<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2015.65082</article-id><article-id pub-id-type="publisher-id">AJPS-55068</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Molecular Characterization of Type II Transposable Elements in Cowpea [&lt;i&gt;Vigna unguiculata&lt;/i&gt; (L.) Walp]
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>lufisayo</surname><given-names>Kolade</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Adebola</surname><given-names>Raji</given-names></name><xref ref-type="aff" rid="aff2"><sup>2</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Iyiola</surname><given-names>Fawole</given-names></name><xref ref-type="aff" rid="aff3"><sup>3</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Ivan</surname><given-names>Ingelbrecht</given-names></name><xref ref-type="aff" rid="aff4"><sup>4</sup></xref></contrib></contrib-group><aff id="aff4"><addr-line>Department of Plant Biotechnology and Bio-Informatics, VIB-Ghent University, Gent, Belgium</addr-line></aff><aff id="aff3"><addr-line>Bells University of Technology, Ota, Ogun State, Nigeria</addr-line></aff><aff id="aff2"><addr-line>Institute of Plant Sciences, Iowa State University, Ames, IA, USA</addr-line></aff><aff id="aff1"><addr-line>Crop Protection and Environmental Biology Department, University of Ibadan, Ibadan, Nigeria</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>okolade@cgiar.org(LK)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>11</day><month>03</month><year>2015</year></pub-date><volume>06</volume><issue>05</issue><fpage>767</fpage><lpage>776</lpage><history><date date-type="received"><day>3</day>	<month>February</month>	<year>2015</year></date><date date-type="rev-recd"><day>accepted</day>	<month>23</month>	<year>March</year>	</date><date date-type="accepted"><day>26</day>	<month>March</month>	<year>2015</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Previous genetic studies in cowpea [
  
  Vigna unguiculata (L.) Walp] have shown that an active bipartite transposable element (TE) is responsible for a range of mutant phenotypes of its leaf, stem and flower. Since type II TEs have not been characterized at the molecular level in cowpea, this study was initiated to survey the presence of type II TEs in the cowpea genome. Type II TEs: Enhancer/Suppressor-mutator (
  
  En/Spm) and Miniature Inverted-repeat Transposable Elements (
  
  MITEs) were isolated and characterized. The sequence identity between the 
  
  EnSpm TE clones was 46% at the nucleotide level (NL) and 30% at the amino acid level (AL) while that of 
  
  MITEs was 71% at NL and 63% at AL. These cowpea 
  
  En/Spm TEs were 80% homologous with 
  
  En/Spm elements of other crops at NL and 46% at AL. The 
  
  MITEs were 96% similar at NL and 18% homologous at AL. DNA gel blot analysis confirmed the presence of the 
  
  En/Spm TEs in cowpea. RT-PCR (reverse transcriptase polymerase chain reaction) analysis showed that the 
  
  VuEnSpm-3 and the 
  
  MITE clone, 
  
  VuPIF-1 were actively transcribed in wild type and mutant cowpea tissues. Overall, our data show that multiple, divergent lineages of 
  
  En/Spm and 
  
  MITEs are present in the cowpea genome, some of which are actively transcribed. Our findings also offer new molecular resource to further investigate the genetic determinants underlying previously described mutant cowpea phenotypes.
 
</p></abstract><kwd-group><kwd>Cowpea</kwd><kwd> En/Spm</kwd><kwd> MITE</kwd><kwd> Transposable Element</kwd><kwd> &lt;i&gt;Vigna unguiculata&lt;/i&gt;</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Transposable elements (TEs), otherwise known as transposons or mobile genetic elements are widespread in pro- and eukaryotes, including plants and animals [<xref ref-type="bibr" rid="scirp.55068-ref1">1</xref>] -[<xref ref-type="bibr" rid="scirp.55068-ref3">3</xref>] . TEs were first characterized by Barbara McClintock using classical genetics [<xref ref-type="bibr" rid="scirp.55068-ref4">4</xref>] . They were later analyzed using molecular techniques [<xref ref-type="bibr" rid="scirp.55068-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.55068-ref5">5</xref>] [<xref ref-type="bibr" rid="scirp.55068-ref6">6</xref>] .</p><p>In plants, TEs contribute significantly to the size, structure and plasticity of the genome [<xref ref-type="bibr" rid="scirp.55068-ref7">7</xref>] . For example, in maize and other plant species, up to 80% of the genome consists of transposable elements [<xref ref-type="bibr" rid="scirp.55068-ref8">8</xref>] . TEs also play an active role in genome evolution [<xref ref-type="bibr" rid="scirp.55068-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.55068-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.55068-ref10">10</xref>] by helping their hosts adapt to new conditions by conferring useful traits [<xref ref-type="bibr" rid="scirp.55068-ref11">11</xref>] . The identification and characterization of transposons in a given host can greatly assist genetic studies of that organism [<xref ref-type="bibr" rid="scirp.55068-ref12">12</xref>] . Transposable elements have been used for improvement in many crop plants such as sorghum, tomatoes, rice and maize [<xref ref-type="bibr" rid="scirp.55068-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.55068-ref4">4</xref>] ; in maize, TEs were used to develop Striga tolerant lines [<xref ref-type="bibr" rid="scirp.55068-ref13">13</xref>] , and they have been used as markers to assess genetic segregation in sorghum [<xref ref-type="bibr" rid="scirp.55068-ref14">14</xref>] , for phylogenetic studies [<xref ref-type="bibr" rid="scirp.55068-ref15">15</xref>] , gene tagging and reverse genetics in plants [<xref ref-type="bibr" rid="scirp.55068-ref16">16</xref>] -[<xref ref-type="bibr" rid="scirp.55068-ref18">18</xref>] .</p><p>In eukaryotes, TEs are classified into two classes based on their mode of transposition: class I elements (retrotransposons), which move via an RNA intermediate, produced via reverse-transcription, before being inserted into the genome in a “copy and paste” manner. By contrast, class II elements move by a “cut and paste” mechanism without RNA intermediate. Type II TEs consist of an autonomous element―a transposase- and non-au- tonomous elements with terminal inverted repeats (TIR) of 10 - 200 bp [<xref ref-type="bibr" rid="scirp.55068-ref3">3</xref>] . They are usually characterized by target site duplications. Class II elements are classified into several super families [<xref ref-type="bibr" rid="scirp.55068-ref1">1</xref>] , including the Enhancer/ Suppressor-mutator (En/Spm) [<xref ref-type="bibr" rid="scirp.55068-ref19">19</xref>] [<xref ref-type="bibr" rid="scirp.55068-ref20">20</xref>] ), the Activator/Dissociation (Ac/Ds), Mutator-Like Elements (MULEs), Mariner-Like Elements (MLEs) and Miniature Inverted-repeat Transposable Elements (MITEs) [<xref ref-type="bibr" rid="scirp.55068-ref21">21</xref>] . The En/ Spm share a common sequence-5’-CACTA-3’ at their TIR and the transposase is highly conserved among plants. They have been found and characterized in Gramineae [<xref ref-type="bibr" rid="scirp.55068-ref22">22</xref>] , Leguminosae, Solanaceae, Chenopodiaceae, Alliaceae species [<xref ref-type="bibr" rid="scirp.55068-ref2">2</xref>] and Euphorbiaceae [<xref ref-type="bibr" rid="scirp.55068-ref23">23</xref>] . MITEs are characterized by their small size, usually less than 500 bp, lack coding capacity and have short TIRs. They can be further classified as Tc1/Mariner-like or PIF/Harbin- ger-like based on their association with established super families [<xref ref-type="bibr" rid="scirp.55068-ref24">24</xref>] .</p><p>Cowpea [Vigna unguiculata (L.) Walp] is a drought-tolerant, fast-growing, and highly nutritious legume of particular importance in the semi-arid regions of tropical countries in Africa, Asia and southern America. Previous genetic studies in cowpea have shown that an active bipartite transposable element system is responsible for a range of mutations affecting leaf, stem and flower morphology and pigmentation [<xref ref-type="bibr" rid="scirp.55068-ref25">25</xref>] -[<xref ref-type="bibr" rid="scirp.55068-ref29">29</xref>] . As characteristic of most TE-induced mutations, the mutants were not stable; an example is that of the flower mutation, both mutant and wild type flowers were found on the same plants [<xref ref-type="bibr" rid="scirp.55068-ref30">30</xref>] . In this study, we present, for the first time, the isolation and molecular characterization of type II TEs, including members of the En/Spm and MITE superfamilies based on the analysis of these unstable mutants. Findings from this study will contribute to and possibly enhance the application of TEs in future breeding efforts of cowpea.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Plant Material and Nucleic Acid Extraction</title><p>Cowpea accessions and parental lines used in this study were mostly obtained from the Department of Crop Protection and Environmental Biology, University of Ibadan, Ibadan, Nigeria as listed on <xref ref-type="table" rid="table1">Table 1</xref>. Reduced Pet-</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> The list of the mutants and wild types used for this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Name</th><th align="center" valign="middle" >Description</th><th align="center" valign="middle" >Source</th></tr></thead><tr><td align="center" valign="middle" >Ife Brown</td><td align="center" valign="middle" >Non mutant cultivar</td><td align="center" valign="middle" >University of Ibadan, Ibadan, Nigeria</td></tr><tr><td align="center" valign="middle" >Ife BPC</td><td align="center" valign="middle" >Non mutant cultivar</td><td align="center" valign="middle" >IITA</td></tr><tr><td align="center" valign="middle" >Tvu 1</td><td align="center" valign="middle" >Wild sp</td><td align="center" valign="middle" >IITA</td></tr><tr><td align="center" valign="middle" >IBS2497_LM1</td><td align="center" valign="middle" >Unifoliate leaf form mutant</td><td align="center" valign="middle" >University of Ibadan, Ibadan, Nigeria</td></tr><tr><td align="center" valign="middle" >IBS2497_LM2</td><td align="center" valign="middle" >Non-petiolate and non-branching stem mutant</td><td align="center" valign="middle" >University of Ibadan, Ibadan, Nigeria</td></tr><tr><td align="center" valign="middle" >RFM</td><td align="center" valign="middle" >Rose-like flower mutant</td><td align="center" valign="middle" >University of Ibadan, Ibadan, Nigeria</td></tr><tr><td align="center" valign="middle" >RPM1</td><td align="center" valign="middle" >Reduced petal mutants</td><td align="center" valign="middle" >University of Ibadan, Ibadan, Nigeria</td></tr><tr><td align="center" valign="middle" >RPM2</td><td align="center" valign="middle" >Reduced petal mutants</td><td align="center" valign="middle" >University of Ibadan, Ibadan, Nigeria</td></tr><tr><td align="center" valign="middle" >Tvu 1509</td><td align="center" valign="middle" >Wild sp</td><td align="center" valign="middle" >IITA</td></tr><tr><td align="center" valign="middle" >Tvu 940151</td><td align="center" valign="middle" >Non mutant line</td><td align="center" valign="middle" >University of California Davis, Davis, CA, USA</td></tr></tbody></table></table-wrap><p>al Mutants (RPM1 and RPM2); unifoliate Leaf form mutant (LM1); Rose-like Flower Mutant (RFM); non-peti- olate and non-branching stem mutant (LM2); Ife brown and Ife BPC. The lines Tvu 1 and Tvu 1509 were obtained from the International Institute of Tropical Agriculture, Ibadan, Nigeria and Tvu 940151 was obtained from the University of California Davis, Davis, CA, USA. Total DNA was extracted from young leaves as described by [<xref ref-type="bibr" rid="scirp.55068-ref31">31</xref>] . RNA was extracted from leaves, stem and flowers as described by [<xref ref-type="bibr" rid="scirp.55068-ref32">32</xref>] and with the RNeasy kit following the manufacturer’s instructions (Qiagen, Valencia, CA, USA).</p></sec><sec id="s2_2"><title>2.2. Pedigree of Mutants</title><p>Mutants were obtained from crosses made by earlier workers on cowpea TEs [<xref ref-type="bibr" rid="scirp.55068-ref26">26</xref>] -[<xref ref-type="bibr" rid="scirp.55068-ref29">29</xref>] , their pedigree is shown in <xref ref-type="fig" rid="fig1">Figure 1</xref>.</p></sec><sec id="s2_3"><title>2.3. PCR Amplification of Fragments</title><p>Total DNA (250 ng) was amplified by polymerase chain reaction (PCR) in a PTC 100 Thermal Cycler (MJ Research Inc.) using the conditions and primers described by [<xref ref-type="bibr" rid="scirp.55068-ref2">2</xref>] [<xref ref-type="bibr" rid="scirp.55068-ref23">23</xref>] for the amplification of En/Spm-like transposases, and those used by [<xref ref-type="bibr" rid="scirp.55068-ref33">33</xref>] for the amplification of PIF/Harbinger-like MITEs. Others included primers for Mariner-like elements [<xref ref-type="bibr" rid="scirp.55068-ref24">24</xref>] , Ac/Ds elements [<xref ref-type="bibr" rid="scirp.55068-ref34">34</xref>] , Zaba elements [<xref ref-type="bibr" rid="scirp.55068-ref35">35</xref>] and Mutator-like elements [<xref ref-type="bibr" rid="scirp.55068-ref36">36</xref>] . Specific primers were used for the reverse transcriptase polymerase chain reaction (RT-PCR) were designed using Primer 3 program [<xref ref-type="bibr" rid="scirp.55068-ref37">37</xref>] . In all cases, PCR amplification was performed in a 50 μl reaction using 1 unit of Taq DNA polymerase (Bioline, USA).</p></sec><sec id="s2_4"><title>2.4. Cloning Procedures and DNA Sequencing</title><p>PCR amplicons obtained from RFM were gel purified using the Qiaex gel extraction kit (Qiagen, USA). PCR amplicons were ligated into a pCR8-GWTOPO (Invitrogen, CA, USA) or pDrive (Invitrogen, CA, USA) and transformed into Escherichia coli DH5α competent cells according to standard procedures [<xref ref-type="bibr" rid="scirp.55068-ref31">31</xref>] . Following blue white selection protocol, recombinant clones were grown in liquid LB medium and plasmid DNA was isolated using ultra-pure plasmid kit (Baygene, USA). Inserts were sequenced using universal primers by the Iowa state University sequencing facility (Iowa, USA). All clones were sequenced in both orientations. The DNA sequences were manually edited and any sequence ambiguities were resolved by re-sequencing. For each PCR reaction, three to five independent plasmid clones were sequenced to enable detection of any size or sequence heterogeneity present in the clones.</p></sec><sec id="s2_5"><title>2.5. Database Searches and Sequence Comparison</title><p>The sequences obtained from this study were compared with other sequences in the database by using BLASTN searches against the GenBank non-redundant database of the National Center for Biotechnology Information</p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Pedigree of mutants</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/22-2601958x6.png"/></fig><p>(NCBI) using default parameters [<xref ref-type="bibr" rid="scirp.55068-ref38">38</xref>] . Cowpea TEs sequences were aligned using the programs QAlign [<xref ref-type="bibr" rid="scirp.55068-ref39">39</xref>] , MEGA [<xref ref-type="bibr" rid="scirp.55068-ref40">40</xref>] , and CLUSTAL W. Phylogenies of the clones were obtained using the relaxed dissimilarity algorithm of the Neighbour Joining program. Trees were constructed using Tree View [<xref ref-type="bibr" rid="scirp.55068-ref41">41</xref>] .</p></sec><sec id="s2_6"><title>2.6. Southern Blot Analysis</title><p>Twenty microgram cowpea DNA was digested overnight using EcoR1 and Hind III at 37˚C and separated on a 1% TAE gel following digestion. DNA was transferred to Hybond N+ nylon membrane (Amersham, USA) using standard procedures [<xref ref-type="bibr" rid="scirp.55068-ref31">31</xref>] as follows: the membrane was prehybridized at 42˚C in DIG easy HyB buffer (Roche, USA) in a hybridization oven. Probes were prepared using the DIG labeling kit (Roche, USA), and hybridization was carried out as recommended by the supplier (Roche, USA). After hybridization, the membrane was exposed to an X-ray film and developed using standard techniques.</p></sec><sec id="s2_7"><title>2.7. RT-PCR Analysis</title><p>Primers were designed from the transposase gene of VuEnSpm-1, VuEnSpm-3 and VuPIF-1. The lists of the pri- mers used are shown in <xref ref-type="table" rid="table2">Table 2</xref>. RT-PCR was carried out using RNA extracted from mutant and wild type plant tissues, including leaves, stems and flowers. The RNA was reverse transcribed into cDNA using the Superscript III reverse transcriptase of Invitrogen (CA, USA) according to the manufacturer’s specifications. RT-PCR products were analyzed on a 2% agarose TAE gel.</p></sec></sec><sec id="s3"><title>3. Results</title><sec id="s3_1"><title>3.1. Identification of Type II Transposable Elements in Cowpea</title><p>PCR amplicons were obtained from the all the type II TEs investigated namely: En/Spm, MITEs, Ac/Ds, MLEs and mutator elements. However, subsequent BLAST searches showed that sequences with significant homology to previously characterized TE were observed only for En/Spm and MITEs. In case of Ac/Ds, MLE and the mutator elements, GenBank searches did not retrieve sequences with significant sequence homology to previously identified Ac/Ds and mutator elements. Four En/Spm clones of about 650 bp each were sequenced and analyzed. These sequences were submitted to the NCBI GenBank with the following accession numbers: FJ526201, FJ526202, FJ526203, and FJ526204. A total of five MITEs clones of approximately 500 bp each were sequenced with only two showing significant homology to previously identified MITEs, and in particular to the PIF/Harbinger subfamily. These two sequences were also submitted to GenBank with accession numbers GQ422756 and GQ422757. The En/Spm-like elements described here are the first class II TE reported in Vigna unguiculata using molecular techniques. En/Spm-like elements were present in all mutant and wild type cowpea genotypes used in this study as assessed by PCR analysis (<xref ref-type="fig" rid="fig2">Figure 2</xref>(a)). Likewise, MITE-like sequences were present in all cowpea genotypes based on PCR analysis (data not shown). The southern blot analysis confirmed the presence of EnSpm (<xref ref-type="fig" rid="fig2">Figure 2</xref>(b)). Five to six distinct bands were obtained in the cowpea lines under <xref ref-type="fig" rid="fig2">Figure 2</xref>.</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Characteristics of cowpea type II TE characterized in this study</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Type of TE</th><th align="center" valign="middle" >Targeted region and forward and reverse primers/reference</th><th align="center" valign="middle" >Cowpea TE (GenBankAcc No)</th><th align="center" valign="middle" >Top BLAST hit (E value)</th></tr></thead><tr><td align="center" valign="middle"  rowspan="3"  >En/Spm</td><td align="center" valign="middle" >Transposase F: 5’GGAAAACTAATATGATT CGACATAATATTGAYITIATGC</td><td align="center" valign="middle" >VuEnSpm1 (FJ526201)</td><td align="center" valign="middle" >Glycine max william 82 clone GMWBb173L02 (3e−120)</td></tr><tr><td align="center" valign="middle" >R: 5’CATAGACAGATGTCCATATC TTTCAAASADRTACATCCA3’[<xref ref-type="bibr" rid="scirp.55068-ref2">2</xref>]</td><td align="center" valign="middle" >VuEnSpm2 (FJ526202)</td><td align="center" valign="middle" >Glycine max william 82 clone GMWBb173L02 (2e−136)</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" >VuEnSpm3 (FJ526203)</td><td align="center" valign="middle" >Glycinemaxclone 77G7b (6e−85)</td></tr><tr><td align="center" valign="middle"  rowspan="2"  >MITEs</td><td align="center" valign="middle"  rowspan="2"  >Transposase F: 5’ATGICKMIRRTTRAACAAYTC3’ R: 5’GGIGCHHTIGATGGHACWCA3’ [<xref ref-type="bibr" rid="scirp.55068-ref33">33</xref>]</td><td align="center" valign="middle" >VuPIF1 (GQ422756)</td><td align="center" valign="middle" >Lotus japonicus clone (4e−16)</td></tr><tr><td align="center" valign="middle" >VuPIF2 (GQ422757)</td><td align="center" valign="middle" >Dendrocalamus minor clone DM-1 PIF01 transposon PIF-like (3e−11)</td></tr></tbody></table></table-wrap><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> (a) PCR amplification of the En/Spm fragment in the cowpea lines used in the study; M = Pst1 size marker, 1 = Ife brown, 2 = Ife BPC, 3 = Tvu1, 4 = LM-1, 5 = RPM-1, 6 = RPM-2, 7 = RFM, 8 = LM-2, 9 = Tvu 94051; (b) Southern blot of different cowpea genotypes using VuEnSpm clone1 as probe: 1 = Ife brown, 2 = Ife BPC, 3 = Tvu1, 4 = LM-1, 5 = RPM-1, 6 = RPM-2, 7 = RFM, 8 = LM-2, 9 = Tvu 94051, M = Pst1 lambda digest (size marker). Arrows point to some distinct bands</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/22-2601958x7.png"/></fig></sec><sec id="s3_2"><title>3.2. Comparisons within the Cowpea En/Spm and MITE Clones</title><p>For each type of TE, the different clones were aligned to assess the level of diversity present within their class. Sequence analysis of the three clones designated VuEnSpm1, VuEnSpm2 and VuEnSpm3, showed only 46% similarity at the nucleotide level and 30% at the amino acid level. Thus, the VuEn/Spm elements showed considerable sequence diversity. VuEnSpm1 and VuEnSpm2 are highly homologous with 72% nucleotide identity, while VuEnSpm3 showed only 41% and 52% nucleotide sequence identity to VuEnSpm1 and VuEnSpm2, respectively. All three clones contained an ORF of 192 amino acids encoding part of the En/Spm transposase as expected, which is an indication of possible active transposons. A similar alignment was made for the two clones of VuPIF, designated VuPIF1 and VuPIF2. These sequences were 71% similar at the nucleotide level and 63% at the amino acid level.</p></sec><sec id="s3_3"><title>3.3. Comparison between TEs from Cowpea and Other Plants</title><p>A multiple sequence alignment of cowpea TEs and other plant species followed by phylogenetic analysis showed the genetic relationship between VuEnSpm1, VuEnSpm2, VuEnSpm3 and En/Spm-like transposons (<xref ref-type="fig" rid="fig3">Figure 3</xref>) as follows: VuEnSpm1 and VuEnSpm2 were more closely related to En/Spm of Pisum sativum while VuEnSpm3 was more closely related to En/Spm of Cicer arietinum and Manihot esculenta. However, En/Spm- like elements from Beta and Allium spps were grouped with other leguminous plants such as Lens culinaris, Cajanus cajan and Lens esculentum. Overall, top BLAST hits were obtained for leguminous plants (<xref ref-type="fig" rid="fig3">Figure 3</xref>) and they showed a higher level of relatedness to one another.</p><p>Similarly, when a BLAST search was performed using the VuPIF sequences, top hits included Sorghum halenpense and Dendrocalamus minor (<xref ref-type="table" rid="table1">Table 1</xref>). In addition, more hits with sequences from mostly monocot plants such as Pennisetum glaucum, Zea mays and Saccharum hybrid cultivar clones, with a nucleotide sequence identity ranging from 90% to 99% and amino acid identity of 67% to 72% were obtained from the BLAST</p><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Dendrogram showing the relationship between VuEn/Spm clones and those from other plants from BLAST search</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/22-2601958x8.png"/></fig><p>search. When the conserved regions of the top hits were aligned with the VuPIF clones, the phylogenetic analysis showed two groups with the two VuPIF clones together and the second group consisted of 2 sub-groups of monocots and the only dicototyledonous crop (<xref ref-type="fig" rid="fig4">Figure 4</xref>). The overall mean distance between the amino acid of PIF TEs from other crops was 82%, hence a similarity of 18% from the analysis with MEGA version 4.</p></sec><sec id="s3_4"><title>3.4. Reverse Transcriptase PCR (RT-PCR) Analysis</title><p>To assess whether the TE isolated from cowpea are actively transcribed, RT-PCR reactions were conducted using cDNA from both the wild (non-mutant) and mutant types of different plant tissues. RT-PCR amplicons were obtained for VuEnSpm3 and VuPIF1 while VuEnSpm1 did not show any transcript in all the mutants and wild type tested. Tissue-specific amplifications showed that VuPIF-1 transcripts are present in both mutant and wild type tissues with expression of two copies (faint) of MITEs transcripts in the leaves of the unifoliate leaf mutant (LM1) compared to wild type leaf tissues (Ife brown) (<xref ref-type="fig" rid="fig5">Figure 5</xref>). In addition, only VuPIF-1 transcripts were present in the stem tissues of the branching habit mutant LM2 (<xref ref-type="fig" rid="fig5">Figure 5</xref>) while it was absent in the stem of wild type (Tvu 1) (not shown). A similar result was obtained in the flowers of the Rose-like Flower Mutant (RFM) where VuEnSpm-3 transcripts are more pronounced in the mutants than in the wild type (not shown). <xref ref-type="fig" rid="fig5">Figure 5</xref> shows typical amplification obtained from the different plant parts.</p></sec></sec><sec id="s4"><title>4. Discussion</title><p>This study aims to authenticate the presence of type II TEs in cowpea, Vigna unguiculata and to provide an insight into the type of TEs potentially implicated in mutations reported in previous studies through classical breeding. To our knowledge, this is the first report of molecular characterization of type II TEs in cowpea. The protein BLAST result of the TEs showed that there are partial open reading frames (ORFs) that encode products involved in transposition. The VuEnSpm encodes a transposase while the VuPIF, was found to be a non-func- tional transposase protein. These findings will constitute a useful source of information to the crop’s genome annotation [<xref ref-type="bibr" rid="scirp.55068-ref42">42</xref>] .</p><p>Also, it has shown the degree of genetic similarity of clones of these types of TEs in cowpea .Similar levels of divergence were obtained in the En/Spm of chickpea [<xref ref-type="bibr" rid="scirp.55068-ref2">2</xref>] . The multiple alignment and phylogenetic analysis with similar types of TEs in other crops shows the relationship between these organisms relative to cowpea TEs. This finding is comparable to the findings of [<xref ref-type="bibr" rid="scirp.55068-ref2">2</xref>] , who reported that En/Spm-like transposon sequences from legume species cluster together. Overall, our data suggests that lineages of En/Spm and MITEs are present in cowpea. En/Spm-like transposable element was present in low copy in all the cowpea varieties investigated. The southern blot analysis revealed about 5 - 6 bands, which may be an indication that En/Spm-like transposons are present in the cowpea genome in low copies. This is similar to the report of [<xref ref-type="bibr" rid="scirp.55068-ref2">2</xref>] of medium and low copies of this type of TEs in the plants they studied. A low copy number has been reported for many other En/Spm-like elements</p><fig id="fig4"  position="float"><label><xref ref-type="fig" rid="fig4">Figure 4</xref></label><caption><title> Dendrogram showing the relationship between VuPIF clones and those from other plants from BLAST search</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/22-2601958x9.png"/></fig><fig id="fig5"  position="float"><label><xref ref-type="fig" rid="fig5">Figure 5</xref></label><caption><title> RT-PCR analysis for the VuEn/Spm and VuPIF clones on leaf, flower and stem samples (M = Lambda Pst1 digest, A = VuEn/Spm-1, B = VuEn/Spm-3 and C = VuPIF-1) of some mutants and wild types, LM1 = unifoliate leaf mutant, RPM1 = reduced flower mutant 1, RFM = “Rosa” flower mutant, RPM2 = reduced flower mutant 2, and LM2 = non-peti- olate leaf mutant and non-branching stem mutant (LM1 analysis shown was on the unifoliate leaves); RFM, RPM1 and RPM2 were on the flowers, LM2 was on the stem while Ife brown and Ife BPC (parental lines/wild types) were on the leaf tissues</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/22-2601958x10.png"/></fig><p>in plants, including other legumes [<xref ref-type="bibr" rid="scirp.55068-ref2">2</xref>] , Poaceae [<xref ref-type="bibr" rid="scirp.55068-ref22">22</xref>] as well as others plant species [<xref ref-type="bibr" rid="scirp.55068-ref43">43</xref>] -[<xref ref-type="bibr" rid="scirp.55068-ref46">46</xref>] .</p><p>A substantial proportion of plant genomes are made up of transposable elements and they contribute both to their structure and evolution [<xref ref-type="bibr" rid="scirp.55068-ref24">24</xref>] . Therefore, the amplification obtained for the En/Spm in all the lines analyzed is an indication that the high mutability observed in cowpea mutants are likely due to the activities of transposable elements; with the En/Spm and MITEs also possibly responsible for these mutations. Therefore, the results obtained in this study corroborates the presence of these types of class II TEs in cowpea and therefore supports the fact that the mutations observed through classical breeding might have been as a result of the activities of transposable elements. [<xref ref-type="bibr" rid="scirp.55068-ref25">25</xref>] -[<xref ref-type="bibr" rid="scirp.55068-ref28">28</xref>] described the previous work done in obtaining these mutants, which revealed that there was somatic instability and possible insertion and activity of TEs in the tissues in which the mutation took place.</p><p>The RT-PCR analysis provides additional evidence that these TEs are transcribed differently in the different plant parts/tissues investigated both in the mutants and in the parental lines/wild type. Firstly, the fact that RT- PCR amplicons were obtained for VuEnSpm3 and VuPIF1 while VuEnSpm1 did not show any transcript in all the mutants and wild type tested, suggests that VuEnSpm-3 is actively transcribed in the tissues analyzed as opposed to VuEnSpm-1. This corroborates the activity of TEs as a result of somatic instability by earlier workers.</p></sec><sec id="s5"><title>5. Conclusion</title><p>In conclusion, this study presents evidence to confirm the presence of EnSpm TEs and MITEs in the cowpea genome. Our results will contribute significantly to the improvement of this crop by providing important genomic resource that was previously unavailable and open up avenues for cowpea TEs to be used in molecular marker development [<xref ref-type="bibr" rid="scirp.55068-ref14">14</xref>] or gene tagging [<xref ref-type="bibr" rid="scirp.55068-ref18">18</xref>] . Availability of complete cowpea genome sequence will further expand the discovery and application of TEs in cowpea genomic studies.</p></sec><sec id="s6"><title>Acknowledgements</title><p>The authors are grateful to the International Institute of Tropical Agriculture, Ibadan, Nigeria for supporting and providing the facilities and materials for this work. We also acknowledge the University of Ibadan, Ibadan, Nigeria and the University of Davies, Davies California, USA for providing some of the plant materials used for this work.</p></sec><sec id="s7"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.55068-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Kunze, R., Saedler, H. and L&amp;oumlnnig, W.E. (1997) Plant Transposable Elements. Advances in Botanical Research, 27, 332-409. http://dx.doi.org/10.1016/S0065-2296(08)60284-0</mixed-citation></ref><ref id="scirp.55068-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Stagginus, C., Huettel, B., Desel, C., Schmidt, T. and Kahl, G. (2001) A PCR-Based Assay to Detect En/Spm-Like Transposon Sequences in Plants. Chromosome Resources, 9, 591-605. http://dx.doi.org/10.1023/A:1012455520353</mixed-citation></ref><ref id="scirp.55068-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Wessler, S. (2006) Transposable Elements and the Evolution of the Eukaryotic Genome. Proceeding of National Academy of Science, 103, 17600-17601. http://dx.doi.org/10.1073/pnas.0607612103</mixed-citation></ref><ref id="scirp.55068-ref4"><label>4</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>McClintock</surname><given-names> B. </given-names></name>,<etal>et al</etal>. (<year>1948</year>)<article-title>Mutable Loci in Maize</article-title><source> Carnegie Institution of Washington Year Book</source><volume> 47</volume>,<fpage> 155</fpage>-<lpage>169</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.55068-ref5"><label>5</label><mixed-citation publication-type="book" xlink:type="simple">Fedoroff, N. (1983) Controlling Elements in Maize. In: Shapiro, J., Ed., Mobile Genetic Elements, Academic Press, New York, 63 p. http://dx.doi.org/10.1016/B978-0-12-638680-6.50005-3</mixed-citation></ref><ref id="scirp.55068-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Griffith, A.J.F., Miller, J.H., Suzuki, D.T., Lewontin, R.C. and Gelbart, W.M. (1999) Introduction to Genetic Analysis. 7th Edition, WH Freeman and Co., New York.</mixed-citation></ref><ref id="scirp.55068-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, X., Jiang, N., Feschotte, C. and Wessler, S.R. (2004) PIF- and Pong-Like Elements: Distribution, Evolution and Relationship with Tourist Like Miniature Inverted Repeat Transposable Elements. Genetics, 166, 971-986. 
http://dx.doi.org/10.1534/genetics.166.2.971</mixed-citation></ref><ref id="scirp.55068-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Bennetzen, J.L. (2000) Transposable Element Contributions to Plant Gene and Genome Evolution. Plant Molecular Biology, 42, 251-269. http://dx.doi.org/10.1023/A:1006344508454</mixed-citation></ref><ref id="scirp.55068-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Shapiro, J.A. (1999) Transposable Elements as the Key to a 21st Century View of Evolution. Genetica, 107, 171-179. 
http://dx.doi.org/10.1023/A:1003977827511</mixed-citation></ref><ref id="scirp.55068-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Fedoroff, N. (2000) Transposons and Genome Evolution in Plants. Proceedings of National Academy of Science USA, 97, 7002-7007. http://dx.doi.org/10.1073/pnas.97.13.7002</mixed-citation></ref><ref id="scirp.55068-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Gray, Y.H.M. (2000) It Takes Two Transposons to Tango: Transposable Element-Mediated Chromosomal Rearrangements. Trends in Genetics, 16, 461-468. http://dx.doi.org/10.1016/S0168-9525(00)02104-1</mixed-citation></ref><ref id="scirp.55068-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Holmes, I. (2002) Transcendent Elements: Whole Genome Transposon Screens and Open Evolutionary Questions. Genome Research, 12, 1152-1155. http://dx.doi.org/10.1101/gr.453102</mixed-citation></ref><ref id="scirp.55068-ref13"><label>13</label><mixed-citation publication-type="book" xlink:type="simple">Grimanelli, D. (2000) Identification of Genes for Tolerance to Striga in Maize Using Transposable Elements. In: Haussmann, B.I.G., Hess, D.E., Koyama, M.L., Grivet, L., Rattunde, H.F.W. and Geiger, H.H., Eds., Breeding for Striga Resistance in Cereals, Proceedings of a Workshop, IITA, Ibadan, 18-20 August 1999, 187.</mixed-citation></ref><ref id="scirp.55068-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Lee, J.J., Kwon, S.J., Park, K.C. and Kim, N.S. (2005) Isaac-CACTA Transposons: New Genetic Markers in Maize and Sorghum. Genome, 48, 455-460. http://dx.doi.org/10.1139/g05-013</mixed-citation></ref><ref id="scirp.55068-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Kumar, A., Pearce, S.R., McLean, K., Harrison, G., Heslop-Harrison, J.S., Waugh, R. and Flavell, A.J. (1997) The Ty1-copia Group of Retrotransposons in Plants: Genomic Organisation, Evolution, and Use as Molecular Markers. Genetica, 100, 205-217. http://dx.doi.org/10.1023/A:1018393931948</mixed-citation></ref><ref id="scirp.55068-ref16"><label>16</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Nevers</surname><given-names> P.</given-names></name>,<name name-style="western"><surname> Sheperd</surname><given-names> N.A. and Saedler </given-names></name>,<etal>et al</etal>. (<year>1986</year>)<article-title>Plant Transposable Elements</article-title><source> Advances in Botanical Research</source><volume> 12</volume>,<fpage> 102</fpage>-<lpage>203</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.55068-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Osborne, B. and Baker, B. (1995) Movers and Shakers: Maize Transposons as Tools for Analyzing Other Plant Genomes. Current Opinion in Cell Biology, 7, 406-413.</mixed-citation></ref><ref id="scirp.55068-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Sundaresan, V., Springer, P., Volpe, T., Haward, S., Jones, J.D., Dean, C., Ma, H. and Martienssen, R. (1995) Patterns of Gene Action in Plant Development Revealed by Enhancer Trap and Gene Trap Transposable Elements. Genes &amp; Development, 9, 1797-1810. http://dx.doi.org/10.1101/gad.9.14.1797</mixed-citation></ref><ref id="scirp.55068-ref19"><label>19</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Peterson</surname><given-names> P.A. </given-names></name>,<etal>et al</etal>. (<year>1953</year>)<article-title>A Mutable Pale-Green Locus in Maize</article-title><source> Genetics</source><volume> 38</volume>,<fpage> 682</fpage>-<lpage>683</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.55068-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">McClintock, B. (1954) Mutations in Maize and Chromosomal Aberrations in Neurospora. In: Carnegie Institution of Washington, Yearbook No. 53, 254-260.</mixed-citation></ref><ref id="scirp.55068-ref21"><label>21</label><mixed-citation publication-type="book" xlink:type="simple">Wessler, S.R., Nagel, A. and Casa, A. (2001) Miniature Inverted Repeat Transposable Elements Help Create Genomic Diversity in Maize and Rice. In: Khush, G.S., Brar, D.S. and Hardy, B., Eds., Rice Genetics IV, Science, Manila, 107-116.</mixed-citation></ref><ref id="scirp.55068-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Altinkut, A., Raskina, O., Nevo, E. and Belyayev, A. (2006) En/Spm-Like Transposons in Poaceae Species: Transposase Sequence Variability and Chromosomal Distribution. Cellular and Molecular Biology Letters, 11, 214-229.  
http://dx.doi.org/10.2478/s11658-006-0017-3</mixed-citation></ref><ref id="scirp.55068-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Gbadegesin, M.A., Reilly, K. and Beeching, J.R. (2005) Mutator-Like Transposable Element of Cassava (Manihot esculenta Crantz) Is Highly Methylated. FEBS Journal, 272, 476.</mixed-citation></ref><ref id="scirp.55068-ref24"><label>24</label><mixed-citation publication-type="book" xlink:type="simple">Feschotte, C., Zhang, X. and Wessler, S.R. (2002) Miniature Inverted-Repeat Transposable Elements (MITEs) and Their Relationship with Established DNA Transposons. In: Craig, N.L., Craigie, R., Gellert, M. and Lambowitz, A.M., Eds., Mobile DNA II, American Society for Microbiology Press, Washington DC, 1147-1158.</mixed-citation></ref><ref id="scirp.55068-ref25"><label>25</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Fawole</surname><given-names> I. </given-names></name>,<etal>et al</etal>. (<year>1988</year>)<article-title>A Non-Petiolate Leaf Mutant in Cowpea, Vigna unguiculata (L.) Walp</article-title><source> Journal of Heredity</source><volume> 79</volume>,<fpage> 484</fpage>-<lpage>487</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.55068-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Fawole, I. (1998) Two Unstable Dominant Genes in Cowpea, Vigna unguiculata (L.) Walp. Eighteenth International Congress of Genetics, Beijing, 10-15 August 1998, 29.</mixed-citation></ref><ref id="scirp.55068-ref27"><label>27</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Fawole</surname><given-names> I. </given-names></name>,<etal>et al</etal>. (<year>1997</year>)<article-title>Inheritance of Crinkled Leaf in Cowpea, Vigna unguiculata (L) Walp</article-title><source> Nigerian Journal of Science</source><volume> 31</volume>,<fpage> 35</fpage>-<lpage>40</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.55068-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Fawole, I. (2001) Genetic Analysis of Mutations at Loci Controlling Leaf Form in Cowpea (Vigna unguiculata L. Walp). Journal of Heredity, 92, 43-50. http://dx.doi.org/10.1093/jhered/92.1.43</mixed-citation></ref><ref id="scirp.55068-ref29"><label>29</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Fawole</surname><given-names> I. </given-names></name>,<etal>et al</etal>. (<year>2010</year>)<article-title>Origin, Morphology &amp; Inheritance of Dominant Mutations Affecting Flower Form and Colour in Cowpea</article-title><source> Nigerian Journal of Science</source><volume> 44</volume>,<fpage> 77</fpage>-<lpage>87</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.55068-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Oluwatosin, O.B. (1997) Inheritance and Instability of Genes Controlling Anthocyanin Pigmentation, Seed Coat Colour and Leaf Form in Cowpea, Vigna unguiculata (L.) Walp. Dissertation, University of Ibadan, Ibadan.</mixed-citation></ref><ref id="scirp.55068-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Dellarporta, S.L., Wood, J. and Hicks, J.B. (1983) A Plant DNA Minipreparation: Version II. Plant Molecular Biology Reporter, 1, 19-21. http://dx.doi.org/10.1007/BF02712670</mixed-citation></ref><ref id="scirp.55068-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Sambrook, J., Fritsch, E. and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual. 2nd Edition, Cold Spring Harbor Laboratory Press, Cold Spring Harbor.</mixed-citation></ref><ref id="scirp.55068-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Zhang, X. and Wessler, S.R. (2004) Genome-Wide Comparative Analysis of the Transposable Elements in the Related Species Arabidopsis thaliana and Brassica oleracea. Proceedings of the National Academy of Sciences of the United States of America, 101, 5589-5594. http://dx.doi.org/10.1073/pnas.0401243101</mixed-citation></ref><ref id="scirp.55068-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Gorbunova, V. and Levy, A.A. (2000) Analysis of Extrachromosomal Ac/Ds Transposable Elements. Genetics, 155, 349-359.</mixed-citation></ref><ref id="scirp.55068-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Macas, J., Neuman, P. and Pozarkova, D. (2003) Zaba: A Novel Miniature Transposable Element Present in Genomes of Legume Plants. Molecular Genetics and Genomics, 269, 624-631. http://dx.doi.org/10.1007/s00438-003-0869-4</mixed-citation></ref><ref id="scirp.55068-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Singer, T., Yordan, C. and Martienssien, R.A. (2001) Robertson’s Mutator Transposons in A. thaliana Are Regulated by the Chromatin-Remodeling Gene Decrease in DNA Methylation (DDM1). Genes &amp; Development, 15, 591-602.  
http://dx.doi.org/10.1101/gad.193701</mixed-citation></ref><ref id="scirp.55068-ref37"><label>37</label><mixed-citation publication-type="book" xlink:type="simple">Rozen, S. and Skaletsky, H.J. (2000) Primer 3 on the WWW for General Users and Biologist Programmers. In: Krawetz, S. and Misener, S., Eds., Bioinformatics Methods and Protocols: Methods in Molecular Biology, Humana Press, Totowa, 365-386.</mixed-citation></ref><ref id="scirp.55068-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Altschul, S.F., Gish, W., Miller, W., Mayers, E.W. and Lipman, D.J. (1990) Basic Local Alignment Search Tool. Journal of Molecular Biology, 215, 403-410. http://dx.doi.org/10.1016/S0022-2836(05)80360-2</mixed-citation></ref><ref id="scirp.55068-ref39"><label>39</label><mixed-citation publication-type="other" xlink:type="simple">Higgins, D.G. and Sharp, P.M. (1988) CLUSTAL: A Package for Performing Multiple Sequence Alignment on a Microcomputer. Gene, 73, 237-244. http://dx.doi.org/10.1016/0378-1119(88)90330-7</mixed-citation></ref><ref id="scirp.55068-ref40"><label>40</label><mixed-citation publication-type="other" xlink:type="simple">Tamura, K., Dudley, J., Nei, M. and Kumar, S. (2007) MEGA4: Molecular Evolutionary Genetics Analysis (MEGA) Software Version 4.0. Molecular Biology and Evolution, 24, 1596-1599. http://dx.doi.org/10.1093/molbev/msm092</mixed-citation></ref><ref id="scirp.55068-ref41"><label>41</label><mixed-citation publication-type="other" xlink:type="simple">Sammeth, M., Griebel, T., Tille, F. and Stoye, J. (2006) Panta rhei (QAlign2): An Open Graphical Environment for Sequence Analysis. Bioinformatics, 22, 889-890. http://dx.doi.org/10.1093/bioinformatics/btl007</mixed-citation></ref><ref id="scirp.55068-ref42"><label>42</label><mixed-citation publication-type="other" xlink:type="simple">Jiang, N., Feschotte, C., Zhang, X. and Wessler, S.R. (2004) Using Rice to Understand the Origin and Amplification of Miniature Inverted Repeat Transposable Elements (MITEs). Current Opinion in Plant Biology, 7, 115-119.  
http://dx.doi.org/10.1016/j.pbi.2004.01.004</mixed-citation></ref><ref id="scirp.55068-ref43"><label>43</label><mixed-citation publication-type="other" xlink:type="simple">Rhodes, P. and Vodkin, L. (1988) Organization of the Tgm Family of Transposable Element in Soybean. Genetics, 120, 597-604.</mixed-citation></ref><ref id="scirp.55068-ref44"><label>44</label><mixed-citation publication-type="other" xlink:type="simple">Snowden, K. and Napoli, C. (1998) Ps1: A Novel Spm-Like Transposable Element from Petunia hybrida. The Plant Journal, 14, 43-54. http://dx.doi.org/10.1046/j.1365-313X.1998.00098.x</mixed-citation></ref><ref id="scirp.55068-ref45"><label>45</label><mixed-citation publication-type="other" xlink:type="simple">He, Z.H., Dong, J.X., Li, D.B. and Ronald, P.C. (2000) The Rice Rim2 Transcript Accumulates in Response to Magnaporthe grisea and Its Predicted Protein Product Shares Similarity with TNP2-Like Proteins Encoded by CACTA Transposons. Molecular and General Genetics MGG, 264, 2-10. http://dx.doi.org/10.1007/s004380000278</mixed-citation></ref><ref id="scirp.55068-ref46"><label>46</label><mixed-citation publication-type="other" xlink:type="simple">Gbadegesin, M.A., Wills, M.A. and Beeching, J.R. (2008) Diversity of LTR-Retrotransposons and Enhancer/Suppressor Mutator-Like Transposons in Cassava (Manihot esculenta Crantz). Molecular Genetics and Genomics, 280, 305-317.  
http://dx.doi.org/10.1007/s00438-008-0366-x</mixed-citation></ref></ref-list></back></article>