<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AiM</journal-id><journal-title-group><journal-title>Advances in Microbiology</journal-title></journal-title-group><issn pub-type="epub">2165-3402</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/aim.2014.48053</article-id><article-id pub-id-type="publisher-id">AiM-47407</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Induced Transcriptional Expression of &lt;i&gt;Bacillus subtilis&lt;/i&gt; Amino Acid Permease &lt;i&gt;yvbW&lt;/i&gt; in Response to Leucine Limitation
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>ean</surname><given-names>M. Rollins</given-names></name><xref ref-type="aff" rid="aff1"><sub>1</sub></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff1"><label>1</label><addr-line>Department of Biology and Chemistry, Fitchburg State University, Fitchburg, USA</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>srollins@fitchburgstate.edu</email></corresp></author-notes><pub-date pub-type="epub"><day>17</day><month>06</month><year>2014</year></pub-date><volume>04</volume><issue>08</issue><fpage>484</fpage><lpage>492</lpage><history><date date-type="received"><day>1</day>	<month>April</month>	<year>2014</year></date><date date-type="rev-recd"><day>5</day>	<month>May</month>	<year>2014</year>	</date><date date-type="accepted"><day>31</day>	<month>May</month>	<year>2014</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
   T box sequences have been identified upstream of a large number of uncharacterized genes such as transporters in bacterial genomes. Expression of each T box family gene is induced by limitation for a specific amino acid. T box family genes contain an untranslated leader region containing a factor-independent transcriptional terminator upstream of the structural genes. The anticodon of uncharged tRNA base-pairs with the leader mRNA at a codon referred to as the specifier sequence, inducing formation of an alternative antiterminator structure, allowing expression of the structural genes. There are several additional conserved primary sequence and secondary structural elements. Analysis of these elements can be used to predict the identity of the specifier codon and the amino acid signal. Bacillus subtilis hypothetical amino acid permease, yvbW, was analyzed as an example of this type of transcriptional regulatory prediction suggesting expression in response to leucine limitation. Expression was induced up to 130-fold in response to leucine limitation, utilizing a yvbW-lacZ transcriptional fusion. These data suggest that hypothetical amino acid permease YvbW may participate in leucine metabolism. A yvbW knockout strain was generated, although the substrate specificity for the putative amino acid permease was not identified. 
 
</p></abstract><kwd-group><kwd>T Box</kwd><kwd> Antitermination</kwd><kwd> Riboswitch</kwd><kwd> Amino Acid Permease</kwd><kwd> YvbW</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>The T box transcriptional antitermination system is widely used in Gram-positive bacteria for the regulation of aminoacyl-tRNA synthetase, amino acid biosynthesis and transporter genes [<xref ref-type="bibr" rid="scirp.47407-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref2">2</xref>] . The expression of each gene in the T box family is induced by limitation for a specific amino acid and not by general amino acid starvation. T box family genes are characterized by an untranslated leader region containing a factor-independent transcriptional terminator upstream of the structural genes. Uncharged tRNA, corresponding to the amino acid class of the response, interacts with the leader mRNA, thus inducing formation of an alternative antiterminator structure, allowing read through the leader region terminator and synthesis of the full-length message [<xref ref-type="bibr" rid="scirp.47407-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref4">4</xref>] (see <xref ref-type="fig" rid="fig1">Figure 1</xref>). Charged tRNA is unable to stabilize the antiterminator, therefore the factor-independent terminator is formed, which aborts transcription before expression of the structural gene(s) [<xref ref-type="bibr" rid="scirp.47407-ref3">3</xref>] (see <xref ref-type="fig" rid="fig1">Figure 1</xref>).</p><p>Analysis of T box transcriptional leaders revealed two base-pairing interactions between the leader mRNA and the cognate tRNA that are required for antitermination. The leader mRNA contains a codon designated the “specifier sequence” which base-pairs with the anticodon of the cognate tRNA [<xref ref-type="bibr" rid="scirp.47407-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref5">5</xref>] . Additionally, the conserved acceptor end sequence of tRNA, NCCA where N is referred to as the discriminator base, base-pairs with a bulged region of the antiterminator (UGGN) with covariance observed between the two variable bases (N) of these sequences [<xref ref-type="bibr" rid="scirp.47407-ref4">4</xref>] . This second base pairing putatively stabilizes the thermodynamically less favorable antiterminator structure. The acceptor end of charged tRNA is sterically blocked from inducing the antiterminator structure, thus allowing formation of the leader mRNA terminator. T box family leaders also contain a number of additional conserved primary sequence and secondary structural elements [<xref ref-type="bibr" rid="scirp.47407-ref3">3</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref6">6</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref7">7</xref>] . Four large stem-loop structures, designated as Stems I, II, IIA/B and III, are typically present. Several conserved primary sequence elements were also observed, including the AG box, GNUG, AGUA-box II, F box and CGUCCC. Additionally, the specifier codon typically ends with a C; this is referred to the C-rule.</p><p>For many T box family genes, the specificity of the amino acid signal has been determined experimentally [<xref ref-type="bibr" rid="scirp.47407-ref3">3</xref>]</p><fig id="fig1"  position="float"><label><xref ref-type="fig" rid="fig1">Figure 1</xref></label><caption><title> Model of B. subtilis yvbW expression. (a) An approximately 350 nt untranslated leader region, containing a factor independent transcriptional terminator, is upstream of the structural gene. Regulation of the leader region terminator controls yvbW expression; (b) Under limiting leucine conditions the leader region terminator is inactive. Uncharged tRNA<sup>Leu</sup> stabilizes the antiterminator structure and yvbW expression is induced; (c) Under high leucine conditions, Charged tRNA<sup>Leu</sup> does not stabilize the antiterminator and the leader region terminator is active and a low level of full-length transcript is synthesized</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/7-2270329-six5.png"/></fig><p>[<xref ref-type="bibr" rid="scirp.47407-ref8">8</xref>] -[<xref ref-type="bibr" rid="scirp.47407-ref10">10</xref>] or has been predicted based on the physiology of the gene; for instance tRNA synthetase genes and amino acid biosynthesis genes are regulated by their cognate amino acid class. When the amino acid class can not be determined by the physiology of the T box gene (for instance with transporters or hypothetical ORFs), the amino acid specificity can be determined by the cumulative analysis of several factors. The position of primary sequence and secondary structural elements relative to the specifier loop allow for the predictive identification of the corresponding specifier sequence codon and hence, the identity of the amino acid limitation signal for induced expression. This determination can also be supported with covariance between the T box variable base and the cognate tRNA discriminator base. In many cases, the amino acid signal can be utilized to assist in the determination of the function of an uncharacterized gene such as Bacillus subtilis hypothetical amino acid permease, yvbW.</p><p>In 2008, Wels et al. and Vitreschak et al. used in silico analysis and alignments of T box genes that lacked a clear physiological correlation with an amino acid class, and compared these sequences with T box genes that had a correlation with an amino acid class [<xref ref-type="bibr" rid="scirp.47407-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref12">12</xref>] . Using these data, B. subtilis hypothetical amino acid permease, yvbW, was predicted to be regulated by leucine limitation suggesting YvbW may participate in the transport of leucine [<xref ref-type="bibr" rid="scirp.47407-ref11">11</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref12">12</xref>] . In a study by Irnov et al., [<xref ref-type="bibr" rid="scirp.47407-ref13">13</xref>] yvbW was annotated as responding to tryptophan limitation. In this study, we will present the conserved primary sequence and secondary structural model of yvbW, supporting regulation by leucine limitation. Folding of the yvbW leader sequence suggested a CUC leucine specifier sequence. In a recent study by Saad et al. [<xref ref-type="bibr" rid="scirp.47407-ref10">10</xref>] , the Clostridium acetobutylicum gatCAB operon was demonstrated to respond to two adjacent specifier sequence codons and two separate amino acid signals. Two additional specifier codon possibilities in the yvbW specifier loop were identified as a UGC serine codon or a GCG arginine codon. A yvbW-lacZ transcriptional fusion was generated [<xref ref-type="bibr" rid="scirp.47407-ref14">14</xref>] . The transcriptional fusion was moved into B. subtilis strains auxotrophic for leucine, serine and arginine. These auxotrophic strains grew on minimal media with limiting concentrations of leucine, serine and arginine, respectively. Induced expression was observed only under limiting leucine conditions and not for serine and arginine limiting conditions. The induction ratio varied between 89 and 130 folds under leucine limiting conditions, compared to growth with excess leucine. By identifying the amino acid specificity of the yvbW gene expression signal, the possible substrate specifity for YvbW transport can be hypothesized. The most logical substrate would be leucine or a biosynthetic precursor for leucine biosynthesis. A yvbW knockout strain was generated and tested under limiting leucine conditions. No growth phenotype was observed for the yvbW knockout strain.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Bacterial Strains and Growth Conditions</title><p>Escherichia coli cloning strain DH5α was maintained in at 37˚C in Luria-Bertani media and B. subtilis strains were maintained at 37˚C in tryptose blood agar base (Difco) or 2xYT broth. Ampicillin (50 &#181;g/ml) was used to select for the maintenance of plasmid pFG328 derivatives in E. coli. B. subtilis strains ZB307A (SPβc- 2del2::Tn917::pSK10∆6) [<xref ref-type="bibr" rid="scirp.47407-ref15">15</xref>] and ZB449 (trpC2 pheA1 abrB703; SPβ cured) [<xref ref-type="bibr" rid="scirp.47407-ref16">16</xref>] were used for the introduction of yvbW-lacZ transcriptional fusions in single copy into the genomes of B. subtilis auxotrophic strains 1A9 (ald-1 aroG932 leuB8 trpC2), 1A622 [arg(GH)95::Tn917::pSK10Δ6] and 1A621 (serC82::Tn917trpC2) by standard procedures utilizing SPβ transduction as previously described [<xref ref-type="bibr" rid="scirp.47407-ref17">17</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref18">18</xref>] . Chloramphenicol (5 &#181;g/ml) was used to select for maintenance of the prophage.</p><p>The yvbW-lacZ transcriptional fusion was tested by streaking the corresponding auxotrophic strains on defined Spizizen minimal media plates containing X-gal (0.004%), required nutrients and limiting (2 &#181;g/ml) or non-limiting (20 &#181;g/ml) concentrations of the amino acid being tested [<xref ref-type="bibr" rid="scirp.47407-ref19">19</xref>] . Auxotrophic strains 1A9, 1A622 and 1A621 containing transcriptional fusions were tested for leucine, arginine and serine limitation, respectively.</p><p>Strain 1A9 SPβyvbW-lacZ was further tested for leucine limitation in defined Spizizen liquid media with limiting (5 &#181;g/ml) and non-limiting (50 &#181;g/ml) concentrations of leucine. Cultures were grown to early log (approximate A<sub>595</sub> of 0.1) under non-limiting leucine conditions; cultures were split, and cells were collected by centrifugation. Cell pellets were resuspended under limiting and non-limiting leucine conditions. Culture samples were taken at the time of splitting and at 1 hr intervals for four hours. Toluene permeabilized cells were assayed for β-galactosidase activity as described by Miller [<xref ref-type="bibr" rid="scirp.47407-ref20">20</xref>] . Induction experiments were performed in duplicate with multiple 1A9 SPβyvbW-lacZ isolates.</p></sec><sec id="s2_2"><title>2.2. Generation and Testing of the Bacillus subtilis yvbW-lacZ Transcriptional Fusion</title><p>The B. subtilis yvbW leader sequence was obtained from the SubtiList database [<xref ref-type="bibr" rid="scirp.47407-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref22">22</xref>] . Restriction endonucleases and DNA-modifying enzymes were purchased from New England Biolabs and Promega and were used as described by the manufacturer. Oligonucleotides were purchased from DNA International or Genosys Technologies. PCR was performed amplifying the yvbW leader region utilizing B. subtilis BR151 genomic DNA as a template. The oligonucleotides utilized were upstream-CTTTTGG|GGATCC|ATTCGAAAAGGGAC and downstream reverse complement-CCTGCCA|TCTAGA|TCGCTGAGCTGCTCCCC (boldface represents base substitutions required to incorporate BamH I and Xba I sites and vertical lines encompass these sites). The PCR product was digested with BamH I and Xba I and inserted into the plasmid pFG328 [<xref ref-type="bibr" rid="scirp.47407-ref3">3</xref>] generating a lacZ transcriptional fusion. Multiple transcriptional fusion clones were sequenced with a USB Sequenase kit confirming the SubtiList yvbW leader sequence [<xref ref-type="bibr" rid="scirp.47407-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref22">22</xref>] and the integrity of the clones.</p></sec><sec id="s2_3"><title>2.3. Construction of a Bacillus subtilis yvbW Knock-Out Strain</title><p>PCR was performed amplifying an internal fragment of the yvbW coding sequence utilizing B. subtilis BR151MA genomic DNA as a template [<xref ref-type="bibr" rid="scirp.47407-ref23">23</xref>] . The oligonucleotides utilized were upstream-ATGGCTGTTC| GGATCC|GTAACGCCAGAACCTTCCG and downstream reverse complement-AACGGCAGCA|GGTACC| ACGCGACAATCCGTGTCAG (boldface represents base substitutions required to incorporate BamH I and Kpn I sites and vertical lines encompass these sites). The PCR fragment was digested with BamH I and Kpn I and inserted into plasmid pIC156, which lacks a B. subtilis origin of replication [<xref ref-type="bibr" rid="scirp.47407-ref24">24</xref>] . Strains 1A9, 1A490 (gltB1 leuB8 metB10) and BR151MA (lys-3 trpC2) were transformed with the plasmid constructs selecting for spectinomycin resistance (100 &#181;g/ml). The recombination event was confirmed by PCR analysis utilizing oligonucleotides TATAGAGAGAAGAAGTGC (from the yvbW coding sequence, downstream of the homologous fragment) and AGATGTCGCTGCAGAATGGG (from within the spectinomycin resistance gene). Several isolates from each strain were used for growth analysis. Strains 1A9, 1A490 and BR151MA were also transduced with SPβyitJ- lacZ (spcR control; Murphy and Henkin, unpublished construct) to provide spectinomycin-resistant control strains.</p></sec></sec><sec id="s3"><title>3. Results</title>Determination of yvbW Secondary Structural Model and Specifier Sequence<p>The yvbW leader mRNA contains all of the conserved primary sequence and secondary structural elements of the prototypical T box leader (See <xref ref-type="fig" rid="fig2">Figure 2</xref>) [<xref ref-type="bibr" rid="scirp.47407-ref1">1</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref2">2</xref>] . Stem I contains consensus CAGAGA and GGUGNRA sequences, surrounded by consensus secondary sturctural folding with a 13 base-pair helix containing a side bulge, which can be formed directly above the conserved AGUA and GAA sequences of the specifier internal loop. A consensus GA motif is also located below the specifier region [<xref ref-type="bibr" rid="scirp.47407-ref7">7</xref>] . Within the specifier loop is a conserved GAA sequence that contributes to the formation of a common loop E RNA structural motif [<xref ref-type="bibr" rid="scirp.47407-ref25">25</xref>] . Downstream of the GAA, is the sequence CUCGC. A CUC leucine codon is located directly downstream of the GAA, placing the specifier at the consensus position, a single base from the lower helix. The work of Saad et al. [<xref ref-type="bibr" rid="scirp.47407-ref10">10</xref>] demonstrated that the specifier sequence can shift allowing more than one codon to serve as the specifier sequence, thereby two different tRNA amino acid species are able to induce antitermination. Additionally, two alternative yvbW specifier codons were tested. Allowing a single nucleotide between the conserved GAA and the specifier sequence would generate a UCG-serine specifier. This specifier would not follow the specifier C rule. Allowing two nucleotides between the conserved GAA and the specifier sequence would generate a C rule CGC-arginine specifier codon but would require one less base-pair in the lower helix than represented in <xref ref-type="fig" rid="fig2">Figure 2</xref>.</p><p>An amino acid designation can also be supported by the ability of the T box variable base to pair with the discriminator base of the cognate tRNA [<xref ref-type="bibr" rid="scirp.47407-ref4">4</xref>] . Likewise, the identity of the T box variable base may allow specific tRNAs to be excluded from consideration. tRNA<sup>Leu</sup> GAG contains an A discriminator base which can pair with the yvbW U T box variable base, although tRNA<sup>Ser</sup> and tRNA<sup>Arg</sup> amino acid species would allow G-U pairs [<xref ref-type="bibr" rid="scirp.47407-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref22">22</xref>] .</p><p>The cumulative folding, alignment and tRNA compatibility data suggest that yvbW is regulated by leucine limitation. Argine and serine were also considered as secondary possible amino acid signals. These predictions were tested by incorporating a yvbW-lacZ transcriptional fusion into strains auxotrophic for the candidate ami- no acid specificities and testing expression during growth in defined minimal media limiting for the respective</p><fig id="fig2"  position="float"><label><xref ref-type="fig" rid="fig2">Figure 2</xref></label><caption><title> Structural model of the B. subtilis yvbW leader region. The B. subtilis yvbW leader folds into a structure that strongly resembles the consensus model. A CUC-leucine codon is positioned at the consensus specifier location and indicated by boxes (positions 122 - 124). Numbering is relative to the predicted yvbW transcription start site downstream of a TGGACA-17N-TATATT sigma-A promoter. Stems I, II, IIA and III and the T box precede the leader region terminator. A portion of the T box may alternatively base-pair with a conserved primary sequence on the 5’ side of the terminator to form the antiterminator (shown in the top box on the right). A putative pseudoknot is denoted by Stems 2A and 2B [<xref ref-type="bibr" rid="scirp.47407-ref6">6</xref>] . Antiterminator formation allows synthesis of the full-length transcript containing the yvbW coding sequence. Asterisks indicate primary sequence elements conserved in T box family member genes. These elements include GA-I (positions 46 and 47), A (position 53), AGUA-I (positions 56 - 59), CAGAGA (positions 77 - 82), GGUGNRA (positions 93 - 99), GAA (positions 119 - 121), C (third position of the specifier sequence; position 124), GA-II (positions 131 and 132), GAAC (positions 144 - 147), AGUA-II (yvbW lacks this element), F box (CCGUUA, positions 189 - 194), AG (positions 206 - 207), T box (AGGGUGGNACCGCG, positions 230 - 243; yvbW lacks the G at position 232, and the anti-T box (UCGUCCCU, positions 258 - 265; yvbW lacks the consensus C at position 263 but covaries with the T box variant), AGGCGGCG, positions 291 - 298 (yvbW lacks the consensus G at position 293 but covaries with the anti-T box variant)</title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/7-2270329-six6.png"/></fig><p>amino acids [<xref ref-type="bibr" rid="scirp.47407-ref19">19</xref>] . Transcriptional fusions were initially tested by streaking strains auxotrophic for arginine, leucine and serine on defined minimal media plates containing the full complement of amino acids or limited for the respective amino acids. The fusions tested in serine and arginine auxotrophic strains exhibited no induction of expression via β-galactosidase activity. Only the leucine auxotroph exhibited induced expression under conditions limiting for leucine. Expression was quantified by β-galactosidase assays of the leucine auxotroph grown in defined liquid minimal media with limiting and non-limiting concentrations of leucine (<xref ref-type="fig" rid="fig3">Figure 3</xref> and <xref ref-type="table" rid="table1">Table 1</xref>). These data indicate yvbW expression is induced 110-fold after 1 hr of leucine limitation. Induction ratios ranged from 89 to 130 fold over a four hour period. These data suggest YvbW may transport leucine or a compound related to leucine metabolism.</p><p>To further test the possible function of YvbW, a strain in which the yvbW gene was inactivated by insertion of a spc cassette was generated. Strains 1A9 yvbW::spc and 1A9 SPβ yitJ-lacZ (spcR control) were grown on defined minimal media containing the required amino acids at 50 &#181;g/ml and leucine at 5 &#181;g/ml to induce expression</p><fig id="fig3"  position="float"><label><xref ref-type="fig" rid="fig3">Figure 3</xref></label><caption><title> Expression of a B. subtilis yvbW-lacZ transcriptional fusion in a leucine auxotroph grown under excess or limiting concentrations of leucine. A B. subtilis yvbW-lacZ transcriptional fusion was tested in leucine auxotroph 1A9. Cultures were grown in defined Spizizen minimal media [<xref ref-type="bibr" rid="scirp.47407-ref19">19</xref>] containing 50 &#181;g/ml leucine and split at early logarithmic growth. Subsequently, cultures were grown with 5 &#181;g/ml (−leucine) or 50 &#181;g/ml leucine (+leucine). Samples were taken at 1 hr intervals and assayed for β-galactosidase activity [<xref ref-type="bibr" rid="scirp.47407-ref20">20</xref>] </title></caption><graphic mimetype="image"   position="float"  xlink:type="simple"  xlink:href="http://html.scirp.org/file/7-2270329-six7.png"/></fig><table-wrap id="table1" ><label><xref ref-type="table" rid="table1">Table 1</xref></label><caption><title> Expression of a B. subtilis yvbW-lacZ transcriptional fusion under excess or limiting leucine conditions. A yvbW-lacZ transcriptional fusion in B. subtilis leucine auxotrophic strain 1A9 was grown in defined Spizizen minimal media [<xref ref-type="bibr" rid="scirp.47407-ref19">19</xref>] containing 50 &#181;g/ml leucine and split during early logarithmic growth. Subsequently, cultures were grown with 5 &#181;g/ml (limiting leucine) or 50 &#181;g/ml leucine (excess leucine). Culture samples were taken at 1 hr intervals and assayed for β-galactosidase activity [<xref ref-type="bibr" rid="scirp.47407-ref20">20</xref>] . Data recorded in Miller β-galactosidase units [<xref ref-type="bibr" rid="scirp.47407-ref20">20</xref>] . The induction ratio is the β-galactosidase activity value under induced conditions divided by the uninduced condition value. Multiple isolates of yvbW-lacZ 1A9 were tested in 3 independent trials. Data was analyzed utilizing a paired student’s T-test. Comparisons at each tested time point produced p-values below 0.001</title></caption><table><tbody><thead><tr><th align="center" valign="middle" >Time</th><th align="center" valign="middle" >Limiting leucine</th><th align="center" valign="middle" >Excess leucine</th><th align="center" valign="middle" >Induction Ratio</th></tr></thead><tr><td align="center" valign="middle" >1 hr</td><td align="center" valign="middle" >0.18</td><td align="center" valign="middle" >20</td><td align="center" valign="middle" >110</td></tr><tr><td align="center" valign="middle" >2 hr</td><td align="center" valign="middle" >0.20</td><td align="center" valign="middle" >26</td><td align="center" valign="middle" >130</td></tr><tr><td align="center" valign="middle" >3 hr</td><td align="center" valign="middle" >0.25</td><td align="center" valign="middle" >29</td><td align="center" valign="middle" >116</td></tr><tr><td align="center" valign="middle" >4 hr</td><td align="center" valign="middle" >0.35</td><td align="center" valign="middle" >31</td><td align="center" valign="middle" >89</td></tr></tbody></table></table-wrap><p>of the yvbW gene in the control strain. No difference in growth was observed between the yvbW knockout strain and the control strain. These strains were also tested for resistance to the leucine analog 4-aza-leucine (Sigma) [<xref ref-type="bibr" rid="scirp.47407-ref26">26</xref>] . Spizizen minimal media (leucine at 5 &#181;g/ml) was supplemented with 2, 20 and 200 &#181;g/ml 4-aza-leucine and growth curves were monitored. Again, no difference in growth was noted.</p><p>These results are inconclusive for the substrate specificity of YvbW. Alternatively, glutamate is utilized as an amine donor in the final step of leucine, isoleucine and valine biosynthesis; therefore glutamate is also a potential substrate for YvbW transport. Several additional transporters with putative substrate specificity for leucine and glutamate have also been identified in B. subtilis, suggesting a functional redundancy [<xref ref-type="bibr" rid="scirp.47407-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref26">26</xref>] . It is also possible that YvbW may transport valine, isoleucine or one of their precursors, which could be converted to leucine.</p></sec><sec id="s4"><title>4. Disscusion</title><p>Many uncharacterized genes and operons have been identified as downstream of T box leaders. These ORFs include a number of proteins likely to participate in tRNA aminoacylation, amino acid biosynthesis and amino acid transport. Transporters are the most prevalent class of proteins identified within the B. subtilis genome, representing approximately 2% of the ORFs [<xref ref-type="bibr" rid="scirp.47407-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref22">22</xref>] . Despite their abundance, this class of proteins remains one of the least understood one. Amino acid biosynthesis genes also represent a widespread group of genes that present many questions. In many cases, some characteristics of the enzyme may be known but the full function is not understood. For example an enzyme may interconvert two amino acids or represent a biosynthetic branch point but the general direction of the catalyzed reaction may not be known. The T box system allows regulatory predictions to be made based on the specificity of the leader region sequence. These data can be used to identify potential transporter substrates or the physiological role of an amino acid biosynthesis gene.</p><p>yvbW has been demonstrated to be transcribed as a monocistronic mRNA that contains a prototypical T box antitermination leader [<xref ref-type="bibr" rid="scirp.47407-ref13">13</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref27">27</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref28">28</xref>] (<xref ref-type="fig" rid="fig1">Figure 1</xref> and <xref ref-type="fig" rid="fig2">Figure 2</xref>). YvbW is annotated as a hypothetical amino acid permease, although the amino acid specificity was not defined [<xref ref-type="bibr" rid="scirp.47407-ref29">29</xref>] . The protein with the highest identity alignment (32%) is gamma-aminobutyrate permease (GabP) from B. subtilis. Expression of gabP was shown to be induced by nitrogen limitation and complemented an E. coli gabP deficient strain [<xref ref-type="bibr" rid="scirp.47407-ref30">30</xref>] . Despite the complementation results, a difference in substrate specificity between the two proteins was identified. Unlike E. coli GabP, the B. subtilis protein was shown to transport β-alanine (3 carbon) and gamma-amino butyrate (4 carbon) with similar efficiencies and was resistant to larger analogs that bind and inhibit GABA transporters of the brain [<xref ref-type="bibr" rid="scirp.47407-ref31">31</xref>] .</p><p>These results are inconclusive for the substrate specificity of YvbW. Alternatively, glutamate is utilized as an amine donor in the final step of leucine, isoleucine and valine biosynthesis; therefore it is also a potential substrate for YvbW transport. Several additional transporters with putative substrate specificity for leucine and glutamate have also been identified in B. subtilis, suggesting a functional redundancy [<xref ref-type="bibr" rid="scirp.47407-ref21">21</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref22">22</xref>] [<xref ref-type="bibr" rid="scirp.47407-ref26">26</xref>] . It is also possible that YvbW may transport a precursor for leucine, isoleucine, valine or glutamate biosynthesis.</p><p>With the proliferation of bacterial genomic analysis, the study of gene expression and regulation has become a logical extension of this research. T box leaders allow for in silico predictions of gene regulation in response to environmental conditions. Regulatory predictions can be made suggesting gene expression in response to specific amino acid limitation. As regulatory sequences become incorporated into the annotation of genomes, the analysis of T box regulatory sequences may contribute to the study of uncharacterized amino acid biosynthesis pathways and identifying transporter substrates.</p></sec><sec id="s5"><title>Acknowledgements</title><p>Thank you to Tina M. Henkin and Frank J. Grundy for training and research support. Auxotrophic strains were obtained from the Bacillus Genetic Stock Center at The Ohio State University.</p></sec></body><back><ref-list><title>References</title><ref id="scirp.47407-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Green, N.J., Grundy, F.J. and Henkin, T.M. (2010) The T Box Mechanism: tRNA as a Regulatory Molecule. FEBS Letters, 584, 318-324. http://dx.doi.org/10.1016/j.febslet.2009.11.056</mixed-citation></ref><ref id="scirp.47407-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Gutiérrez-Preciado, A., Henkin, T.M., Grundy, F.J., Yanofsky, C. and Merino, E. (2009) Biochemical Features and Functional Implications of the RNA-Based T-Box Regulatory Mechanism. Microbiology and Molecular Biology Reviews, 73, 36-61. http://dx.doi.org/10.1128/MMBR.00026-08</mixed-citation></ref><ref id="scirp.47407-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">Grundy, F.J. and Henkin, T.M. (1993) tRNA as a Positive Regulator of Transcription Antitermination in B. subtilis. Cell, 74, 475-482. http://dx.doi.org/10.1016/0092-8674(93)80049-K</mixed-citation></ref><ref id="scirp.47407-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">Grundy, F.J., Rollins, S.M. and Henkin, T.M. (1994) Interaction between the Acceptor end of tRNA and the T Box Stimulates Antitermination in the Bacillus subtilis tyrS Gene: A New Role for the Discriminator Base. Journal of Bacteriology, 176, 4518-4526.</mixed-citation></ref><ref id="scirp.47407-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">Grigg, J.C., Chen, Y., Grundy, F.J., Henkin, T.M., Pollack, L. and Ke, A. (2013) T Box RNA Decodes both the Information Content and Geometry of tRNA to Affect Gene Expression. Proceedings of the National Academy of Sciences of the United States of America, 110, 7240-7245. &lt;br&gt;http://dx.doi.org/10.1073/pnas.1222214110</mixed-citation></ref><ref id="scirp.47407-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Rollins, S.M., Grundy, F.J. and Henkin, T.M. (1997) Analysis of cis-Acting Sequence and Structural Elements Required for Antitermination of the Bacillus subtilis tyrS Gene. Molecular Microbiology, 25, 411-421.  
http://dx.doi.org/10.1046/j.1365-2958.1997.4851839.x</mixed-citation></ref><ref id="scirp.47407-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Winkler, W.C., Grundy, F.J., Murphy, B.A. and Henkin, T.M. (2001) The GA Motif: An RNA Element Common to Bacterial Antitermination Systems, rRNA, and Eukaryotic RNAs. RNA, 7, 1165-1172. 
http://dx.doi.org/10.1017/S1355838201002370</mixed-citation></ref><ref id="scirp.47407-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">Putzer, H., Gendron, N. and Grunberg-Manago, M. (1992) Coordinate Expression of the Two Threonyl-tRNA Synthetase Genes in Bacillus subtilis: Control by Transcriptional Antitermination Involving a Conserved Regulatory Sequence. The EMBO Journal, 11, 3117-3127.</mixed-citation></ref><ref id="scirp.47407-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Yousef, M.R., Grundy, F.J. and Henkin, T.M. (2003) tRNA Requirements for glyQS Antitermination: A New Twist on tRNA. RNA, 9, 1148-1156. http://dx.doi.org/10.1261/rna.5540203</mixed-citation></ref><ref id="scirp.47407-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Saad, N.Y., Stamatopoulou, V., Brayé, M., Drainas, D., Stathopoulos, C. and Becker, H.D. (2013) Two-Codon T-Box Riboswitch Binding Two tRNAs. Proceedings of the National Academy of Sciences of the United States of America, 110, 12756-127561. http://dx.doi.org/10.1073/pnas.1304307110</mixed-citation></ref><ref id="scirp.47407-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Wels, M., Groot Kormelink, T., Kleerebezem, M., Siezen, R.J. and Francke, C. (2008) An in Silico Analysis of T-Box Regulated Genes and T-Box Evolution in Prokaryotes, with Emphasis on Prediction of Substrate Specificity of Transporters. BMC Genomics, 9, 330. http://dx.doi.org/10.1186/1471-2164-9-330</mixed-citation></ref><ref id="scirp.47407-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Vitreschak, A.G., Mironov, A.A., Lyubetsky, V.A. and Gelfand, M.S. (2008) Comparative Genomic Analysis of T-Box Regulatory Systems in Bacteria. RNA, 14, 717-735. &lt;br&gt;http://dx.doi.org/10.1261/rna.819308</mixed-citation></ref><ref id="scirp.47407-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Irnov I., Sharma, C.M., Vogel, J. and Winkler, W.C. (2010) Identification of Regulatory RNAs in Bacillus subtilis. Nucleic Acids Research, 38, 6637-6651. http://dx.doi.org/10.1093/nar/gkq454</mixed-citation></ref><ref id="scirp.47407-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">Henkin, T.M. (2009) Analysis of tRNA-Directed Transcription Antitermination in the T box System in Vivo. Methods in Molecular Biology, 540, 281-290. http://dx.doi.org/10.1007/978-1-59745-558-9_20</mixed-citation></ref><ref id="scirp.47407-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Zuber, P. and Losick, R. (1987) Role of AbrB in Spo0A- and Spo0B-Dependent Utilization of a Sporulation Promoter in Bacillus subtilis. Journal of Bacteriology, 169, 2223-2230.</mixed-citation></ref><ref id="scirp.47407-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Nakano, M.M. and Zuber, P. (1989) Cloning and Characterization of srfB, a Regulatory Gene Involved in Surfactin Production and Competence in Bacillus subtilis. Journal of Bacteriology, 171, 5347-5353.</mixed-citation></ref><ref id="scirp.47407-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Henkin, T.M., Glass, B.L. and Grundy, F.J. (1992) Analysis of the Bacillus subtilis tyrS Gene: Conservation of a Regulatory Sequence in Multiple tRNA Synthetase Genes. Journal of Bacteriology, 174, 1299-1306.</mixed-citation></ref><ref id="scirp.47407-ref18"><label>18</label><mixed-citation publication-type="other" xlink:type="simple">Zeigler, D.R. (2013) Bacillus Genetic Stock Center. http://www.bgsc.org/</mixed-citation></ref><ref id="scirp.47407-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Anagnostopoulos, C. and Spizizen, J. (1961) Requirements for Transformation in Bacillus subtilis. Journal of Bacteriology, 81, 741-746.</mixed-citation></ref><ref id="scirp.47407-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Miller, J. (1972) Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York.</mixed-citation></ref><ref id="scirp.47407-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Barbe, V., Cruveiller, S., Kunst, F., Lenoble, P., Meurice, G., Sekowska, A., Vallenet, D., Wang, T., Moszer, I., Médigue, C. and Danchin, A. (2009) From a Consortium Sequence to a Unified Sequence: The Bacillus subtilis 168 Reference Genome a Decade Later. Microbiology, 155, 1758-1775. http://dx.doi.org/10.1099/mic.0.027839-0</mixed-citation></ref><ref id="scirp.47407-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Kunst, F., Ogasawara, N., Moszer, I., Albertini, A.M., Alloni, G., Azevedo, V., Bertero, M.G., Bessières, P., Bolotin, A., Borchert, S., Borriss, R., Boursier, L., Brans, A., Braun, M., Brignell, S.C., Bron, S., Brouillet, S., Bruschi, C.V., Caldwell, B., Capuano, V., Carter, N.M., Choi, S.K., Codani, J.J., Connerton, I.F., Danchin, A., et al. (1997) The Complete Genome Sequence of the Gram-Positive Bacterium Bacillus subtilis. Nature (London), 390, 249-256. 
http://dx.doi.org/10.1038/36786</mixed-citation></ref><ref id="scirp.47407-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Grundy, F.J. and Henkin, T.M. (1991) The rpsD Gene, Encoding Ribosomal Protein S4, Is Autogenously Regulated in Bacillus subtilis. Journal of Bacteriology, 173, 4595-4602.</mixed-citation></ref><ref id="scirp.47407-ref24"><label>24</label><mixed-citation publication-type="other" xlink:type="simple">Steinmetz, M. and Richter, R. (1994) Plasmids Designed to Alter the Antibiotic Resistance Expressed by Insertion Mutations in Bacillus subtilis, through in Vivo Recombination. Gene, 142, 79-83. 
http://dx.doi.org/10.1016/0378-1119(94)90358-1</mixed-citation></ref><ref id="scirp.47407-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Wang, J., Henkin, T.M. and Nikonowicz, E.P. (2010) NMR Structure and Dynamics of the Specifier Loop Domain from the Bacillus subtilis tyrS T Box Leader RNA. Nucleic Acids Research, 38, 3388-3398. 
http://dx.doi.org/10.1093/nar/gkq020</mixed-citation></ref><ref id="scirp.47407-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Belitsky, B.R., Gustafsson, M.C.U., Sonenshein, A.L. and Von Wachenfeldt, C. (1997) An lrp-Like Gene of Bacillus subtilis Involved in Branched-Chain Amino Acid Transport. Journal of Bacteriology, 179, 5448-5457.</mixed-citation></ref><ref id="scirp.47407-ref27"><label>27</label><mixed-citation publication-type="other" xlink:type="simple">Nicolas, P., Mader, U., Dervyn, E., Rochat, T., Leduc, A., Pigeonneau, N., Bidnenko, E., Marchadier, E., Hoebeke, M., Aymerich, S., Becher, D., Bisicchia, P., Botella, E., Delumeau, O., Doherty, G., Denham, E.L., Fogg, M.J., Fromion, V., Goelzer, A., Hansen, A., Hartig, E., Harwood, C.R., Homuth, G., Jarmer, H., Jules, M., Klipp, E., Le Chat, L., Lecointe, F., Lewis, P., Liebermeister, W., March, A., Mars, R.A., Nannapaneni, P., Noone, D., Pohl, S., Rinn, B., Rugheimer, F., Sappa, P.K., Samson, F., Schaffer, M., Schwikowski, B., Steil, L., Stülke, J., Wiegert, T., Devine, K.M., Wilkinson, A.J., van Dijl, J.M., Hecker, M., Volker, U., Bessieres, P. and Noirot, P. (2012) Condition-Dependent Transcriptome Reveals High-Level Regulatory Architecture in Bacillus subtilis. Science, 335, 1103-1106.  
&lt;br&gt;http://dx.doi.org/10.1126/science.1206848</mixed-citation></ref><ref id="scirp.47407-ref28"><label>28</label><mixed-citation publication-type="other" xlink:type="simple">Rasmussen, S., Nielsen, H.B. and Jarmer, H. (2009) The Transcriptionally Active Regions in the Genome of Bacillus subtilis. Molecular Microbiology, 73, 1043-1057. http://dx.doi.org/10.1111/j.1365-2958.2009.06830.x</mixed-citation></ref><ref id="scirp.47407-ref29"><label>29</label><mixed-citation publication-type="other" xlink:type="simple">Chopin, A., Biaudet, V. and Ehrlich, S.D. (1998) Analysis of the Bacillus subtilis Genome Sequence Reveals Nine New T-Box Leaders. Molecular Microbiology, 29, 662-664. &lt;br&gt;http://dx.doi.org/10.1046/j.1365-2958.1998.00912.x</mixed-citation></ref><ref id="scirp.47407-ref30"><label>30</label><mixed-citation publication-type="other" xlink:type="simple">Wray, L.V., Ferson, A.E., Rohrer, K. and Fisher, S.H. (1996) TnrA, a Transcription Factor Required for Global Nitrogen Regulation in Bacillus subtilis. Proceedings of the National Academy of Sciences of the United States of America, 93, 8841-8845. http://dx.doi.org/10.1073/pnas.93.17.8841</mixed-citation></ref><ref id="scirp.47407-ref31"><label>31</label><mixed-citation publication-type="other" xlink:type="simple">Brechtel, C.E. and King, S.C. (1998) 4-Aminobutyrate (GABA) Transporters from the Amine-Polyamine-Choline Superfamily: Substrate Specificity and Ligand Recognition Profile of the 4-Aminobutyrate Permease from Bacillus subtilis. Biochemical Journal, 333, 565-571.</mixed-citation></ref></ref-list></back></article>