<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2015.61015</article-id><article-id pub-id-type="publisher-id">AJPS-53242</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Reference Genes for RT-qPCR Analysis of Environmentally and Developmentally Regulated Gene Expression in Alfalfa
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>ves</surname><given-names>Castonguay</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Josée</surname><given-names>Michaud</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Marie-Pier</surname><given-names>Dubé</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>Soils and Crops Research and Development Center, Agriculture and Agri-Food Canada, Québec, Canada</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>yves.castonguay@agr.gc.ca(VC)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>06</day><month>01</month><year>2015</year></pub-date><volume>06</volume><issue>01</issue><fpage>132</fpage><lpage>143</lpage><history><date date-type="received"><day>21</day>	<month>December</month>	<year>2014</year></date><date date-type="rev-recd"><day>accepted</day>	<month>4</month>	<year>January</year>	</date><date date-type="accepted"><day>15</day>	<month>January</month>	<year>2015</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Reverse transcription quantitative PCR (RT-qPCR) is a highly sensitive technique that has become the standard for the analysis of differences in gene expression in response to experimental treatments or among genetic sources. The accuracy of the RT-qPCR results can be significantly affected by uncontrolled sources of variation that can be accounted for normalization with so-called reference genes stably expressed under various conditions. In this study we assessed the stability of 21 reference gene candidates in crowns of two alfalfa cultivars (Apica and Evolution) exposed to various environmental conditions (cold, water stress and photoperiod) and from above ground biomass of the cultivar Orca sampled at three developmental stages (vegetative, full bloom and mature pods). Candidates were selected based on their previous identification in other plant species or their stable expression in a differential hybridization of alfalfa ESTs with cDNA from non-acclimated and cold-acclimated alfalfa. Genes encoding ubiquitin protein ligase 2a (UBL-2a), actin depolymerizing factor (ADF) and retention in endoplasmic reticulum 1 protein (Rer1) were the most stable across experimental conditions. Conversely β-actin (Act), α-tubulin (Tub) and glyce-raldehyde 3-phosphate dehydrogenase (GAPDH) frequently used as “housekeeping genes” in gene expression studies showed poor stability. No more than two reference genes were required to normalize the gene expression data under each condition. Normalization of the expression of genes of interest with unstable reference genes led to observations that were conflicting with those made with validated reference genes and that were in some cases inconsistent with the current knowledge of the trait. The reference genes identified in this study are strong candidates for normalization of gene expression in cultivated alfalfa.
 
</p></abstract><kwd-group><kwd>Abiotic Stress</kwd><kwd> Alfalfa</kwd><kwd> RT-qPCR</kwd><kwd> Cold Acclimation</kwd><kwd> Development</kwd><kwd> Reference Genes</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Cultivated alfalfa (Medicago sativa L.) is a major forage legume grown extensively worldwide [<xref ref-type="bibr" rid="scirp.53242-ref1">1</xref>] . This perennial species has a tetraploid (2n = 4x = 32) genome which displays tetrasomic inheritance and its populations are extremely polymorphic due to a high degree of outcrossing [<xref ref-type="bibr" rid="scirp.53242-ref2">2</xref>] . Superior tolerance to environmental stress and decline in stem digestibility during plant development are major issues for alfalfa breeding programs [<xref ref-type="bibr" rid="scirp.53242-ref3">3</xref>] . Insufficient tolerance to subfreezing temperatures reduces long term persistence of alfalfa in northern countries and is a source of major costs associated with stands reestablishment and the need to buy forage outside the farm [<xref ref-type="bibr" rid="scirp.53242-ref4">4</xref>] . Lignin deposition in maturing stems significantly interferes with the release of simple sugars from the cellulose and hemi-cellulose fiber fraction and causes a significant decline in feed value [<xref ref-type="bibr" rid="scirp.53242-ref5">5</xref>] . The development of new breeding approaches allowing significant gains will require a deeper knowledge of these complex traits at the genetic and molecular levels. Analysis of candidate gene expression within heterogeneous populations will help identify genes and gene networks that affect these traits. It will also facilitate the search for trait-allele associations in projects pursuing high throughput assessment of DNA polymorphisms.</p><p>Reverse transcription-quantitative polymerase chain reaction (RT-qPCR) is a highly sensitive technique which can detect small differences in transcript abundance between samples even for weakly expressed target genes. Normalization of cDNA concentrations with stably expressed genes is needed to minimize the effects of uncontrolled factors such as variation in RNA concentrations or the efficiency of reverse transcription that can affect the accurate determination of transcript variations across biological samples [<xref ref-type="bibr" rid="scirp.53242-ref6">6</xref>] . The so-called “reference genes” are often selected for their constitutive expression or their involvement in maintenance of cell structure or in primary metabolism. Genes encoding 18S ribosomal RNA (18S rRNA), actin (Act), tubulin (Tub), glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and eukaryotic elongation factor 1-alpha (eEF1-α) are often used as putative “housekeeping genes” even though they may not always meet the requirements for internal controls [<xref ref-type="bibr" rid="scirp.53242-ref7">7</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref8">8</xref>] . It has been well documented that the selection of reference genes can markedly affect the accuracy of RT-qPCR analysis and that no single gene or genes combination should be arbitrarily used without validation under specific experimental conditions and varied sources of genetic material [<xref ref-type="bibr" rid="scirp.53242-ref9">9</xref>] . For that reason, reference gene candidates have been recently tested in a wide array of plant species and experimental conditions [<xref ref-type="bibr" rid="scirp.53242-ref10">10</xref>] - [<xref ref-type="bibr" rid="scirp.53242-ref21">21</xref>] . These studies clearly demonstrate the need to validate reference gene candidates under the experimental conditions specific to each study in order to avoid erroneous conclusions. Several statistical approaches have been developed to select reference genes [<xref ref-type="bibr" rid="scirp.53242-ref7">7</xref>] . The geNorm M value based on the analysis of pairwise variations between reference genes is a widely used indicator of the expression stability of candidates [<xref ref-type="bibr" rid="scirp.53242-ref22">22</xref>] .</p><p>In this study we evaluated the stability of the expression of several candidate reference genes in different genetic backgrounds of cultivated alfalfa exposed to variable environmental conditions or sampled at different developmental stages. Our objective was to identify genes that are stable under a wide range of conditions and would constitute good candidates for the selection of reference genes in RT-qPCR analysis of the expression of genes potentially associated to key agronomic traits in alfalfa. We also assessed the impact of unstable reference genes for normalization of gene expression in the assessment of their relationship with physiological traits.</p></sec><sec id="s2"><title>2. Material and Methods</title><sec id="s2_1"><title>2.1. Plant Materials</title><p>Plants of alfalfa (Medicago sativa spp. sativa) were sampled during their acclimation to various environmental conditions (low temperature, water deficit, photoperiod) and at different stages of their development. These plants were obtained from a series of independent experiments described below:</p><sec id="s2_1_1"><title>2.1.1. Cold Acclimation Indoors</title><p>Plants of the cultivars Apica (ATF0) and Evolution (ETF0) and populations (ATF5 and ETF5) obtained after five cycles of recurrent selection for superior tolerance to freezing (TF) within these two cultivars [<xref ref-type="bibr" rid="scirp.53242-ref23">23</xref>] were grown and cold-acclimated under environmentally-controlled conditions. Plants were grown from seeds in 15-cm pots (10 plants per pot) filled with a mixture (10:3; v:v) of top soil/peat moss (Pro-mix BX, Premier Peat Moss, Rivi&#232;re-du-Loup, QC, Canada) supplemented with a controlled release fertilizer [N: 17% (w:w); P: 7.31% (w:w); K: 14.1% (w:w); 250 g/35 L; Muticote 4, Haifa Chemicals Ltd, Haifa Bay, Israel]. Plants were grown six weeks in an environmentally-controlled chamber set to: photoperiod, 16 h; day-time temperature, 22˚C; night- time temperature 17˚C. Artificial lighting was provided by a mixture of high pressure sodium and metal halide 400 W lamps (PL light systems, Beamsville, ON, Canada) with a photosynthetic photon flux density (PPFD) of 600 to 800 &#181;mol photons m<sup>−2</sup>∙s<sup>−1</sup>. Plants were kept well watered and fertilized twice a week with a 1 g∙L<sup>−1</sup> of a commercial fertilizer (20-20-20 plus micronutrients, Plant-Prod, Brampton, ON, Canada). Plants were subsequently cold acclimated at constant 2˚C, 8-h photoperiod with 150 &#181;mol photons m<sup>−2</sup>∙s<sup>−1</sup> PPFD. After two weeks at 2˚C, plants were transferred to a freezer set to −2˚C in the dark for a second stage of hardening to promote superior freezing tolerance.</p><p>Two separate cold acclimation assays were performed: “cold acclimation 2011” and “cold acclimation 2013”. In 2011, non-acclimated (NA) plants of populations ATF0 and ATF5 were sampled immediately before their transfer to low temperature and at the end of the cold acclimation period at −2˚C (A). In 2013, the populations ETF0 and ETF5 were added and a time course analysis of gene expression was performed by taking samples 0 h, 8 h, 1 d, 3 d, 7 d and 15 d after transfer to 2˚C and after two additional weeks of hardening below freezing at −2˚C (HF). In both experiments, crown tissues of four randomly selected pots (10 plants per pot) of each population were harvested at each sampling point.</p></sec><sec id="s2_1_2"><title>2.1.2. Cold Acclimation Outdoor</title><p>Plants of the initial cultivars ATF0 and ETF0 and populations ATF5 and ETF4 obtained after respectively five and four cycles of recurrent selection were grown under environmentally-controlled conditions and acclimated to natural hardening conditions in an unheated greenhouse as described in Castonguay et al. [<xref ref-type="bibr" rid="scirp.53242-ref24">24</xref>] . Five pots (15 plants per pot) of each population were sampled before transfer the unheated greenhouse on October 15, 2003 and during the subsequent winter on January 21, 2004 after fall hardening.</p></sec><sec id="s2_1_3"><title>2.1.3. Water Stress and Photoperiod</title><p>Two additional treatments were included in the “cold acclimation 2013” experiment to test candidate reference genes under water deficit and reduced photoperiod. For that purpose, unstressed plants of ATF0 and ATF5 grown under the conditions described previously (22˚C/17˚C, 16 h photoperiod) were compared to plants 1― Exposed to a progressive water deficit by withholding water during a 10 d period until the appearance of wilting symptoms; 2―Maintained under short (8 h) photoperiod at warm temperature (22˚C/17˚C) for three days. Five replicates (10 plants∙pot<sup>−1</sup>) were available for each treatment.</p></sec><sec id="s2_1_4"><title>2.1.4. Plant Development</title><p>Plants of the biomass-type cultivar Orca were grown in a greenhouse under the conditions described in Duceppe et al. [<xref ref-type="bibr" rid="scirp.53242-ref25">25</xref>] . Stems with leaves were harvested from 20 genotypes with high and 20 genotypes with low cell wall degradability at three developmental stages (vegetative, full bloom and mature pods). At each harvest, a single stem was collected from each genotype, chopped into 3 cm segments and flash frozen in liquid N<sub>2</sub>. Stems of each group of genotypes were pooled into bulk samples for RNA extraction.</p></sec></sec><sec id="s2_2"><title>2.2. Primer Design</title><p>Reference gene candidates tested in this study are listed in <xref ref-type="table" rid="table1">Table 1</xref>. Except for Actin primers that were developed from a partial Medicago sativa coding sequence available in GenBank (EU664318), other target sequences for candidate genes were developed from an alfalfa EST library (Serge Laberge, unpublished) prepared from cDNAs from cold-acclimated crowns (pooled RNA extracts from 50 genotypes) of the population ATF2 obtained after two cycles of recurrent selection for superior tolerance to freezing within the cultivar Apica [<xref ref-type="bibr" rid="scirp.53242-ref23">23</xref>] . EST sequences with functional homologies with genes that show expression stability in other plants [<xref ref-type="bibr" rid="scirp.53242-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref14">14</xref>] or that maintained a stable expression in a macro array hybridization with cDNA from non-acclimated and cold- acclimated plants of the alfalfa population ATF2 (Serge Laberge, unpublished) were used to design primers with the Oligo Explorer software, version 1.1.0 (T. Kuulasma, University of Kuopio, Kuopio, Finland; <xref ref-type="table" rid="table1">Table 1</xref>). Selected EST sequences have been deposited in the GenBank data library under the names and associated accession numbers listed in <xref ref-type="table" rid="table1">Table 1</xref>.</p></sec><sec id="s2_3"><title>2.3. RNA Extraction and cDNA Synthesis</title><p>RNA samples were extracted from crowns with buds (5-cm transition zone between shoots and roots) or stems</p><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Candidates as reference gene (Ref) and genes of interest (GOI) with primer sequences, PCR fragments characteri- stics and amplification efficiency. Selection criteria (literature vs macro array hybridization) and GenBank accession number of Medicago sativa EST used to design primers are also provided</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Gene ID</th><th align="center" valign="middle" >Type</th><th align="center" valign="middle" >Sequence homology</th><th align="center" valign="middle" >Genbank acc.no.</th><th align="center" valign="middle" >Primer Sequences (5'-3')</th><th align="center" valign="middle" >Size (bp)</th><th align="center" valign="middle" >Tm (˚C)</th><th align="center" valign="middle" >PCR efficiency (%)</th></tr></thead><tr><td align="center" valign="middle" >Act</td><td align="center" valign="middle" >Ref†</td><td align="center" valign="middle" >β-Actin</td><td align="center" valign="middle" >EU664318</td><td align="center" valign="middle" >TAGGTGCCGAGCGTTTCC CCGGGGAACATAGTCGTACC</td><td align="center" valign="middle" >175</td><td align="center" valign="middle" >79.2</td><td align="center" valign="middle" >95.7</td></tr><tr><td align="center" valign="middle" >ADF</td><td align="center" valign="middle" >Ref†</td><td align="center" valign="middle" >Actin depolymerizing factor</td><td align="center" valign="middle" >JZ818469</td><td align="center" valign="middle" >GCATCTGGTATGGCAGTCC GCACTCATCAGCAGGAAGG</td><td align="center" valign="middle" >183</td><td align="center" valign="middle" >81.4</td><td align="center" valign="middle" >91.0</td></tr><tr><td align="center" valign="middle" >APT</td><td align="center" valign="middle" >Ref†</td><td align="center" valign="middle" >Adenine phosphoribosyltransferase</td><td align="center" valign="middle" >JZ818470</td><td align="center" valign="middle" >GGAGCTGTTGAAGCTGGTG CACGACCCTTCAGTTCTGG</td><td align="center" valign="middle" >154</td><td align="center" valign="middle" >81.8</td><td align="center" valign="middle" >96.7</td></tr><tr><td align="center" valign="middle" >ATPase</td><td align="center" valign="middle" >Ref‡</td><td align="center" valign="middle" >Vacuolar H+- ATPase A subunit</td><td align="center" valign="middle" >JZ818471</td><td align="center" valign="middle" >CTACGAACGTGCTGGGAAAG GAGGGTTGCAGATGTCACG</td><td align="center" valign="middle" >124</td><td align="center" valign="middle" >80.2</td><td align="center" valign="middle" >91.4</td></tr><tr><td align="center" valign="middle" >CAC</td><td align="center" valign="middle" >Ref†</td><td align="center" valign="middle" >Clathrin adaptor complex</td><td align="center" valign="middle" >JZ818472</td><td align="center" valign="middle" >AGCCGGGCCTCTTAGTATGAC CCCATCGATACGGATTATGAGC</td><td align="center" valign="middle" >113</td><td align="center" valign="middle" >76.5</td><td align="center" valign="middle" >97.0</td></tr><tr><td align="center" valign="middle" >COP</td><td align="center" valign="middle" >Ref‡</td><td align="center" valign="middle" >Coatamer delta subunit</td><td align="center" valign="middle" >JZ818473</td><td align="center" valign="middle" >GGTGAGAATCAAGCCGTCTC GTTGGACCAGTGGGGAAAG</td><td align="center" valign="middle" >116</td><td align="center" valign="middle" >77.8</td><td align="center" valign="middle" >95.3</td></tr><tr><td align="center" valign="middle" >COMT</td><td align="center" valign="middle" >Ref‡</td><td align="center" valign="middle" >Caffeic acid 3-0-methyltransferase</td><td align="center" valign="middle" >JZ818474</td><td align="center" valign="middle" >ATACTTCCGGTGGCTCCAG GCACCTTTGGCAAGATCCTC</td><td align="center" valign="middle" >131</td><td align="center" valign="middle" >81.0</td><td align="center" valign="middle" >94.3</td></tr><tr><td align="center" valign="middle" >eEF-1α</td><td align="center" valign="middle" >Ref‡</td><td align="center" valign="middle" >Eukaryotic elongation factor 1-alpha</td><td align="center" valign="middle" >JZ818475</td><td align="center" valign="middle" >GAGCCAAAGAGACCCACAGAC TCAGTGAGAGCCTCGTGGT</td><td align="center" valign="middle" >194</td><td align="center" valign="middle" >82.2</td><td align="center" valign="middle" >93.2</td></tr><tr><td align="center" valign="middle" >eIF-2</td><td align="center" valign="middle" >Ref‡</td><td align="center" valign="middle" >Eukaryotic translation initiation factor 2</td><td align="center" valign="middle" >JZ818476</td><td align="center" valign="middle" >GGTGCTGGGTCATCAAAGG GCTCTGGGTCCTGGACAAC</td><td align="center" valign="middle" >162</td><td align="center" valign="middle" >78.5</td><td align="center" valign="middle" >94.2</td></tr><tr><td align="center" valign="middle" >eIF-5</td><td align="center" valign="middle" >Ref†</td><td align="center" valign="middle" >Eukaryotic translation initiation factor 5</td><td align="center" valign="middle" >JZ818477</td><td align="center" valign="middle" >ATGCACTGGAGGAAGAGCAC TCCTCCGACTCTGACTCTGC</td><td align="center" valign="middle" >133</td><td align="center" valign="middle" >79.5</td><td align="center" valign="middle" >97.2</td></tr><tr><td align="center" valign="middle" >GAPDH</td><td align="center" valign="middle" >Ref†</td><td align="center" valign="middle" >Glyceraldehyde 3-P Dehydrogenase</td><td align="center" valign="middle" >JZ818478</td><td align="center" valign="middle" >CTGGAGAGGTGGAAGAGCTG GGTTGGGACACGGAATGAC</td><td align="center" valign="middle" >127</td><td align="center" valign="middle" >82.1</td><td align="center" valign="middle" >97.8</td></tr><tr><td align="center" valign="middle" >ITR</td><td align="center" valign="middle" >Ref‡</td><td align="center" valign="middle" >Inositol Transporter</td><td align="center" valign="middle" >JZ818479</td><td align="center" valign="middle" >TGGTCTTGGTGTAGGGATGG GGAAAGGAACTGTCCACCAG</td><td align="center" valign="middle" >127</td><td align="center" valign="middle" >79.6</td><td align="center" valign="middle" >98.8</td></tr><tr><td align="center" valign="middle" >Pro1</td><td align="center" valign="middle" >Ref‡</td><td align="center" valign="middle" >Profilin 1</td><td align="center" valign="middle" >JZ818480</td><td align="center" valign="middle" >CCTCGAATGACAGCTCCAG TCCTCGGTGTAGACGGTAGC</td><td align="center" valign="middle" >181</td><td align="center" valign="middle" >80.6</td><td align="center" valign="middle" >97.5</td></tr><tr><td align="center" valign="middle" >Rer1</td><td align="center" valign="middle" >Ref‡</td><td align="center" valign="middle" >Retention in endoplasmic reticulum 1 protein</td><td align="center" valign="middle" >JZ818481</td><td align="center" valign="middle" >GCCTTCTGATGGTGGACCT GGCCAGAAGACAGGAACATC</td><td align="center" valign="middle" >165</td><td align="center" valign="middle" >78.9</td><td align="center" valign="middle" >98.0</td></tr><tr><td align="center" valign="middle" >18S rRNA</td><td align="center" valign="middle" >Ref†</td><td align="center" valign="middle" >18S ribosomal RNA</td><td align="center" valign="middle" >JZ818482</td><td align="center" valign="middle" >GGGCTCGAAGACGATCAG AGCCTTGCGACCATACTCC</td><td align="center" valign="middle" >145</td><td align="center" valign="middle" >82.3</td><td align="center" valign="middle" >97.8</td></tr><tr><td align="center" valign="middle" >RPL4</td><td align="center" valign="middle" >Ref†</td><td align="center" valign="middle" >Ribosomal protein L4</td><td align="center" valign="middle" >JZ818483</td><td align="center" valign="middle" >GGATGGCTTTGCTTGCTG CTTTCCCTGCAGCCTTGA</td><td align="center" valign="middle" >114</td><td align="center" valign="middle" >80.0</td><td align="center" valign="middle" >99.7</td></tr><tr><td align="center" valign="middle" >Tub</td><td align="center" valign="middle" >Ref†</td><td align="center" valign="middle" >α-tubulin</td><td align="center" valign="middle" >JZ818484</td><td align="center" valign="middle" >CAGCCTCCTTCAGTTGTGC CTTCTTCCATGCCCTCACC</td><td align="center" valign="middle" >175</td><td align="center" valign="middle" >82.6</td><td align="center" valign="middle" >96.2</td></tr><tr><td align="center" valign="middle" >UBQ-2</td><td align="center" valign="middle" >Ref‡</td><td align="center" valign="middle" >Ubiquitin 2</td><td align="center" valign="middle" >JZ818485</td><td align="center" valign="middle" >GGACTCAAGGTGGCCAAAC GCCTAAGCCAGTGGGTGTCT</td><td align="center" valign="middle" >197</td><td align="center" valign="middle" >82.5</td><td align="center" valign="middle" >93.0</td></tr><tr><td align="center" valign="middle" >UBQ-5</td><td align="center" valign="middle" >Ref†</td><td align="center" valign="middle" >Ubiquitin-like protein 5</td><td align="center" valign="middle" >JZ818486</td><td align="center" valign="middle" >GAAGGTTCGCGTGAAGTGC CACCGAGAGTGATGTGATCC</td><td align="center" valign="middle" >140</td><td align="center" valign="middle" >82.1</td><td align="center" valign="middle" >92.0</td></tr><tr><td align="center" valign="middle" >UBL-2a</td><td align="center" valign="middle" >Ref†</td><td align="center" valign="middle" >Ubiquitin protein ligase 2a</td><td align="center" valign="middle" >JZ818487</td><td align="center" valign="middle" >CCAAACCCAAACTCACCAG AGCAGTCCAACTCTGCTCAAC</td><td align="center" valign="middle" >108</td><td align="center" valign="middle" >80.5</td><td align="center" valign="middle" >95.9</td></tr><tr><td align="center" valign="middle" >Unknown</td><td align="center" valign="middle" >Ref‡</td><td align="center" valign="middle" >No hit</td><td align="center" valign="middle" >JZ818488</td><td align="center" valign="middle" >ATGAGCCTTCGTCGTTGC GGAGCCAATCTAGCTGGAAC</td><td align="center" valign="middle" >169</td><td align="center" valign="middle" >79.8</td><td align="center" valign="middle" >99.0</td></tr><tr><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td><td align="center" valign="middle" ></td></tr><tr><td align="center" valign="middle" >ProDh</td><td align="center" valign="middle" >GOI</td><td align="center" valign="middle" >Proline dehydrogenase</td><td align="center" valign="middle" >JZ818489</td><td align="center" valign="middle" >GGCTGCTGCAAAAGCACA GCCCTTCTCAAGAGGTATGG</td><td align="center" valign="middle" >180</td><td align="center" valign="middle" >79.6</td><td align="center" valign="middle" >98.4</td></tr><tr><td align="center" valign="middle" >SPS</td><td align="center" valign="middle" >GOI</td><td align="center" valign="middle" >Sucrose phosphate synthase</td><td align="center" valign="middle" >JZ818490</td><td align="center" valign="middle" >TCCCAAGCCCTCAGATACC CTGCTTCCGACTCCCTTCA</td><td align="center" valign="middle" >146</td><td align="center" valign="middle" >80.6</td><td align="center" valign="middle" >96.4</td></tr><tr><td align="center" valign="middle" >SuSy</td><td align="center" valign="middle" >GOI</td><td align="center" valign="middle" >Sucrose synthase</td><td align="center" valign="middle" >JZ818491</td><td align="center" valign="middle" >CCGATTGACATCCTTCTACCC GTCCTTTGACTCCTTCCTCCT</td><td align="center" valign="middle" >235</td><td align="center" valign="middle" >82.6</td><td align="center" valign="middle" >93.0</td></tr></tbody></table></table-wrap><p>†Setection based on literature; ‡Setection based on differential hybridization of alfalfa cDNA library.</p><p>with leaves and ground to a fine powder in an analytical mill (IKA A11, Wilmington, NC) equipped with a cutting blade and a reinforced chamber for embrittlement of tissues in liquid N<sub>2</sub>. Total RNA was extracted using a CTAB procedure as described in Dub&#233; et al. (2013). Total RNA was quantified using the Experion<sup>TM</sup> RNA StdSens microcapillary chip (Bio-Rad, Mississauga, ON, Canada) and its integrity based on the RNA quality indicator (RQI) calculated by the Experion<sup>TM</sup> software was always greater than 8. First-strand cDNA was synthesized from 1 &#181;g of total RNA and oligo(dT)<sub>18</sub> primers using the Transcriptor First Strand cDNA synthesis Kit (Roche Applied Science, Laval, QC, Canada) following the manufacturer instructions. Any residual genomic DNA was removed by a treatment with DNaseI (Invitrogen, Burlington, ON, Canada) prior to cDNA synthesis. Two independent cDNA synthesis reactions were performed for each sample and used as technical replicates in RT-qPCR analyses.</p></sec><sec id="s2_4"><title>2.4. Real-Time PCR</title><p>RT-qPCR analysis of gene expression was performed according to the MIQE guidelines [<xref ref-type="bibr" rid="scirp.53242-ref6">6</xref>] . Assays were carried out as described in Dub&#233; et al. [<xref ref-type="bibr" rid="scirp.53242-ref26">26</xref>] in a Mastercycler<sup>&#174;</sup> ep realplex system (Eppendorf Canada, Mississauga, ON, Canada) using the QuantiTect<sup>&#174;</sup> SYBR GreenPCR kit (QIAGEN, Toronto, ON, Canada). The 10-&#181;l reaction mixture contained 3 &#181;l of first-strand cDNA and 0.5 &#181;M of each of the forward and reverse primers. The thermocycler program was set to: 15 min activation at 95˚C followed by 40 cycles of 15 s at 95˚C, 15 s at 60˚C; 1 min extension at 72˚C. Real-time PCR was carried out as duplicates and control samples without template or with RNA alone without reverse transcription were included as checks for potential contamination with genomic DNA. Twenty (20) &#181;l of each reaction were run on 2% agarose gels stained with ethidium bromide to check the specificity of amplification. The DNA fragments were recovered using the QIAquick gel extraction kit (QIAGEN Inc., Mississauga, ON, Canada) and confirmed by sequencing. PCR efficiency (%) was calculated from the linear regression of a seven fold dilution of each PCR product using the following equation: Efficiency % = (10<sup>(</sup><sup>−</sup><sup>1/slope)</sup> − 1) &#215; 100. The threshold cycle (Cq) values at which the PCR product fluorescence rises over the background fluorescence was determined by the instrument software which was set to default parameters. Data was analyzed with the qBase<sup>PLUS</sup> software version 3.0 (Biogazelle, Ghent, Belgium). Inter-run calibrators were included on each plate to account for plate-to-plate variation. Normalized relative expression levels was calculated using the 2<sup>−</sup><sup>ΔΔCq</sup> or comparative Cq method based on the differences in Cq between the target and the reference genes and corrected for PCR efficiency [<xref ref-type="bibr" rid="scirp.53242-ref27">27</xref>] .</p></sec><sec id="s2_5"><title>2.5. Statistical Analysis</title><p>Statistical analysis of gene expression data was performed with the two-way Anova procedure of SigmaPlot<sup>&#174;</sup> Ver. 12.0 (Systat Software, San Jose, CA). Data normality was verified using the Shapiro-Wilk statistic. Pairwise comparison of means was performed with the Tukey test and statistical significance was postulated at P &gt; 0.05.</p></sec></sec><sec id="s3"><title>3. Results and Discussion</title><sec id="s3_1"><title>3.1. Selection of Candidate Genes for Normalization of Gene Expression</title><p>Reverse transcription quantitative PCR (RT-qPCR) is a highly sensitive technique that has become the standard for gene expression analysis [<xref ref-type="bibr" rid="scirp.53242-ref28">28</xref>] .Various factors including variation in RNA integrity, reverse transcription efficiency or amount of cDNA templates between samples are significant sources of uncontrolled errors in RT- qPCR analysis of gene expression [<xref ref-type="bibr" rid="scirp.53242-ref9">9</xref>] . The normalization of samples against two or more reference genes is therefore required to account for technical variation and to achieve reliable estimates of true biological effects [<xref ref-type="bibr" rid="scirp.53242-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref29">29</xref>] . Expression levels of reference genes in RT-qPCR analyses can be extremely variable under different experimental conditions. Consequently, a systematic validation of the stability of expression needs to be performed in order to identify the most stable genes in a given experiment and to determine the optimal combination required for normalization [<xref ref-type="bibr" rid="scirp.53242-ref9">9</xref>] . In that perspective a validated repertoire of genes stably expressed in distinct genetic backgrounds of cultivated alfalfa exposed to variable environmental conditions or sampled at different developmental stages would be a valuable resource for functional analyses of genes associated to key agronomic traits in that species.</p><p>We evaluated twenty one (21) candidates as potential reference genes for normalization of transcript levels in RT-qPCR analysis of gene expression in plants of alfalfa exposed to low temperature (<xref ref-type="table" rid="table1">Table 1</xref>). The selection of candidate genes was based on the following criteria:1―Previous reports of expression stability under various environmental conditions and different species [<xref ref-type="bibr" rid="scirp.53242-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref14">14</xref>] or; 2―Lack of differential expression in a comparative macroarray hybridization of an EST collection with cDNA from non-acclimated and cold-acclimated crowns of alfalfa (<xref ref-type="table" rid="table1">Table 1</xref>). High amplification efficiencies that varied between 91 and 99% were observed for all selected candidates. This indicated an efficient annealing of the primers allowing an accurate detection of Cq and robust RT-qPCR assays [<xref ref-type="bibr" rid="scirp.53242-ref11">11</xref>] . Some sequences have previously been validated as reference genes in alfalfa [<xref ref-type="bibr" rid="scirp.53242-ref30">30</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref31">31</xref>] and other plant systems [<xref ref-type="bibr" rid="scirp.53242-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref14">14</xref>] . Other candidates including a vacuolar H+-ATPase A subunit (ATPase), a coatamer delta subunit (COP), cafeic acid 3-O-methyl transferase (COMT), an inositol transporter (ITR), profiling 1 (Pro1) and a retention in reticulum 1 protein (Rer1) homolog that we selected on the basis of the stability of their expression in a differential macroarray hybridization had not been previously tested as candidates.</p></sec><sec id="s3_2"><title>3.2. Stability of the Expression of Candidate Reference Genes</title><p>The stability of the 21 candidate reference genes expressed as the geNorm mean pairwise variation (M) of a gene in comparison to the other genes was first tested with samples from plants acclimated to low temperature under controlled conditions in 2011 (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)). Using a M threshold value of ≤ 0.5 [<xref ref-type="bibr" rid="scirp.53242-ref27">27</xref>] , the most stably expressed genes were 18S rRNA, UBL-2a, ADF, CAC, ATPase, Rer1, eF-1α, COP, UBQ-5, eIF-2, UBQ-2 and GAPDH. Conversely Act, COMT and Tub were deemed unstable under these conditions. An M value just below the 0.5 geNorm threshold for GAPDH is also noteworthy. Act and Tub were shown to be unsuitable as references to normalize the expression of genes in sweet potato (Ipomoea batatas (L.) Lam) samples exposed to cold [<xref ref-type="bibr" rid="scirp.53242-ref16">16</xref>] . Graphical depiction of the number of cycles required for the fluorescence signal from amplified fragments to rise above the background level (Cq values) for two variable (Act and Tub) and two stable (UBL-2a and 18S rRNA) candidate genes in the alfalfa populations ATF0 and ATF5 illustrate the contrasted stability of these two set of genes (<xref ref-type="fig" rid="fig2">Figure 2</xref>). With their expression levels significantly repressed in plants exposed to low temperature (higher Cq values), Act and Tub clearly fall short of the reference genes requirement to maintain a stable expression regardless of the experimental conditions. This is in stark contrast with the highly stable expression of UBL-2a and 18S-rRNA under these experimental conditions. Act has been previously shown to be unstable under various experimental conditions and was deemed unsuitable to normalize stress-induced gene expression in several species [<xref ref-type="bibr" rid="scirp.53242-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref32">32</xref>] including alfalfa [<xref ref-type="bibr" rid="scirp.53242-ref30">30</xref>] . Rapacz et al. [<xref ref-type="bibr" rid="scirp.53242-ref18">18</xref>] concluded that the stability of Act in barley (Hordeum vulgare) exposed to abiotic stress could depend on the developmental stage. Tub is another gene commonly used for normalization of gene expression that has been frequently shown to be unstable across species and experimental treatments [<xref ref-type="bibr" rid="scirp.53242-ref9">9</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref12">12</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref16">16</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref20">20</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref30">30</xref>] .</p><p>The 12 candidate genes below the 0.5 M threshold in <xref ref-type="fig" rid="fig1">Figure 1</xref>(a) were further evaluated for their stability in response to environmental, developmental and genetic variations (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). This extensive analysis tended to confirm the initial observations with regard to the stability of these candidates except for18S rRNA which was more unstable in the other data sets (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)). A much higher geNorm M value for 18s rRNA in the 2013 cold acclimation experiment indicates an instability as a reference gene even for replicated experiments conducted under identical conditions. Xia et al. [<xref ref-type="bibr" rid="scirp.53242-ref32">32</xref>] recently noted that 18S rRNA was unstable as a reference gene (geNorm M value ≥ 0.5) in coconut (Cocos nucifera L.) partly because of the abundance of its transcripts. It has been pointed out that large differences in the levels of target and reference gene transcripts may affect the accuracy of RT-qPCR analyses [<xref ref-type="bibr" rid="scirp.53242-ref11">11</xref>] . On the other hand, UBL-2a, ATPase and Rer1 were highly stable across a wide range of experimental conditions and are strong candidates as reference genes in RT-qPCR studies of gene expression in alfalfa. Ubiquitin protein ligase genes were selected as the most suitable reference genes across RNA samples from various tissues of Brazilian rubber trees (Hevea brasiliensis) treated with plant growth regulators [<xref ref-type="bibr" rid="scirp.53242-ref14">14</xref>] . It should be noted that Rer1 and ATPase genes that were included as candidates on the basis of their stability of expression in a differential macroarray hybridization of alfalfa ESTs had not been previously tested as putative reference genes in other species. New reference genes identified by microarray analysis in Arabidopsis thaliana [<xref ref-type="bibr" rid="scirp.53242-ref33">33</xref>] and soybean (Glycine max) [<xref ref-type="bibr" rid="scirp.53242-ref34">34</xref>] were shown to outperform commonly used housekeeping genes in these species and other plant systems as well [<xref ref-type="bibr" rid="scirp.53242-ref21">21</xref>] . It is also noteworthy that eEF-1α consistently maintained an M value well below the 0.5 geNorm threshold across all treatments and genetic sources and is another candidate to consider in the validation of reference genes in RT-qPCR analysis of gene expression in alfalfa. This is in agreement with previous reports of eEF-1α stable expression in various species tissues and treatments [<xref ref-type="bibr" rid="scirp.53242-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref32">32</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref35">35</xref>] including in low temperature-treated crowns of barley [<xref ref-type="bibr" rid="scirp.53242-ref36">36</xref>] .</p><fig-group id="fig1"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> (a) Expression stability estimated with the geNorm<sup>Plus </sup>M value for 21 candidate reference genes in the 2011 cold acclimation experiment. Candidates with lower M values have a more stable expression across all sampling points and replicates. (b) Twelve candidate genes with M values below the 0.5 cut-off threshold in panel (a) were subsequently tested for the stability of their expression under various experimental conditions including: 1―Repeat of the 2011 cold acclimation protocol in 2013; 2―A time course of cold acclimation with two cultivars (Apica and Evolution); 3―Exposure to a short photoperiod at high temperature; 4―Water stress and; 5―Sampling at different developmental stages or in plants of contrasting stem degradability. Bold numbers indicate reference gene with lowest values under each experimental condition.</title></caption><fig id ="fig1_1"><label>(b)</label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2601858x5.png"/></fig><fig id ="fig1_2"><label></label><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2601858x6.png"/></fig></fig-group><p>Data in <xref ref-type="fig" rid="fig1">Figure 1</xref>(b) also reveal that even though GAPDH is frequently used as a housekeeping gene in RT-qPCR studies, it seldom met the requirements for robust analysis of gene expression in our study. The poor performance of GAPDH as a reference gene in cold acclimation experiments is corroborated by the significant induction of its expression in plants of four populations of alfalfa exposed to low temperature (<xref ref-type="fig" rid="fig3">Figure 3</xref>). This is</p><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Quantification cycle (Cq) values of four candidate reference genes in a RT-qPCR assessment of expression in samples from the 2011 cold acclimation experiment. The Cq value is the number of cycles needed to rise above the threshold fluorescence signal and reflects the abundance of transcripts present in a sample. Each bar represents the mean of four replicates for non-acclimated (NA) and cold-accli- mated (A) plants of populations ATF0 and ATF5. For each gene, treatments with the same letter are not statistically different at P &gt; 0.05</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2601858x7.png"/></fig><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Relative quantification of GAPDH expression during a time course of cold acclimation within cultivars Apica and Evolution and TF5 populations obtained after five cycles of recurrent selection for superior freezing tolerance within these two genetic backgrounds (TF0). Samples were taken 0 h, 8 h, 1 d, 3 d, 7 d and 15 d after transfer to 2˚C and after two additional weeks of hardening below freezing at −2˚C (HF). The validated reference genes used for normalization were Rer1 and ATPase. Each bar represents the mean of four replicates. Within each population, relative expression values with the same letters are not statistically different at P &gt; 0.05</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2601858x8.png"/></fig><p>in accordance with previous reports of its poor performance as a reference gene in other species [<xref ref-type="bibr" rid="scirp.53242-ref10">10</xref>] [<xref ref-type="bibr" rid="scirp.53242-ref19">19</xref>] including the normalization of gene expression in cold-treated plants of lentil (Lens culinaris) [<xref ref-type="bibr" rid="scirp.53242-ref19">19</xref>] and coconut [<xref ref-type="bibr" rid="scirp.53242-ref32">32</xref>] .(Zhu et al. 2013)(Saha and Vandemark (2013)) GAPDH and Tub were recently ranked by geNorm<sup>Plus</sup> as among the most unstable candidate for the normalization of gene expression in alfalfa [<xref ref-type="bibr" rid="scirp.53242-ref30">30</xref>] . However, conflicting reports on the stability of the expression of GADPH and considerable regulation of eEF-1α in plants of the legume Cicer arietinum exposed to abiotic stresses illustrate that generalization should be avoided in the selection of reference genes and that the optimal combination must be validated under each specific experimental conditions. {Castro, 2012 #2710}{Castro, 2012 #2710}{Castro, 2012 #2710}{Castro, 2012 #2710;Castro, 2012 #2710;Castro, 2012 #2710@@author-year}{Abberton, 2008 #2154}{Abberton, 2008 #2154}{Garcia de Castro, 2000 #791}{Castro, 2012 #2710}{Castro, 2012 #2710}This task will be facilitated in alfalfa by the identification of strong candidates in the current study.</p><p>A combination of reference genes is required to ensure the accuracy of RT-qPCR analysis of gene expression [<xref ref-type="bibr" rid="scirp.53242-ref22">22</xref>] . However, increasing the number of internal controls is costly and time consuming and they should be kept to the minimum required for accurate normalization. The pairwise variation analysis of the optimal number of reference genes determined as the geNorm V value was used to evaluate the benefits of adding more reference genes on the accuracy of the normalization factor. The value is based on the calculation of the pairwise variation (<inline-formula><inline-graphic xlink:href="http://html.scirp.org/file/15-2601858x9.png" xlink:type="simple"/></inline-formula>) observed after the sequential addition of reference genes. A cut-off of 0.15 is typically used as a value below which there is no benefit of including other reference genes [<xref ref-type="bibr" rid="scirp.53242-ref22">22</xref>] . V values below the 0.15 threshold in <xref ref-type="table" rid="table2">Table 2</xref> for the V2/3 combination show that proper normalization of gene expression in all our alfalfa sample sets could be achieved with only two reference genes. In accordance with our observations, Chen et al. [<xref ref-type="bibr" rid="scirp.53242-ref12">12</xref>] also observed that two stable reference genes were sufficient for accurate normalization of gene expression in banana (Musa acuminate) fruits. Their results also concur with our observation in <xref ref-type="fig" rid="fig1">Figure 1</xref>(b) that the combination of reference genes does however vary with experimental conditions.</p></sec><sec id="s3_3"><title>3.3. Validation of Reference Genes</title><p>RT-qPCR determinations of relative levels of expression of sucrose synthase (SuSy), sucrose phosphate synthase (SPS) and proline dehydrogenase (ProDh) known to be involved in the cold acclimation process highlight the importance of using validated reference genes (<xref ref-type="fig" rid="fig4">Figure 4</xref>). When the two most stable reference genes UBL- 2a and 18S rRNA in <xref ref-type="fig" rid="fig1">Figure 1</xref>(a) were used for normalization of the 2011 cold acclimation samples, the results indicated a significant drop in SuSy and ProDh transcripts and a slight but significant increase in SPS gene expression in plants acclimated to low temperature. These results concur with previous observations that the enzymatic activity of SPS and SuSy are respectively induced and supressed in cold-acclimated crowns of alfalfa [<xref ref-type="bibr" rid="scirp.53242-ref37">37</xref>] . They are also consistent with the fact that ProDh is considered as a key enzyme in proline catabolism and that its expression is generally suppressed in plants exposed to abiotic stresses [<xref ref-type="bibr" rid="scirp.53242-ref38">38</xref>] . The slight but significant difference in SuSy expression between acclimated plants of ATF0 and ATF5 is indicative of the sensitivity of RT-qPCR analysis with validated reference genes.</p><table-wrap id="table2" ><label><xref ref-type="table" rid="table2">Table 2</xref></label><caption><title> Pairwise variation analysis of the optimal number of references genes estimated by the geNorm V value. The V value is an estimate of the benefits of adding additional reference genes to the normalization factor. A V value &lt;0.15 indi- cates no significant gain from the inclusion of additional reference genes</title></caption><table><tbody><thead><tr><th align="center" valign="middle"  rowspan="2"  >Data set</th><th align="center" valign="middle"  colspan="10"  >geNorm pairwise variation V value</th></tr></thead><tr><td align="center" valign="middle" >V2/3</td><td align="center" valign="middle" >V3/4</td><td align="center" valign="middle" >V4/5</td><td align="center" valign="middle" >V5/6</td><td align="center" valign="middle" >V6/7</td><td align="center" valign="middle" >V7/8</td><td align="center" valign="middle" >V8/9</td><td align="center" valign="middle" >V9/10</td><td align="center" valign="middle" >V10/11</td><td align="center" valign="middle" >V11/12</td></tr><tr><td align="center" valign="middle" >Cold acclimation (2011)</td><td align="center" valign="middle" >0.104</td><td align="center" valign="middle" >0.089</td><td align="center" valign="middle" >0.065</td><td align="center" valign="middle" >0.056</td><td align="center" valign="middle" >0.051</td><td align="center" valign="middle" >0.049</td><td align="center" valign="middle" >0.049</td><td align="center" valign="middle" >0.052</td><td align="center" valign="middle" >0.044</td><td align="center" valign="middle" >0.041</td></tr><tr><td align="center" valign="middle" >Cold acclimation (2013)</td><td align="center" valign="middle" >0.076</td><td align="center" valign="middle" >0.066</td><td align="center" valign="middle" >0.062</td><td align="center" valign="middle" >0.061</td><td align="center" valign="middle" >0.058</td><td align="center" valign="middle" >0.050</td><td align="center" valign="middle" >0.049</td><td align="center" valign="middle" >0.057</td><td align="center" valign="middle" >0.056</td><td align="center" valign="middle" >0.076</td></tr><tr><td align="center" valign="middle" >Time course of cold acclimation</td><td align="center" valign="middle" >0.120</td><td align="center" valign="middle" >0.083</td><td align="center" valign="middle" >0.065</td><td align="center" valign="middle" >0.059</td><td align="center" valign="middle" >0.049</td><td align="center" valign="middle" >0.053</td><td align="center" valign="middle" >0.047</td><td align="center" valign="middle" >0.046</td><td align="center" valign="middle" >0.050</td><td align="center" valign="middle" >0.086</td></tr><tr><td align="center" valign="middle" >Apica</td><td align="center" valign="middle" >0.096</td><td align="center" valign="middle" >0.073</td><td align="center" valign="middle" >0.060</td><td align="center" valign="middle" >0.059</td><td align="center" valign="middle" >0.053</td><td align="center" valign="middle" >0.051</td><td align="center" valign="middle" >0.049</td><td align="center" valign="middle" >0.046</td><td align="center" valign="middle" >0.046</td><td align="center" valign="middle" >0.091</td></tr><tr><td align="center" valign="middle" >Evolution</td><td align="center" valign="middle" >0.106</td><td align="center" valign="middle" >0.077</td><td align="center" valign="middle" >0.074</td><td align="center" valign="middle" >0.060</td><td align="center" valign="middle" >0.052</td><td align="center" valign="middle" >0.051</td><td align="center" valign="middle" >0.044</td><td align="center" valign="middle" >0.045</td><td align="center" valign="middle" >0.050</td><td align="center" valign="middle" >0.079</td></tr><tr><td align="center" valign="middle" >Acclimation to natural conditions</td><td align="center" valign="middle" >0.098</td><td align="center" valign="middle" >0.075</td><td align="center" valign="middle" >0.060</td><td align="center" valign="middle" >0.052</td><td align="center" valign="middle" >0.049</td><td align="center" valign="middle" >0.047</td><td align="center" valign="middle" >0.057</td><td align="center" valign="middle" >0.062</td><td align="center" valign="middle" >0.061</td><td align="center" valign="middle" >0.052</td></tr><tr><td align="center" valign="middle" >Photoperiod</td><td align="center" valign="middle" >0.108</td><td align="center" valign="middle" >0.084</td><td align="center" valign="middle" >0.070</td><td align="center" valign="middle" >0.063</td><td align="center" valign="middle" >0.054</td><td align="center" valign="middle" >0.052</td><td align="center" valign="middle" >0.060</td><td align="center" valign="middle" >0.063</td><td align="center" valign="middle" >0.068</td><td align="center" valign="middle" >0.061</td></tr><tr><td align="center" valign="middle" >Water stress</td><td align="center" valign="middle" >0.080</td><td align="center" valign="middle" >0.067</td><td align="center" valign="middle" >0.065</td><td align="center" valign="middle" >0.050</td><td align="center" valign="middle" >0.044</td><td align="center" valign="middle" >0.061</td><td align="center" valign="middle" >0.054</td><td align="center" valign="middle" >0.063</td><td align="center" valign="middle" >0.059</td><td align="center" valign="middle" >0.062</td></tr><tr><td align="center" valign="middle" >Development</td><td align="center" valign="middle" >0.067</td><td align="center" valign="middle" >0.093</td><td align="center" valign="middle" >0.068</td><td align="center" valign="middle" >0.061</td><td align="center" valign="middle" >0.052</td><td align="center" valign="middle" >0.053</td><td align="center" valign="middle" >0.047</td><td align="center" valign="middle" >0.040</td><td align="center" valign="middle" >0.049</td><td align="center" valign="middle" >0.088</td></tr></tbody></table></table-wrap><fig id="fig4"  position="float"><label><xref ref-type="fig" rid="fig4">Figure 4</xref></label><caption><title> Relative quantification of the expression of sucrose synthase, sucrose phosphate synthase and proline dehydrogenase in plants of the population ATF5 and of the initial genetic background (ATF0) sampled during the 2011 cold acclimation experiment. Expression was normalized with validated reference genes (UBL-2a and 18S rRNA) or with commonly used reference genes that were above the 0.5 M value threshold. Each bar represents the mean of four replicates for non-acclimated (NA) and cold-acclimated (A) plants of populations ATF0 and ATF5. Within each panel, treatments with the same letter are not statistically different at P &gt; 0.05</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/15-2601858x10.png"/></fig><p>Normalization with less stable Act and Tub genes led to strikingly different conclusions including a lack of a low temperature effect on SuSy expression, a much higher increase in SPS gene expression and unexpected cold inducibility of ProDh. Such discrepancies are the results of biased adjustment to the data set when low temperature-repressed Act and Tub (<xref ref-type="fig" rid="fig2">Figure 2</xref>) are used to normalize gene expression. Xia et al. [<xref ref-type="bibr" rid="scirp.53242-ref32">32</xref>] noted that gene expression data normalized with less stable reference genes can lead to different conclusions due to weaker variation or higher levels of expression of target genes than those obtained with candidates validated with statistical algorithms.</p></sec></sec><sec id="s4"><title>4. Conclusion</title><p>Comparative geNorm<sup>Plus</sup> analysis of a repertoire of candidate reference genes identified a set of candidates with high potential as reference for normalization in RT-qPCR analysis of gene expression in alfalfa. Genes encoding ubiquitin protein ligase 2a (UBL-2a), actin depolymerizing factor (ADF), retention in the endoplasmic reticulum protein 1 (Rer1) and eukaryotic elongation factor 1-alpha (eEF-1α) were found to be good references to normalize the expression of genes potentially related to key traits in alfalfa populations. Standardization of transcript levels in samples from a wide range of experimental conditions was systematically achieved with a combination of no more than two reference genes. When RT-qPCR data were normalized with stably expressed genes, observations on the expression of genes functionally related to cold acclimation in alfalfa was consistent with current knowledge of the physiology of that trait. Normalization with unstable genes led to markedly different conclusions with regard to the expression of these genes under these treatments. The candidate reference genes identified in our study will foster the acquisition of accurate RT-qPCR results in functional analyses of gene expression in alfalfa.</p></sec><sec id="s5"><title>Acknowledgements</title><p>The authors would like to thank Dr. Serge Laberge for providing access to the EST library from cold acclimated alfalfa. We would also like to thank Mr. R&#233;jean Desgagn&#233; and Mr. David Gagn&#233; for their contribution to the development of the EST collection and database. The participation of Dr. Marie-Pier Dub&#233; to this project was supported by a NSERC visiting fellowship in Canadian federal government laboratories. This project was supported by a competitive grant of Agriculture and Agri-Food Canada.</p></sec></body><back><ref-list><title>References</title><ref id="scirp.53242-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Russelle, M.P. (2001) Alfalfa. American Scientist, 89, 252-261. http://dx.doi.org/10.1511/2001.3.252</mixed-citation></ref><ref id="scirp.53242-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Han, Y., Kang, Y., Torres-Jerez, I., Cheung, F., Town, C., et al. (2011) Genome-Wide SNP Discovery in Tetraploid Alfalfa Using 454 Sequencing and High Resolution Melting Analysis. BMC Genomics, 12, 350. 
http://dx.doi.org/10.1186/1471-2164-12-350</mixed-citation></ref><ref id="scirp.53242-ref3"><label>3</label><mixed-citation publication-type="book" xlink:type="simple">Verenosi, F., Brummer, E.C. and Hyuyghe, C. (2010) Alfalfa. In: Boller, B., Posselt, U.K., Veronesi, F., Eds., Fodder Crops and Amenity Grasses, Handbook of Plant Breeding, Vol. 5, Springer, New York, 395-437.</mixed-citation></ref><ref id="scirp.53242-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Castonguay, Y., Laberge, S., Brummer, E.C. and Volenec, J.J. (2006) Alfalfa Winter Hardiness: A Research Retrospective and Integrated Perspective. Advances in Agronomy, 90, 203-265.  
http://dx.doi.org/10.1016/S0065-2113(06)90006-6</mixed-citation></ref><ref id="scirp.53242-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Jung, H.J.G., Samac, D.A. and Sarath, G. (2012) Modifying Crops to Increase Cell Wall Digestibility. Plant Science, 185-186, 65-77. http://dx.doi.org/10.1016/j.plantsci.2011.10.014</mixed-citation></ref><ref id="scirp.53242-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Bustin, S.A., Benes, V., Garson, J.A., Hellemans, J., Huggett, J., et al. (2009) The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clinical Chemistry, 55, 611-622. 
http://dx.doi.org/10.1373/clinchem.2008.112797</mixed-citation></ref><ref id="scirp.53242-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Guénin, S., Mauriat, M., Pelloux, J., Van Wuytswinkel, O., Bellini, C., et al. (2009) Normalization of qRT-PCR Data: The Necessity of Adopting a Systematic, Experimental Conditions-Specific, Validation of References. Journal of Experimental Botany, 60, 487-493. http://dx.doi.org/10.1093/jxb/ern305</mixed-citation></ref><ref id="scirp.53242-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Chang, E., Shi, S., Liu, J., Cheng, T., Xue, L., et al. (2012) Selection of Reference Genes for Quantitative Gene Expression Studies in Platycladus orientalis (Cupressaceae) Using Real-Time PCR. PLoS ONE, 7, e33278.</mixed-citation></ref><ref id="scirp.53242-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Gutierrez, L., Mauriat, M., Guénin, S., Pelloux, J., Lefebvre, J.-F., et al. (2008) The Lack of a Systematic Validation of Reference Genes: A Serious Pitfall Undervalued in Reverse Transcription-Polymerase Chain Reaction (RT-PCR) Analysis in Plants. Plant Biotechnology Journal, 6, 609-618. http://dx.doi.org/10.1111/j.1467-7652.2008.00346.x</mixed-citation></ref><ref id="scirp.53242-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Bin, W.S., Wei, L.K., Ping, D.W., Li, Z., Wei, G., et al. (2012) Evaluation of Appropriate Reference Genes for Gene Expression Studies in Pepper by Quantitative Real-Time PCR. Molecular Breeding, 30, 1393-1400.</mixed-citation></ref><ref id="scirp.53242-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Castro, P., Román, B., Rubio, J. and Die, J.V. (2012) Selection of Reference Genes for Expression Studies in Cicer arietinum L.: Analysis of cyp81E3 Gene Expression against Ascochyta rabiei. Molecular Breeding, 29, 261-274.  
http://dx.doi.org/10.1007/s11032-010-9544-8</mixed-citation></ref><ref id="scirp.53242-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Chen, L., Zhong, H.-Y., Kuang, J.-F., Li, J.-G., Lu, W.-J. and Chen, J.-Y. (2011) Validation of Reference Genes for RT-qPCR Studies of Gene Expression in Banana Fruit under Different Experimental Conditions. Planta, 234, 377-390.  
http://dx.doi.org/10.1007/s00425-011-1410-3</mixed-citation></ref><ref id="scirp.53242-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Fernández, M., Villarroel, C., Balbontín, C. and Valenzuela, S. (2010) Validation of Reference Genes for Real-Time qRT-PCR Normalization during Cold Acclimation in Eucalyptus globulus. Trees, 24, 1109-1116. 
http://dx.doi.org/10.1007/s00468-010-0483-0</mixed-citation></ref><ref id="scirp.53242-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Li, H., Qin, Y., Xiao, X. and Tang, C. (2011) Screening of Valid Reference Genes for Real-Time RT-PCR Data Normalization in Hevea brasiliensis and Expression Validation of a Sucrose Transporter Gene HbSUT3. Plant Science, 181, 132-139. http://dx.doi.org/10.1016/j.plantsci.2011.04.014</mixed-citation></ref><ref id="scirp.53242-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Maroufi, A., Van Bockstaele, E. and De Loose, M. (2010) Validation of Reference Genes for Gene Expression Analysis in Chicory (Cichorium intybus) Using Quantitative Real-Time PCR. BMC Molecular Biology, 11, 15. 
http://dx.doi.org/10.1186/1471-2199-11-15</mixed-citation></ref><ref id="scirp.53242-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Park, S.-C., Kim, Y.-H., Ji, C.Y., Park, S., Jeong, J.C., Lee, H.-S. and Kwak, S.-S. (2012) Stable Internal Reference Genes for the Normalization of Real-Time PCR in Different Sweetpotato Cultivars Subjected to Abiotic Stress Conditions. PLoS ONE, 7, e51502. http://dx.doi.org/10.1371/journal.pone.0051502</mixed-citation></ref><ref id="scirp.53242-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Goulao, L., Fortunato, A.C. and Ramalho, J. (2012) Selection of Reference Genes for Normalizing Quantitative Real-Time PCR Gene Expression Data with Multiple Variables in Coffea spp. Plant Molecular Biology Reporter, 30, 741-759. http://dx.doi.org/10.1007/s11105-011-0382-6</mixed-citation></ref><ref id="scirp.53242-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Rapacz, M., Stepień, A. and Skorupa, K. (2012) Internal Standards for Quantitative RT-PCR Studies of Gene Expression under Drought Treatment in Barley Hordeum vulgare: The Effects of Developmental Stage and Leaf Age. Acta Physiologiae Plantarum, 34, 1723-1733. http://dx.doi.org/10.1007/s11738-012-0967-1</mixed-citation></ref><ref id="scirp.53242-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Saha, G.C. and Vandemark, G.J. (2013) Stability of Expression of Reference Genes among Different Lentil (Lens culinaris) Genotypes Subjected to Cold Stress, White Mold Disease, and Aphanomyces Root Rot. Plant Molecular Biology Reporter, 31, 1109-1115. http://dx.doi.org/10.1007/s11105-013-0579-y</mixed-citation></ref><ref id="scirp.53242-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Shi, J., Liu, M., Shi, J.N., Zheng, G., Wang, Y., Wang, J.Y., et al. (2012) Reference Gene Selection for qPCR in Ammopiptanthus mongolicus under Abiotic Stresses and Expression Analysis of Seven ROS-Scavenging Enzyme Genes. Plant Cell Reports, 31 1245-1254. http://dx.doi.org/10.1007/s00299-012-1245-9</mixed-citation></ref><ref id="scirp.53242-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Zhu, J.F., Zhang, L., Li, W.F., Han, S.Y., Yang, W.H. and Qi, L.W. (2013) Reference Gene Selection for Quantitative Real-Time PCR Normalization in Caragana intermedia under Different Abiotic Stress Conditions. PLoS ONE, 8, e53196. http://dx.doi.org/10.1371/journal.pone.0053196</mixed-citation></ref><ref id="scirp.53242-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N. and De Paepe, A. (2002) Accurate Normalization of Real-Time Quantitative RT-PCR Data by Geometric Averaging of Multiple Internal Control Genes. Genome Biology, 3, RESEARCH0034.</mixed-citation></ref><ref id="scirp.53242-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Castonguay, Y., Michaud, R., Nadeau, P. and Bertrand, A. (2009) An Indoor Screening Method for Improvement of Freezing Tolerance in Alfalfa. Crop Science, 49, 809-818. http://dx.doi.org/10.2135/cropsci2008.09.0539</mixed-citation></ref><ref id="scirp.53242-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Castonguay, Y., Bertrand, A., Michaud, R. and Laberge, S. (2011) Cold-Induced Biochemical and Molecular Changes in Afalfa Populations Selectively Improved for Freezing Tolerance. Crop Science, 51, 2132-2144. 
http://dx.doi.org/10.2135/cropsci2011.02.0060</mixed-citation></ref><ref id="scirp.53242-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Duceppe, M.-O., Bertrand, A., Pattathil, S., Miller, J., Castonguay, Y., Hahn, M.G., et al. (2012) Assessment of Genetic Variability of Cell Wall Degradability for the Selection of Alfalfa with Improved Saccharification Efficiency. BioEnergy Research, 5, 904-914. http://dx.doi.org/10.1007/s12155-012-9204-4</mixed-citation></ref><ref id="scirp.53242-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Dubé, M.P., Castonguay, Y., Cloutier, J., Michaud, J. and Bertrand, A. (2013) Characterization of Two Novel Cold-Inducible K3 Dehydrin Genes from Alfalfa (Medicago sativa spp. sativa L.). Theoretical and Applied Genetics, 126, 823-835. http://dx.doi.org/10.1007/s00122-012-2020-6</mixed-citation></ref><ref id="scirp.53242-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Hellemans, J., Mortier, G., De Paepe, A., Speleman, F. and Vandesompele, J. (2007) qBase Relative Quantification Framework and Software for Management and Automated Analysis of Real-Time Quantitative PCR Data. Genome Biology, 8, R19. http://dx.doi.org/10.1186/gb-2007-8-2-r19</mixed-citation></ref><ref id="scirp.53242-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Bustin, S.A., Benes, V., Nolan, T. and Pfaffl, M.W. (2005) Quantitative Real-Time RT-PCR—A Perspective. Journal of Molecular Endocrinology, 34, 597-601. http://dx.doi.org/10.1677/jme.1.01755</mixed-citation></ref><ref id="scirp.53242-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Derveaux, S., Vandesompele, J. and Hellemans, J. (2010) How to Do Successful Gene Expression Analysis Using Real-Time PCR. Methods, 50, 227-230. http://dx.doi.org/10.1016/j.ymeth.2009.11.001</mixed-citation></ref><ref id="scirp.53242-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Guerriero, G., Legay, S. and Hausman, J.-F. (2014) Alfalfa Cellulose Synthase Gene Expression under Abiotic Stress: A Hitchhiker’s Guide to RT-qPCR Normalization. PLoS ONE, 9, e103808. 
http://dx.doi.org/10.1371/journal.pone.0103808</mixed-citation></ref><ref id="scirp.53242-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Pembleton, K.G. and Sathish, P. (2014) Giving Drought the Cold Shoulder: A Relationship between Drought Tolerance and Fall Dormancy in an Agriculturally Important Crop. AoB PLANTS, 6, plu012.</mixed-citation></ref><ref id="scirp.53242-ref32"><label>32</label><mixed-citation publication-type="other" xlink:type="simple">Xia, W., Liu, Z., Yang, Y., Xiao, Y., Mason, A.S., Zhao, S.L. and Ma, Z.L. (2014) Selection of Reference Genes for Quantitative Real-Time PCR in Cocos nucifera during Abiotic Stress. Botany, 92, 179-186.  
http://dx.doi.org/10.1139/cjb-2013-0212</mixed-citation></ref><ref id="scirp.53242-ref33"><label>33</label><mixed-citation publication-type="other" xlink:type="simple">Czechowski, T., Stitt, M., Altmann, T., Udvardi, M.K. and Scheible, W.R. (2005) Genome-Wide Identification and Testing of Superior Reference Genes for Transcript Normalization in Arabidopsis. Plant Physiology, 139, 5-17. 
http://dx.doi.org/10.1104/pp.105.063743</mixed-citation></ref><ref id="scirp.53242-ref34"><label>34</label><mixed-citation publication-type="other" xlink:type="simple">Libault, M., Thibivilliers, S., Bilgin, D.D., Radwan, O., Benitez, M., Clough, S.J. and Stacey, G. (2008) Identification of Four Soybean Reference Genes for Gene Expression Normalization. Plant Genome, 1, 44-54. 
http://dx.doi.org/10.3835/plantgenome2008.02.0091</mixed-citation></ref><ref id="scirp.53242-ref35"><label>35</label><mixed-citation publication-type="other" xlink:type="simple">Lee, H., Kim, J.H., Park, M., Kim, I.C., Yim, J.H., et al. (2010) Reference Genes Validation for qPCR Normalization in Deschampsia antarctica during Abiotic Stresses. Antarctic Science, 22, 477-484. 
http://dx.doi.org/10.1017/S0954102009990782</mixed-citation></ref><ref id="scirp.53242-ref36"><label>36</label><mixed-citation publication-type="other" xlink:type="simple">Janská, A., Hodek, J., Svoboda, P., Zámecník, J., Prá&amp;#138il, I.T., Vlasáková, E., et al. (2013) The Choice of Reference Gene Set for Assessing Gene Expression in Barley (Hordeum vulgare L.) under Low Temperature and Drought Stress. Molecular Genetics and Genomics, 288, 639-649. http://dx.doi.org/10.1007/s00438-013-0774-4</mixed-citation></ref><ref id="scirp.53242-ref37"><label>37</label><mixed-citation publication-type="other" xlink:type="simple">Castonguay, Y. and Nadeau, P. (1998) Enzymatic Control of Soluble Carbohydrate Accumulation in Cold-Acclimated Crowns of Alfalfa. Crop Science, 38, 1183-1189. http://dx.doi.org/10.2135/cropsci1998.0011183X003800050012x</mixed-citation></ref><ref id="scirp.53242-ref38"><label>38</label><mixed-citation publication-type="other" xlink:type="simple">Szabados, L. and Savouré, A. (2010) Proline: A Multifunctional Amino Acid. Trends in Plant Science, 15, 89-97. 
http://dx.doi.org/10.1016/j.tplants.2009.11.009</mixed-citation></ref></ref-list></back></article>