BES reactors were made using 2-liter PET (polyethylene terephthalate) bottles as reservoirs for sediment created by mixing freshwater sediment from a fish breeding facility with andosol, zeolite and sand. The bottles were filled with approximately 0.89 L of sediment (equivalent to a depth of approx. 10 cm). The electrodes were made of plain carbon graphite (4 × 5 × 0.7 cm; electrode footprint area: 86 cm²) and insulating wire was affixed to them with electrically conductive epoxy (H20E silver epoxy, Epotek, USA). A modified silicone sealant (SM- 447, Cemedine Co. Ltd., Japan) was applied after the epoxy had dried to protect it and any exposed wire from contact with water or sediment. An electrode was buried at the bottom of the sediment, and tap water with a 1/100 concentration of the basal medium was gently added to a depth of 8.5 cm over the sediment and allowed to permeate the particles overnight. Another electrode was set in the overlying water. The basal medium contained the following material amounts per liter: KH₂PO₄: 0.91 g; Na₂HPO₄∙12H₂O: 2.39 g; NH₄Cl: 0.5 g; MgCl₂∙6H₂O: 0.18 g; mineral solution: 5.0 ml; vitamin solution: 1.0 ml [11] .

The electrodes were connected to a potentiostat (HA-151B, Hokuto Denko Co. Ltd., Japan), and the potential of the buried one was set arbitrarily. The electrode wires were connected with a resistor (1210 W) between them when the BES reactor was used in SMFC mode, and the voltage across the resistor was monitored every 10 min using a data logger. Electrodes that were connected neither via an external circuit nor via a potentiostat were used as a control system. The BES reactors were contained in a hood chamber, and methane gas concentration in the air phase of the reactor was continuously measured using a photoacoustic multi-gas monitor (Model 1312, Innova, Denmark). Total amount of the methane gas emission during experimental period was determined from the methane gas concentration and sampling volume for determination. The BES reactors were installed in a water bath at 30˚C (Figure 1).

Electron recovery in the experiment was calculated on the basis of the amount of acetate decomposed and the amounts of current measured and methane evolved [12] .

Sediment or biofilm that was spread onto the surface of electrodes with a spatula was taken from the reactors and suspended in phosphate buffered saline (PBS). Any loose soil on the electrodes was removed before the biofilm sample was taken. DNA was extracted using the MagNA Pure System (Roche, USA). A MagNA Pure LC DNA Isolation Kit III (Roche, USA) was used according to the manufacturer’s instructions expect for one

modification in which the sample was agitated with a bead crusher (3200 r/min) for 30 sec using 0.1 mm of glass beads after solubilization using a lysis buffer and proteinase K treatment.

PCR amplification of 16S rRNA gene fragments (V4 region) was performed using the primers ad-tag-515F (5’-CGTATCGCCTCCCTCGCGCCATCAGXXXXXX GTGCCAGCMGCCGCGGTAA-3’) and ad-806R (5’- CTATGCGCCTTGCCAGCCCGCTCAG GGACTACHVGGGTWTCTAAT) [13] , where the underlined sequences are adaptors for pyrosequencing and XXXXXX is an arbitrary tag sequence for sample identification [14] .

An AmpliTaq Gold^® DNA Polymerasekit (Life Technologies, California, USA) was used for the PCR reactions. The PCR mixture contained 36.5 μL of sterilized water, 5 μL of PCR buffer, 5 μL of dNTP mix, 1 μL of each of the forward and reverse primers (0.2 μM) and 1.0 μL of genomic DNA. Reactions were held at 95˚C for 10 min to denature the DNA, with amplification proceeding for 28 cycles at 95˚C for 45 s, 55˚C for 60 sand 72˚C for 90 s. A final extension of 10 min at 72˚C was added to ensurecomplete amplification.

A composite sample for sequencing was created by combining equimolar ratios of amplicons from the individual samples followed by gel purification (illustra GFX PCR DNA and Gel Band Purification Kit, GE Healthcare, USA) and ethanol precipitation tore move any remaining contaminants and PCR artifacts.

The mixed amplicons were subjected to pyrosequencing using a Genome Sequencer FLX system at the Dragon Genomics Center (Mie, Japan), and phylogenetic analysis was conducted using the DDBJ 16S rRNA database (Feb. 5, 2013), the Blast program [15] and the RDP classifier ver. 2.3 [16] . An operational taxonomic unit (OTU) was defined as a unique sequence or a group of sequences with sequence homologies of over 97%. Rarefaction analysis was performed using the Esprit program [17] , and sequence alignment was conducted using ClustalX ver. 2.1 [18] . A phylogenetic tree based on the partial sequences obtained and reference strains were constructed using the neighbor-joining method [19] .

The abundance of Geobacteraceae bacteria in the soil was evaluated via quantitative real-time PCR (qPCR) assay using a primer set targeting 16S rRNA genes of bacteria affiliated with the family Geobacteraceae: Geo494F and Geo825R [20] . The Light Cycler system and a Light Cycler DNA Master SYBR Green I kit (Roche Applied Science) were used. As PCR conditions, after initial denaturation at 95˚C for 10 min, the target DNA was amplified in 40 cycles each consisting of denaturation for 5 s at 95˚C, annealing for 5 s at 65˚C and extension for 20 s at 72˚C. Standard curves were generated using seriallydiluted genomic DNA extracted from Geobacter sulfurreducens. The amount of Geobacteraceae DNA (G. sulfurreducens-equivalent value) in the extracted DNA was calculated from the qPCR results, and the ratio of Geobacteraceae DNA to the total of extracted DNA was estimated using the expression Fold Change (FC) = 2^−ΔΔCT. The abundance of Archaea was also evaluated by qPCR assay using a primer set: Ar109f and Ar915r according to the previous study [21] .

The nucleotide sequence data reported here have been deposited on the NCBI Short Read Archive database under accession number DRA001685.

The BES reactors were allowed to acclimatize for 364 days after electrode installation, as a period of around 200 days is needed for ORP values in the sediment to stabilize [10] . During this time, 4.8 mmol of acetate was periodically injected into the vicinity of the working electrode or anode using a needle. Five injections were made before methane gas emissions were determined, and three were made during the determination period.

The temporal progressions of typical performance in each reactor are shown in Figure 2. Methane gas concentration in the gas phase above the reactor gradually increased after acetate injections, and evolution ceased within around eight days. The behavior response of methane gas evolution showed a correlation with current

generation. The concentrations of the methane gas evolved differed in each reactor tested; the value was lower in Reactor D, in which a potential of +300 mV (vs Ag/AgCl) as set at the working electrode, while no reduction of concentration was observed in Reactor B (SMFC mode). Acetate was not detected in the reactor water phases after the end of the 14-day period following acetate injections, when both methane gas evolution and current generation ceased. This implies that the injected acetate had completely decomposed by this time. The methane gas emissions of Reactor D were 36% lower than those of the reactor without electrode installation (Reactor A). Meanwhile, methane gas concentration drastically increased when the electrode potential was set at −200 mV (vs Ag/AgCl) (Reactor C). These results suggest that electrode installation in the sediment and positive potential setting reduced methane gas concentration in the gas phase in the reactor.

The highest current generation was observed in Reactor C, while that seen in SMFC mode (Reactor B) was lower than previously reported values in MFCs, yielding a coulumbic efficiency level of 1% (Table 1). This may have been due to mass transfer limitation and/or corrosion of the electrode used, as the present study continued for around year after electrode installation. Electron recovery in the experiments was calculated from the amount of acetate injected, the amount of current generated and the amount of methane gas evolved (Table 1). In each reactor, most of the electrons donated from acetate were recovered except for those taken up by methane and current, indicating that oxygen respiration and other electron-accepting reactions were predominant in the present experimental system, although Fe³⁺, Mn⁴⁺ and NO³⁻ are also electron acceptor candidates under anaerobic conditions. Electron recovery for the current was approximately 1% in Reactor B, where electrode potential was not artificially set. Current generation was extremely low in SMFC mode in this experimental system.

Although the number varied slightly, approximately 4000 - 8000 reads were obtained for each sample. Around 10,000 representative examples were chosen from the sequences, accounting for more than 97% of identities. Sediment from before the experiment was also analyzed to provide control data.

The results of rarefaction analysis are shown in Figure 3. The read number was not saturated for each sample analyzed, implying that a much more diversified population cloud existed within the samples. The number of representative sequences represents the richness of microbial diversity in the samples, and the most diversified population was observed in the original sediment analyzed before the experiment to provide control data. A secondary diversified population was observed in the non-electrode sample injected with acetate during the same experimental period (Reactor A). The read numbers were lower in the samples from BES reactors B, C and D than those of the control sample and Reactor A, implying that the presence of specific microorganisms on the electrode surface was enriched by electrode installation and potential setting. The levels of enrichment differed among the BES reactors, while richness in diversity showed no correlation with the setting potential. The microbial population was the most accumulated in Reactor C, where potential of −200 mV was applied.

The proportion of clones affiliated to unknown species was high in each sample and particularly high in the control sample, suggesting microbial richness in diversity within the natural sediment used (Figure 4). On the contrary, the microbial population changed drastically depending on experimental conditions including temperature, nutrient (acetate) addition and electrode installation with or without potential setting. These cultivation biases brought about an increase in the proportion of the genera Geobacter and Longilinea. The proportion of Longilinea was 2% - 5% among all BES reactors, while that of Geobacter increased in reactors with buried electrodes (B, C and D), accounting for 37%, 59% and 30% of the total, respectively. The proportion of Geobacter increased to 6% of the total in Reactor A, indicating that acetate addition enriched this genus in the sediment used even without the presence of a buried electrode.

Data were obtained during 15 days of operation after acetate injection (4.8 mmol). ^aCalculated from CH₄ concentration in the gas phase in the hood chamber and the volume of gas continuously sampled for determination; ^bEvaluated with comparison to Reactor A; ^cCurrent values are converted to coulomb equivalents.

Longilinea, an obligate anaerobe belonging to phylum Chloroflexi, is known as a protein decomposer in methanogenic bioreactors [22] . Although it seems to function in granular formation, the function remained unclear in this experimental system. A significant increase in the proportion of Geotoga was observed in the Reactor I sample (13% of the total). The function of this organism was also unclear in the experimental system, as the genus Geotoga is known as a moderate thermophilic carbohydrate-fermenting bacterium [23] . The proportion of methanogenic archaea belonging to the genera Methanobacterium and Methanosarcina was approximately 2% of the total read number.

Sequences affiliated with the family Geobacteraceae contained several major OTUs (more than 100 reads of the total). The phylogenetic relationships linking these OTUs and the reference strains are shown in Figure 5. Although overgrowing Geobacter in the sample of Reactor A (OTU-JBKXN) was affiliated with a distinct cluster comprised of G. grbiciae and G. metallireducens, all other clones were positioned in different clusters of the reference strains. Relatives of G. sulfurreducens, which is a well-characterized EAB with high electricity-generatingcapacity in the presence of acetate [24] , are frequently detected in acetate-fed bioelectrochemical systems [25] -[27] . The Geobacter relatives observed in the present experimental system with freshwater sediment as a microbial source may have been slightly different from species so far reported.

The relative abundances of archaea and Geobacteraceae DNA as a proportion of the total DNA were determined using sediment samples taken from the vicinity of the buried electrodes. It was confirmed that the proportion of archaea was lower in the samples from the BES reactors (Figure 6(a)), with the population decreasing to approximately 1/6 for the electrode set at +300 mV.

The relative abundance of Geobacteraceae populations significantly increased in the vicinity of the buried electrodes (Figure 6(b)). The ratio was more than 10 times higher in the reactors in which electrodes were buried than in Reactor A with no electrode. This suggests that electrode installation in the sediment brought about the enrichment of Geobacteraceae, which plays an important role in electricity generation.