 3946-3951.http://dx.doi.org/10.1128/JCM.39.11.3946-3951.2001</mixed-citation></ref><ref id="scirp.56852-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Shambat, S., Nadig, S., Prabhakara, S., Bes, M., Etienne, J. and Arakere, G. (2012) Clonal Complexes and Virulence Factors of Staphylococcus aureus from Several Cities in India. BMC Microbiology, 12, 64.http://dx.doi.org/10.1186/1471-2180-12-64</mixed-citation></ref><ref id="scirp.56852-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Hafiz, S., Hafiz, A.N., Ali, L., Chughtai, A.S., Memon, B., Ahmed, A., et al. (2002) Methicillin Resistant Staphylococcus aureus: A Multicentre Study. Journal of Pakistan Medical Association, 52, 312-315.</mixed-citation></ref><ref id="scirp.56852-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Ko, K.S., Lee, J.-Y., Suh, J.Y., Oh, W.S., Peck, K.R., Lee, N.Y. and Song, J.-H. (2005) Distribution of Major Genotypes among Methicillin-Resistant Staphylococcus aureus Clones in Asian Countries. Journal of Clinical Microbiology, 43, 421-426. http://dx.doi.org/10.1128/JCM.43.1.421-426.2005</mixed-citation></ref><ref id="scirp.56852-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Japoni, A., Jamalidoust, M., Farshad, S., Ziyaeyan, M., Alborzi, A., Japoni, S. and Rafaatpour, N. (2011) Characterization of SCCmec Types and Antibacterial Susceptibility Patterns of Methicillin-Resistant Staphylococcus aureus in Southern Iran. Japanese Journal of Infectious Diseases, 64, 28-33.</mixed-citation></ref><ref id="scirp.56852-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Shabir, S., Hardy, K.J., Abbasi, W.S., McMurray, C.L., Malik, S.A., Wattal, C. and Hawkey, P.M. (2010) Epidemiological Typing of Meticillin-Resistant Staphylococcus aureus Isolates from Pakistan and India. Journal of Medical Microbiology, 59, 330-337. http://dx.doi.org/10.1099/jmm.0.014910-0</mixed-citation></ref><ref id="scirp.56852-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Valsesia, G., Rossi, M., Bertschy, S. and Pfyffer, G.E. (2010) Emergence of SCCmec Type IV and SCCmec Type V Methicillin-Resistant Staphylococcus aureus Containing the Panton-Valentine Leukocidin Genes in a Large Academic Teaching Hospital in Central Switzerland: External Invaders or Persisting Circulators? Journal of Clinical Microbiology, 48, 720-727. http://dx.doi.org/10.1128/JCM.01890-09</mixed-citation></ref><ref id="scirp.56852-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Shukla, S.K., Stemper, M.E., Ramaswamy, S.V., Conradt, J.M., Reich, R., Graviss, E.A. and Reed, K.D. (2004) Molecular Characteristics of Nosocomial and Native American Community-Associated Methicillin-Resistant Staphylococcus aureus Clones from Rural Wisconsin. Journal of Clinical Microbiology, 42, 3752-3757.   http://dx.doi.org/10.1128/JCM.42.8.3752-3757.2004</mixed-citation></ref><ref id="scirp.56852-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Ma, X.X., Ito, T., Tiensasitorn, C., Jamklang, M., Chongtrakool, P., Boyle-Vavra, S., et al. (2002) Novel Type of Staphylococcal Cassette Chromosome mec Identified in Community-Acquired Methicillin-Resistant Staphylococcus aureus Strains. Antimicrobial Agents and Chemotherapy, 46, 1147-1152.http://dx.doi.org/10.1128/AAC.46.4.1147-1152.2002</mixed-citation></ref><ref id="scirp.56852-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Marchese, A., Gualco, L., Maioli, E. and Debbia, E. (2009) Molecular Analysis and Susceptibility Patterns of Meticillin-Resistant Staphylococcus aureus (MRSA) Strains Circulating in the Community in the Ligurian Area, a Northern Region of Italy: Emergence of USA300 and EMRSA-15 Clones. International Journal of Antimicrobial Agents, 34, 424-428. http://dx.doi.org/10.1016/j.ijantimicag.2009.06.016</mixed-citation></ref><ref id="scirp.56852-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Hsu, L.Y., Loomba-Chlebicka, N., Koh, Y.-L., Tan, T.-Y., Krishnan, P., Lin, R.T.P., et al. (2007) Evolving EMRSA-15 Epidemic in Singapore Hospitals. Journal of Medical Microbiology, 56, 376-379.http://dx.doi.org/10.1099/jmm.0.46950-0</mixed-citation></ref><ref id="scirp.56852-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Hsu, L.Y., Koh, T.-H., Singh, K., Kang, M.-L., Kurup, A. and Tan, B.-H. (2005) Dissemination of Multisusceptible Methicillin-Resistant Staphylococcus aureus in Singapore. Journal of Clinical Microbiology, 43, 2923-2925.http://dx.doi.org/10.1128/JCM.43.6.2923-2925.2005</mixed-citation></ref><ref id="scirp.56852-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Tenover, F.C., McDougal, L.K., Goering, R.V., Killgore, G., Projan, S.J., Patel, J.B. and Dunman, P.M. (2006) Characterization of a Strain of Community-Associated Methicillin-Resistant Staphylococcus aureus Widely Disseminated in the United States. Journal of Clinical Microbiology, 44, 108-118. http://dx.doi.org/10.1128/JCM.44.1.108-118.2006</mixed-citation></ref><ref id="scirp.56852-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Cosgrove, S.E., Qi, Y., Kaye, K.S., Harbarth, S., Karchmer, A.W. and Carmeli, Y. (2005) The Impact of Methicillin Resistance in Staphylococcus aureus Bacteremia on Patient Outcomes: Mortality, Length of Stay, and Hospital Charges. Infection Control and Hospital Epidemiology, 26, 166-174. http://dx.doi.org/10.1086/502522</mixed-citation></ref><ref id="scirp.56852-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Rallapalli, S., Verghese, S. and Verma, R.S. (2008) Validation of Multiplex PCR Strategy for Simultaneous Detection and Identification of Methicillin Resistant Staphylococcus aureus. Indian Journal of Medical Microbiology, 26, 361-364. http://dx.doi.org/10.4103/0255-0857.43580</mixed-citation></ref><ref id="scirp.56852-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Milheirico, C., Oliveira, D.C. and de Lencastre, H. (2007) Update to the Multiplex PCR Strategy for Assignment of mec Element Types in Staphylococcus aureus. Antimicrobial Agents and Chemotherapy, 51, 3374-3377.http://dx.doi.org/10.1128/AAC.00275-07</mixed-citation></ref></ref-list></back></article>