1. INTRODUCTIONThe plant cell wall is one of the first lines of defense against invading pathogens. A strengthening of the cell wall by callose deposition in so called papillae is considered as an important part of the basal plant resistance mechanism against penetration [1]. Callose is a linear polysaccharide, which consists of (1,3)-β-linked glucose monomers with some (1,6)-β-branches [2]. It is synthesized by membrane-bound callose synthases [3], which might be organized in multiprotein complexes [4] and use UDP-glucose as substrate [5]. In Arabidopsis thaliana, 12 callose synthase genes are described [4]. They showed a tissue-specific expression [6], which was also reported from callose synthase genes in wheat [7]. Among the 12 callose synthases in A. thaliana, PMR4 (POWDERY MILDEW RESITANT 4, also called GLUCAN SYNTHASE LIKE 5) is responsible for woundand pathogen-induced callose formation [8,9]. Interestingly, PMR4 did not seem to be required for penetration resistance to powdery mildew in the A. thaliana mlo2 (MILDEW RESISTANCE LOCUS O 2) mutant [10], whereas an inhibition of callose synthesis in a barley (Hordeum vulgare) mlo mutant resulted in an increased powdery mildew penetration [11]. Because callose inhibition studies with wheat (Triticum aestivum) and oat (Avena sativa) show similar effects after callose inhibition [12], it is suggested that callose deposition might have a function in penetration resistance that is more important in monocot than dicot plants. However, we could recently demonstrate that callose deposition can also play a major role in powdery mildew resistance in A. thaliana. The overexpression of PMR4 in A. thaliana led to an early enhanced callose deposition after powdery mildew infection, which conferred complete penetration resistance [3,13]. Based on the scientific and economic importance of powdery mildews and especially Blumeria graminis [14], we wanted to evaluate whether modification of callose biosynthesis would also increase penetration resistance to an adapted powdery mildew in barley.
2. MATERIALS AND METHODS2.1. Transient ExpressionFor barley transformation, we used a binary vector that contains the cassette 35S::PMR4-GFP for overexpression of the A. thaliana callose synthase PMR4 fused to the green fluorescent protein GFP under control of the constitutive cauliflower mosaic virus promoter 35S [3]. As a control, we generated a binary vector for 35S-controlled GFP overexpression. The GFP open reading frame was amplified from pIGPAPA [15] using an NcoI-containing 5’ and a Bst EII-containing 3’ primer. The NcoI-Bst EII-digested GFP fragment was cloned into the likewise prepared vector pCAMBIA3301 (Cambia, Australia), which supplied a 35S promoter element upstream to the GFP cloning site. The primer sequences are: GFP-fw [5’GCCATGGTGAGCAAGGGCGAG] and GFP-rev [5’GGGTGACCTTACTTGTACAGCTCGTCC]. The two vectors were transformed into the bacterium Agrobacterium tumefaciens (strain GV3101). To analyze whether strong powdery mildew resistance could also be induced in crops, we transiently expressed the 35S::PMR4-GFP and 35S::GFP construct in barley leaves. The respective A. tumefaciens suspensions were infiltrated into leaves of 12-day-old barley seedlings (line Algerian-S (CI-16138)) as described for rice [16].
2.2. Barley Leaf Infection and Microscopy24 h post-infiltration, leaves were inoculated with B. graminis f. sp. hordei (Bgh, race CR3) as described for A. thaliana [17] and monitored at 15 h post-inoculation (hpi), when haustorium formation by Bgh indicates successful penetration in this susceptible barley line [18]. Barley as well as the powdery mildew Bgh were cultivated as described in Stein et al. [17]. Leaf samples were mounted between two cover slips in water. Z series were captured with a spinning-disk confocal microscope [19] by using a Leica 63× water-immersion objective. For better visualization of the fungal conidia and hyphae, the samples were stained with propidium iodide. GFP and propidium iodide were excited at 488 nm by using an argon laser. Emission filtering for GFP was done with a 520/50, for propidium iodide with a 570 - 650 nm bandpass filter. 2D projections of Z stacks were produced with ImageJ (Rasband, W.S., US National Institutes of Health, Bethesda, Maryland, USA, http://imagej.nih.gov/ij/, 1997-2011).
3. RESULTS AND DISCUSSIONMicrocopy of infiltrated leaves revealed that the efficiency of A. tumefaciens-mediated transient expression was relatively low. At 24 h post-infiltration, only 1 out of 136 cells (±17 cells) showed a GFP signal in 35S::GFP control leaves, whereas GFP signals were not detectable in leaves infiltrated with the 35S::PMR4-GFP construct before powdery mildew inoculation (Figure 1(a)). The leaves were then inoculated with the barley powdery mildew Bgh. To increase the coincidence of GFP-expression and an infection of the same cell, spore density was set to 65 conidia·mm−2. We determined penetration success by haustoria formation in epidermal cells 15 hpi by using confocal laser-scanning microscopy to additionally identify PMR4-GFPand GFP-expressing cells, which were infected by Bgh. At 15 hpi, GFP-signals also occurred in 35S::PMR4-GFP-infiltrated leaves at sites of attempted fungal penetration (Figure 1(a)). The pattern of the GFP-signal was similar to the signal detected in the A. thaliana 35S::PMR4-GFP mutants after G. cichoracearum infection; a dense core with a surrounding field of lower density [3,13].
Quantification of microscopy images revealed that in untreated barley leaves, 85% of germinated conidia were able to penetrate as determined by haustorium formation, which is in the range of reported penetration rates for Bgh on susceptible barley lines [18,20]. Buffer-infiltration reduced penetration success to 70% (Figure 1(b)). Counting the overall penetration success in A. tumefaciens-infiltrated barley leaves, a difference to bufferinfiltrated leaves was not detectable. Penetration success in cells with distinct PMR4-GFP presence at the site of Bgh penetration was significantly reduced to 36%, whereas simple GFP presence in infected cells did not alter Bgh penetration (Figure 1(b)).
Our results show that modification of callose biosynthesis can increase resistance to adapted powdery mildew in a monocot plant. The basis for the resistance seems to be similar as recently described for A. thaliana, the focal accumulation of the callose synthase at the site of attempted fungal penetration [3]. Interestingly, barley was able to focally accumulate the callose synthase PMR4 from the different, dicot plant species A. thaliana at the fungal penetration site. This suggests that transport mechanisms that are involved in stress-induced callose deposition as a defense response to pathogens might be conserved in plants. A stable overexpression of the callose synthase PMR4 would further improve microscopy, which would help to elucidate these regulatory mechanisms. One aim could be to evaluate whether already known regulatory factors of stress-induced callose biosynthesis, like the GTPase ARFA [21], are also involved in the PMR4-based resistance to powdery mildew in barley. In addition, a stable overexpression of the callose synthase would also facilitate the determination of possible alterations in the cell wall composition.
In A. thaliana, the overexpression of PMR4 induced changes in the noncellulosic monocarbohydrate composition, especially reflected by the increase in the amount
of Glucose [3]. Based on the available barley genome data [22], it would be possible to identify those barley callose synthases that have the highest homology to the stress-induced callose synthase PMR4 from A. thaliana. The identified callose synthase genes would be good candidates for an overexpression in barley and A. thaliana. This could help to further elucidate whether the observed resistance to powdery mildew in A. thaliana and barley is facilitated only by PMR4. The result would support the evaluation of possible molecular breeding strategies for improved powdery mildew resistance in crops, which may only include the callose synthase PMR4 from A. thaliana or additional, species-specific callose synthases.