<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJPS</journal-id><journal-title-group><journal-title>American Journal of Plant Sciences</journal-title></journal-title-group><issn pub-type="epub">2158-2742</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajps.2013.412296</article-id><article-id pub-id-type="publisher-id">AJPS-41043</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Construction of a Constitutively Activated Gα Mutant in the Maize Pathogen &lt;i&gt;Cochliobolus heterostrophus&lt;/i&gt;
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>fir</surname><given-names>Degani</given-names></name><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><author-notes><corresp id="cor1">* E-mail:<email>d-ofir@bezeqint.net, ofird@telhai.ac.il</email>;<email>Tel-Hai College, Upper Galilee, Israel; 
2Migal—Galilee Research Institute, Kiryat Shmona, Israel</email>;</corresp></author-notes><pub-date pub-type="epub"><day>21</day><month>11</month><year>2013</year></pub-date><volume>04</volume><issue>12</issue><fpage>2394</fpage><lpage>2399</lpage><history><date date-type="received"><day>October</day>	<month>18th,</month>	<year>2013</year></date><date date-type="rev-recd"><day>November</day>	<month>17th,</month>	<year>2013</year>	</date><date date-type="accepted"><day>November</day>	<month>28th,</month>	<year>2013</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
   Conserved eukaryotic signaling proteins participate in development and disease in plant pathogenic fungi. Mutants in CGA1, a heterotrimeric G protein Ga subunit gene of the maize pathogen Cochliobolus heterostrophus, are defective in several developmental pathways. Conidia from CGA1 mutants germinate as abnormal, straight-growing germ tubes that form few appressoria, and the mutants are female-sterile. The CGA1, Gα subunit, is also thought to act as a down regulator of hydrophobin expression and secretion in this fungus and in related Ascomycete species. Although cga1 mutants can cause normal lesions on plants there are host physiology conditions under which full virulence requires signal transduction through CGA1-mediated pathways. A Gα activated mutant, cga1<sup>Q204L</sup> was created to help establish the role of CGA1 in growth and development, and in mediating hydrophobin secretion and expression. The activated Gα allele was transformed into a cga1 mutant strain. The transgenic lines showed phenotypes resembling the null mutant in development, sporulation and hydrophobicity, indicating a possible role for CGA1 as a stabilizer of these traits.
    <!--?xml:namespace prefix = o /-->
     
 
</p></abstract><kwd-group><kwd>&lt;i&gt;Cochliobolus&lt;/i&gt;; Constitutively Activated; G-Alpha Subunit; G-Protein; Fungal; Signal Transduction</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. Introduction</title><p>Mutants in genes encoding conserved eukaryotic signal transducing proteins have been very helpful in efforts to understand the environmental mediated control of development and the sensory pathways needed to detect the host and establish invasive growth. Several such mutants have been constructed for the maize pathogen Cochliobolus heterostrophus, agent of Southern corn leaf blight [1-4]. In Ascomycetes for which sufficient sequence information is available, there are three Gα encoding genes, one Gβ and one Gγ gene. Deletion of the MAP kinase gene CHK1 [<xref ref-type="bibr" rid="scirp.41043-ref3">3</xref>] or the Gβ gene CGB1 [<xref ref-type="bibr" rid="scirp.41043-ref1">1</xref>] has a vast effect on growth and development and is drastically reducing virulence under all conditions tested. Mutants in CGA1, a heterotrimeric G protein Ga subunit, produce conidia that germinate as abnormal, straight-growing germ tubes forming few appressoria [<xref ref-type="bibr" rid="scirp.41043-ref5">5</xref>]. Nevertheless, these mutants can cause normal lesions on plants, unlike other filamentous fungal plant pathogens in which functional homologues of CGA1 are required for full virulence [<xref ref-type="bibr" rid="scirp.41043-ref2">2</xref>]. This demonstrates that appressorium formation is not essential for virulence. Indeed, inoculation with mycelium results in growth on the leaf surface followed by penetration into the leaf without noticeable appressorium formation: sometimes aggregates of mycelia localize to stomatal apertures, but it seems that direct penetration of the epidermis is also possible. Detailed examination indicated that under some host physiology conditions, CGA1 disruption and deletion mutants are considerably less virulent [<xref ref-type="bibr" rid="scirp.41043-ref6">6</xref>]. In addition disruption of the CGA1 gene causes aerial growth formation and spores aggregation that indicates a possible role for CGA1 in regulation of hydrophobin secretion [<xref ref-type="bibr" rid="scirp.41043-ref5">5</xref>]. Determination of Cochliobolus heterostrophus hydrophobins expression in cga1 mutants provided the molecular evidence for the role of CGA1 in suppression of hydrophobins expression [<xref ref-type="bibr" rid="scirp.41043-ref5">5</xref>].</p><p>Although, Gene disruption studies are an efficient way to identify the role of signaling components such as the G-protein subunits and the MAPK cascade, a constant activation of desired genes became, in recent years, a powerful genetic tool to accomplish the information resulting from the disruption experiment and to identify new functions. Site specific mutagenesis (such as Q204-L, G42-R and R178-C) designed to constitutively activate Gα signaling was reported in C. parasitica [<xref ref-type="bibr" rid="scirp.41043-ref7">7</xref>], M. grisea [<xref ref-type="bibr" rid="scirp.41043-ref8">8</xref>], N. crassa [<xref ref-type="bibr" rid="scirp.41043-ref9">9</xref>] and in A. nidulans [<xref ref-type="bibr" rid="scirp.41043-ref10">10</xref>]. Conversion of one of these amino acids abolishes GTPase activity, which in turn would constitutively activate G protein signaling. Here we constructed a constitutively activated Gα allele (cga1<sup>Q204L</sup>) to investigate the role of CGA1 in developmental processes. In particular, we examined its influence on hydrophobin assosiated traits.</p></sec><sec id="s2"><title>2. Materials and Methods</title><sec id="s2_1"><title>2.1. Strains</title><p>Wild type C. heterostrophus strain was C4 (MAT1-2; Tox1 + ATCC 48331; abbreviated in figures as WT C4). Mutant, previously developed [<xref ref-type="bibr" rid="scirp.41043-ref2">2</xref>], in the G protein α subunit gene CGA1 was: C5Dcga1 (MAT1-1 tox-cga1, created by insertion of the hygromycin cassette into the coding region, combined with an 18 bp deletion).</p></sec><sec id="s2_2"><title>2.2. Construction of the Q204L Mutation</title><p>A specific sequence change in the pCGA1-Bar plasmid (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)) was done using primed amplification by the polymerase chain reaction (PCR). The method is based on the amplification of the entire plasmid using primers that include the desired changes. The site directed mutagenesis (Q204L mutation) was done here to change glutamine (Q, coded by cag) to leucine (L, coded by ctg) by replacing the nucleic acid adenine (a) with thymine (t). As result of this point mutation the GTPase activity should be abolished and the CGA1 gene is constantly activated.</p><p>Vector preparation. A plasmid (pCGA1-Bar, 6338 bp, <xref ref-type="fig" rid="fig1">Figure 1</xref>(a)) containing pBluescript (2918 bp), CGA1 gene (2387 bp) and bar expression cassette (1015 bp) for Bialaphos antibiotic resistance, was used as a template for the synthesis of the desirable vector.</p><p>Enzyme restriction reaction. ApaI, BstxI and HindIII were used in order to confirm the construction of the plasmid and the presence of the CGA1 insert. First examination was done by addition of 1 μl ApaI to 2 μl reaction buffer #4 (New England Biolabs) 0.5 μl BSA, 2 μl DNA (pCGA1-Bar plasmid) and 14.5 μl DDW, and incubation at 25˚C for 1 hour. Alternatively, 1 μl BstxI, was added to 2 μl reaction buffer #3 (NEB), 2 μl DNA (pCGA1-Bar plasmid) and 15 μl DDW, and the reaction was incubated at 55˚C for 1 hour. Third examination was done by adding 1μl HindIII to 2 μl reaction buffer #2 (NEB), 2 μl DNA (pCGA1-Bar plasmid) and 15 μl DDW, and incubation at 37˚C for 1 hour (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)).</p><p>Site directed mutagenesis. Site mutagenesis was conducted with “QuikChange<sup>&#174;</sup> site-directed Mutagenesis Kit” (Qiagen) according to the manufacturers protocol. Two complimentary oligonucleotides were synthesized to contain the Q204L mutation. Primers: Q204L forward</p><p>5’ GATGTCGGTGGTCTGCGATCAGAGC 3’ and Q-204L Reverse 5’ GCTCTGATCGCAGACCACCG ACATC 3’ (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a), black frame). The pCGA1-Bar plasmid was used as a template for the reaction.</p><p>Cloning and amplification. The transformation was conducted using XL-1 Blue MRF’ (Stratagene) super competent E. coli cells, suspended in 5 μl LB + Amp: 3 μl DNA, were added to 40 μl XL-1 suspended cells. Heat shock treatment was admitted by incubating cells on ice for 30 minutes, and then transferring them to 42˚C heated bath for 45 seconds. Cells were transferred to regeneration broth containing LB and incubated at 37˚C, for 45 min, then plated on color screening plates and incubated at 37˚C overnight.</p><p>Transformed E. coli colonies selection and verification. Since transformed colonies have selection markers for pBluescript, blue colonies were used as a template for PCR reactions using Bio-X-Act (stratagene) polymerase, with the CGA1 primers: Cga1-f: 5’ GAGTCGCTCGAGCTCCCGC 3’ and the Cga1-r: 5’ GCATAGTATCCGTGGCGCAGG 3’ (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)). DNA fragments length was determined using gel electrophoresis. Size marker ladders were of two types. 5% Hyperladder/lane; HL (Bioline), 2 Log DNA ladder (New England Bioloabs).</p><p>Fungal transformation. Transformation to the WT and the cga1 strains was performed as described previously (Turgeon et al., Molecular and Cellular Biology, 7(9), 1987). Each strain was transformed with linear DNA excised from the plasmid using different restriction enzymes: ApaI, BstxI, or HindIII (DNA kept in 50 &#181;l STC buffer). After first overnight incubation period, an agar over layer, containing bialaphos antibiotics to a final concentration of 100 &#181;g/ml, was added. Plates were incubated for an additional 3 - 8 days at 30˚C in the light, until colonies appeared. Bialaphos resistant colonies were isolated and their DNA was extracted using a “Miniprep” Kit (Qiagen) according to the manufacturers’ protocol. The purified DNA was used for PCR with the primers Cga1-f and Cga1-r or with the primers pairs: Cga1-f/Cga1 B4xho (5’ CCGTTGTTGCCTCCATTAGC 3’) and CGA1-r or Bar-r 5’ GGTACCGGCAGGCTGAAGTC 3’ and Bar-s 5’ CGGCCGTCTGCACCATCG 3’ (Figures 1(a), 2). The sequence of the PCR products was determined (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p></sec></sec><sec id="s3"><title>3. Results</title>cga1<sup>Q204L</sup> Mutation<p>cga1<sup>Q204L</sup> construction and verification. In order to construct a constitutively activated CGA1 mutant we used site-directed mutagenesis (Q204L mutation) to change glutamine to leucine at position 204. A plasmid carrying the CGA1 gene followed by the Bar resistance cassette (pCGA1-Bar, <xref ref-type="fig" rid="fig1">Figure 1</xref>(a)) was used as a template for Site-directed mutagenesis (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a), black frame) and afterward for cloning in E. coli cells. The mutagenesis and the cloning success were verified by PCR amplification of the CGA1 mutated gene and by sequencing. Vectors containing the Q204L mutation were prepared from the plasmid using two unique restriction sites Apa1 or Bstx1 (6 kb linear fragment) or HindIII that excluded the pBluescript vector (3 kb linear fragment) (<xref ref-type="fig" rid="fig1">Figure 1</xref>(b)).</p><p>The plasmid was then transformed into two strains of C. heterostrophus, WT and cga1. The mutated colonies were grown on selective media (CM-Bar) for several transfers. DNA extracted from both strains, cga1 and the WT, was obtained by PCR amplification. Mutant in the background of cga1 was verified by amplifying the transformed sequence using the forward Cga1 B4xho primer, and the Cga1-r reverse primer (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)). Since the cga1 mutation was created by deleting 18 bp upstream to the CGA1 promoter after Xho restriction site and insertion of a hygromicin cassette instead, an unsuccessful transformation will result in the presence of a sole copy of the disrupted CGA1 gene. So a PCR reaction with these primers will result in a 2854 bp product (772 bp CGA1 minus 18 bp of the coding region plus 2100 bp Hyg resisting cassette). Successful transformants are expected to be carrying an additional copy of the complete CGA1 gene, with the point mutation. So the same PCR will produce additional band, 809 bp long, which will allow us to distinguish between successful and unsuccessful transformants (<xref ref-type="fig" rid="fig2">Figure 2</xref>).</p><p>Since the new cga1<sup>Q204L</sup> mutant has two copies of the cga1 gene (the activated one and the original disrupted one) a PCR with the primers Cga1-f and Cga1-r will result in a mixture product of both genes. In other words a mixture of adenine (A) and thymine (T) is expected. Several isolated mutants (WT and cga1 in the background) showed resistance to bialaphos antibiotics, and proved by PCR to have the bar expression cassette together with the CGA1 gene (as shown for the QL18a mutant strain, <xref ref-type="fig" rid="fig2">Figure 2</xref>). Nevertheless, only one mutation, QL18a (CGA1 in the background, created by plasmid digested with Hind III) showed mixture of adenine (A) and thymine (T) in a Cga1-f—Cga1-r PCR reaction product (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p><p>The WT strain transformation with the same linear plasmid led to at least one bar resistance mutant named QL10. This mutant proved by PCR to carry the bar expression cassette and the additional CGA1<sup>Q204L</sup> gene but the resultant products that were sent for sequencing didn’t contain the mixture of adenine (a) and thymine (t) as expected (<xref ref-type="fig" rid="fig3">Figure 3</xref>).</p><p>cga1<sup>Q</sup><sup>204L</sup> phenotype characterization. The cga1<sup>Q204L</sup> mutation strain (QL18a) was characterized by appearance of white aerial hyphae (<xref ref-type="fig" rid="fig4">Figure 4</xref>), a WT proximately sporulation (<xref ref-type="fig" rid="fig5">Figure 5</xref>) but hyphal straight growth, with no apparent appressorium formation (<xref ref-type="fig" rid="fig5">Figure 5</xref>). Interestingly these phenotypes resemble the cga1 phenotypes. A “water drop assay” conducted to test the colony hyphae absorbency phenotype that may indicate hydrophobins secretion pattern (<xref ref-type="fig" rid="fig4">Figure 4</xref>, lower panel). Here also no obvious difference was found between cga1 and the cga1<sup>Q204L</sup> mutants and both strains showed hydrophobic colony surface.</p><p>Former examination showed that cga1 strains have a significant sensitivity to Sorbitol (1M) osmotic stress in comparison to the WT strains [<xref ref-type="bibr" rid="scirp.41043-ref4">4</xref>]. The cga1<sup>Q204L</sup> may show resistance similar to the WT or even more as described in N. crassa [<xref ref-type="bibr" rid="scirp.41043-ref9">9</xref>]. So this trait may provide us with a better insight of the role of cga1 in mediating osmotic</p><p>stress response. Although this expectation, the constantly activated cga1 mutant showed the same sensitivity to Sorbitol (1M) osmotic stress as CGA1 disruption strains (data not shown).</p></sec><sec id="s4"><title>4. Discussion</title><p>In most published works employing activated Gα alleles, it has not been shown, biochemically, that the transgene encodes a protein lacking GTPase activity, or that it activates downstream effectors such as adenylate cyclase (an example is [<xref ref-type="bibr" rid="scirp.41043-ref7">7</xref>]). Such work can support the resulting phenotype conclusion. Nevertheless, phenotypes characterization, based on site specific mutagenesis (such as Q204-L, G42-R and R178-C), designed to constitutively activate Gα signaling, has been widely used to investigate the role of genes encoding heterotrimeric G-protein α subunits (Gα) in filamentous fungi. Constitutively activated mutants in this gene were used to study the Gα’s role in Schizophyllum commune [<xref ref-type="bibr" rid="scirp.41043-ref11">11</xref>], Hypocrea jecorina [<xref ref-type="bibr" rid="scirp.41043-ref12">12</xref>], Ustilago maydis [<xref ref-type="bibr" rid="scirp.41043-ref13">13</xref>], Penicillium chrysogenum [<xref ref-type="bibr" rid="scirp.41043-ref14">14</xref>] and Cryphonectria parasitica [<xref ref-type="bibr" rid="scirp.41043-ref7">7</xref>].</p><p>Comparative analysis of the phenotypic traits exhibited by fungal strains containing null or activated Gα alleles has been used by a number of laboratories to identify putative signaling-related functions [7-10]. Free Gβg may cause a signal in both the Gα null and activated mutant strains and the phenotypic traits of both strains are affected mainly by the manipulated Gα gene. Indeed in some instances phenotypes of the Gα null and activated mutant strains were different. In N. crassa [<xref ref-type="bibr" rid="scirp.41043-ref9">9</xref>] the Gα activated mutant (gna-1<sup>R178C</sup> and gna-1<sup>Q204L</sup>) has longer, abundant aerial hyphae, less conidia per aerial hyphae, greater colony dry weight mass, lower carotenoid secretion, higher cAMP levels and increased sensitivity to heat and hydrogen peroxide-induced oxidative stress than wild-type strains while the null mutant Dgna-1 presents the opposite phenotypes. Furthermore, the permanent activation of Dgna-1 abolished the osmotic sensitivity, the lower extension rate and the female sterility of the null Dgna-1 mutant. In A. nidulans [<xref ref-type="bibr" rid="scirp.41043-ref10">10</xref>], constitutive signaling of α-subunit of G protein (fadA<sup>G</sup><sup>42R</sup>) resulted in proliferation and block of sporulation in contrast to the null mutant (fadA) that was characterized by reduced growth with normal sporulation. Other studies demonstrated that some similar phenotypes result from constant activation or silencing of the Gα subunit. In M. grisea activated and null mutants of the Gα subunit magB exhibited similar phenotypes in terms of reduced conidiation, sexual reproduction and virulence [<xref ref-type="bibr" rid="scirp.41043-ref8">8</xref>]. These findings were supported by a recent work in C. parasitica [<xref ref-type="bibr" rid="scirp.41043-ref7">7</xref>]. Pigmentation, conidiation, and virulence negative regulation were completely compromised in both Gα (cpg-1) null mutant and activated CPG-1 strains (QL and RC). Nevertheless dissimilar responses were identified in the two C. parasitica mutant strains when subjected to a variety of stresses.</p><p>In this work we constructed an activated cga1 allele, Q204L. Although the success of the mutagenesis was proved by PCR and sequencing, this mutant presents similar phenotypes to the null cga1 mutant. These phenotypes include colony growth rate on CM or on CM containing 1.5 M sorbitol (hyper osmotic stress), sporulation, hyphae straight growth, aerial hyphae growth and hydrophobicity. The results were presented here indicating a possible role for CGA1 as a stabilizer of these traits.</p></sec><sec id="s5"><title>5. Acknowledgements</title><p>I am grateful to Dr. Benjamin A. Horwitz (TechnionIsrael Institute of Technology, Israel) for his guidance and much helpful advice. I thank Oren Schaedel for his technical assistance and Dr. Sophie Lev for many helpful suggestions.</p></sec><sec id="s6"><title>REFERENCES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.41043-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">S. Ganem, S. W. Lu, B. N. Lee, D. Y. Chou, R. Hadar, B. G. Turgeon, et al., “G-Protein Beta Subunit of Cochliobolus heterostrophus Involved in Virulence, Asexual and Sexual Reproductive Ability, and Morphogenesis,” Eukaryotic Cell, Vol. 3, No. 6, 2004, pp. 1653-1663. http://dx.doi.org/10.1128/EC.3.6.1653-1663.2004</mixed-citation></ref><ref id="scirp.41043-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">B. A. Horwitz, A. Sharon, S. W. Lu, V. Ritter, T. M. Sandrock, O. C. Yoder, et al., “A G Protein Alpha Subunit from Cochliobolus heterostrophus Involved in Mating and Appressorium Formation,” Fungal Genetics and Biology, Vol. 26, No. 1, 1999, pp. 19-32.http://dx.doi.org/10.1006/fgbi.1998.1094</mixed-citation></ref><ref id="scirp.41043-ref3"><label>3</label><mixed-citation publication-type="other" xlink:type="simple">S. Lev, A. Sharon, R. Hadar, H. Ma and B. A. Horwitz, “A Mitogen-Activated Protein Kinase of the Corn Leaf Pathogen Cochliobolus heterostrophus Is Involved in Conidiation, Appressorium Formation, and Pathogenicity: Diverse Roles for Mitogen-Activated Protein Kinase Homologs in Foliar Pathogens,” Proceedings of the National Academy of Sciences of the United States of America, Vol. 96, No. 23, 1999, pp. 13542-13547.http://dx.doi.org/ 10.1073/pnas.96.23.13542</mixed-citation></ref><ref id="scirp.41043-ref4"><label>4</label><mixed-citation publication-type="other" xlink:type="simple">O. Degani, “Cochliobolus heterostrophus G-Protein Alpha and Beta Subunit Double Mutant Reveals Shared and Distinct Roles in Development and Virulence,” Physiological and Molecular Plant Pathology, Vol. 82, 2013, pp. 35-45. http://dx.doi.org/10.1016/j.pmpp.2013.01.004</mixed-citation></ref><ref id="scirp.41043-ref5"><label>5</label><mixed-citation publication-type="other" xlink:type="simple">O. Degani, S. Lev and M. Ronen, “Hydrophobin Gene Expression in the Maize Pathogen Cochliobolus heterostrophus,” Physiological and Molecular Plant Pathology, Vol. 83, 2013, pp. 25-34.http://dx.doi.org/10.1016/j.pmpp.2013.03.003</mixed-citation></ref><ref id="scirp.41043-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">O. Degani, R. Maor, R. Hadar, A. Sharon and B. A. Horwitz, “Host Physiology and Pathogenic Variation of Cochliobolus heterostrophus Strains with Mutations in the G Protein Alpha Subunit, CGA1,” Applied and Environmental Microbiology, Vol. 70, No. 8, 2004, pp. 5005-5009.http://dx.doi.org/10.1128/AEM.70.8.5005-5009.2004</mixed-citation></ref><ref id="scirp.41043-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">G. C. Segers and D. L. Nuss, “Constitutively Activated Galpha Negatively Regulates Virulence, Reproduction and Hydrophobin Gene Expression in the Chestnut Blight Fungus Cryphonectria parasitica,” Fungal Genetics and Biology, Vol. 38, No. 2, 2003, pp. 198-208. http://dx.doi.org/10.1016/S1087-1845(02)00534-0</mixed-citation></ref><ref id="scirp.41043-ref8"><label>8</label><mixed-citation publication-type="other" xlink:type="simple">E. G. Fang and R. A. Dean, “Site-Directed Mutagenesis of the magB Gene Affects Growth and Development in Magnaporthe grisea,” Molecular Plant-Microbe Interactions, Vol. 13, No. 11, 2000, pp. 1214-1227. http://dx.doi.org/10.1094/MPMI.2000.13.11.1214</mixed-citation></ref><ref id="scirp.41043-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Q. Yang and K. A. Borkovich, “Mutational Activation of a Gαi Causes Uncontrolled Proliferation of Aerial Hyphae and Increased Sensitivity to Heat and Oxidative Stress in Neurospora crassa,” Genetics, Vol. 151, No. 1, 1999, pp. 107-117.</mixed-citation></ref><ref id="scirp.41043-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">J. H. Yu, J. Wieser and T. H. Adams, “The Aspergillus FlbA RGS Domain Protein Antagonizes G Protein Signaling to Block Proliferation and Allow Development,” The EMBO Journal, Vol. 15, No. 19, 1996, pp. 5184-5190.</mixed-citation></ref><ref id="scirp.41043-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">K. Yamagishi, T. Kimura, M. Suzuki and H. Shinmoto, “Suppression of Fruit-Body Formation by Constitutively Active G-Protein α-Subunits ScGP-A and ScGP-C in the Homobasidiomycete Schizophyllum commune,” Microbiology, Vol. 148, No. 9, 2002, pp. 2797-2809.</mixed-citation></ref><ref id="scirp.41043-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">C. Seibel, G. Gremel, R. do Nascimento Silva, A. Schuster, C. P. Kubicek and M. Schmoll, “Light-Dependent Roles of the G-Protein α Subunit GNA1 of Hypocrea jecorina (Anamorph Trichoderma reesei),” BMC Biology, Vol. 7, 2009, p. 58.  http://dx.doi.org/ 10.1186/1741-7007-7-58</mixed-citation></ref><ref id="scirp.41043-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">P. Müller, A. Leibbrandt, H. Teunissen, S. Cubasch, C. Aichinger and R. Kahmann, “The Gβ-Subunit-Encoding Gene bpp1 Controls Cyclic-AMP Signaling in Ustilago maydis,” Eukaryotic Cell, Vol. 3, No. 3, 2004, pp. 806-814. http://dx.doi.org/ 10.1128/EC.3.3.806-814.2004</mixed-citation></ref><ref id="scirp.41043-ref14"><label>14</label><mixed-citation publication-type="other" xlink:type="simple">R. O. García-Rico, F. Fierro, E. Mauriz, A. Gómez, M. á. Fernández-Bodega and J. F. Martín, “The Heterotrimeric Gα Protein Pga1 Regulates Biosynthesis of Penicillin, Chrysogenin and Roquefortine in Penicillium chrysogenum,” Microbiology, Vol. 154, No. 11, 2008, pp. 3567-7358. http://dx.doi.org/ 10.1099/mic.0.2008/019091-0</mixed-citation></ref></ref-list></back></article>