The prourokinase clone was generated in our previous research. Transfer vector pFBac and E. coli DH10Bac waas purchased from Invitrogen (Hong Kong) Ltd. Sepharose 4B were bought from Pharmacia(Sweden). Anti-prourokinase antibody was a gift from Prof. WeiYan Yue of Institute of Biotechnology (Beijing).

The structure of the KGD-prourokinase was simulated with sgi workstation using Insight II software. Structural simulation was carried out with the data of NMR structure of native human prourokinase (Protein Data Bank, Brookheaven, CA). The Biopolymer module was employed to add the KGDW sequence between the Gly118 and Ile119 sites of prourokinase structure. The Builder module was employed to carry out structural optimization (iterations: 1000; derivative: 0.01).

The multiple steps of polymerase chain reaction method was employed to construct mutant KGD-containing proUK gene. The sequences of the primers were as follows: CCCAA GCTTGATATCATG A (Primer 1, 5’-primer); GACAAG CGGCTTTAGCCA GTCCCCTTTGCCCACCTGCACATA (Primer 2, mutprimer); CTAAAGCCGCTTGTC (Primer 3, complementary to the mut-primer); GTGGCGCTGATCACCC (Primer 4, complementary to the encoding region of 672 - 688 sequence of proUK gene, 3’-primer). Primers 1 and 2 were used to obtain upstream DNA fragment, and Primer 3 and 4 were used to obtain downstream DNA fragment. Then, the above two DNA fragments were mixed and anneled with the Primers 1 and 4 to obtain largemolucular-KGD-containing sequence. Then, by digestion of HindIII and BclI, the above DNA fragment was inserted into the corresponding region of native proUK gene and whole-length KGD-proUK gene could be obtained. The DNA sequencing assay was used to determine the gene structure.

Polyhedrin-fusion vector pFBac, was used as a trasnfer vector. Recombinant transfer vector pFBac-KGD-proUK was constructed by insertion of KGD-proUK gene into BamHI and EcoRI sites among the multiple cloning site of pFBac [12]. The pFBac-KGD-proUK was introduced into E. coli DH10Bac to get recombinant baculovirus DNA inserted with KGD-proUK gene under polyhedrin promoter [13]. The recombinant baculovirus DNA was isolated and transfected into sf9 insect cells and KGD-proUK was expressed transiently in insect cells. By signal peptide, expressed KGD-proUK protein was secreted into culture medium after 5 - 7 days postinfection. The fibrinolytic activtiy assay was used to determine the locus of expressed products.

The culture medium and infected insect cells were collected 5 - 7 days post-infection and condensed. The protein product was purified by fractional precipitation with 0.2 - 0.45 ammonium sulphate and by immunoaffinity chromatography [7]. The immunoaffinity chromatography column was made by coupled anti-proUK antibody to activated sepharose 4B. The homogeneity of purified product was assayed by western-blotting and PAGE electrophoresis.

Specific fibrinolytic activity of KGD-proUK chimera was measured on fibrin plates by comparison with the International Reference Preparation for Urokinase [14]. 1% (w/v) agar solution containing plasminogen-free fibrinogen was prepared. The mixture was immediately transferred to a sterile dish into which 53 uL of 30 U·mL⁻¹ thrombin and 20 uL of 2 U·mL⁻¹ plasminogen were added, respectively. The fibrin plates were mixed gently and cooled to room temperature. Uniform wells were punched and sample was diluted and added to well, respectively. The diameters of these plaques were measured after incubation at 37˚C for 16 h. The content of KGD-proUK was determined by Bradford method [15].

Fresh rabbit blood was anticoagulated with 0.01M sodium citrate (10% v/v), pH 7.4, and centrifuged at 150 g at 25˚C for 10 min. The supernatant was collected as platelet-rich plasma. The protein samples were dissolved in 0.9% NaCl. Platelet-rich plasma, 300 uL, was incubated with 25 uL of various concentrations of protein samples at 37˚C for 2 min before addition of 25 uL of 100 uM adenosine 5’-diphophate. The inhibition of platelet aggregation was determined by light transmission measurement. The IC50 value was calculated by linear regression.

The structural simulation and homology modeling of the KGD-prourokinase chimera was carried out with the sgi-workstation using Insight II-software based on detailed structural information of native prourokinase and the disintegrin barbourin [10]. To protect previous enzymatic activity of prourokinase, foreign KGD-containing motif was designed to introduce between Gly118 site and Ile119 site among Kringle domain which is far away from the proteolytic active region of prourokinase and would not affect previous enzymatic domain structure. The flanking amino acid Trp at the carboxylterminus of KGD-motif was also introduced to help KGD-motif originated from disintegrin barbourin exhibit active conformation. The sinulated structure (Figure 1) of the KGDprourokinase chimera protein demonstrates that the KGDW-peptide introduced between the Gly118 and Ile119 site among Kringle domain of natvie prourokinase lies on the surface of prourokinase molecule and the side-chains of the KGD sequence are extened to the outside of loop structure and exhibits its functional motif to interact with the glycoprotein IIb/IIIa receptor, known as fibrinogen receptor. The structural property of the KGD-containing functional motif provides necessary requirements of recognition and interaction with the glycoprotein IIb/IIIa receptor, known as fibrinogen receptor, on platelet cell surface. On the other side, the other parts of prourokinase, especially enzymatic domain, didn’t change obviously and remained the same as native conformation of prourokinase almostly. Then, Proteolytic activity of prourokinase as a kind of protease to activate plasminogen to plasmin can be still retained. So there is great possibility to obtain a novel multi-functional thrombolytic agent both with potent fibrinolytic activity and also with high anti-thrombosis activity.

Figure 4

at 10 plaque-foming units (pfu) per cell, fibrinolytic activity in the medium was detected at 48 hours post infection (hpi) using fibrin-plate assay. The highest activities, which was obtained at 168 hpi, were estimated to be 1200 IU/10⁶ cells respectively. Fibrinolytic activities remained cell-associated were about 100 IU/10⁶ cells or less, at 168 hpi, as shown in Figure 4. This result also suggested that more than 90% of the expressed recombinant KGD-prourokinase protein was secreted into the culture medium.

Figure 6

and western-blotting assay also (Figure 6). The concentration of purified KGD-prourokinase-containing solution was determined by the Bradford method as described [15] and fibrinolytic activity unit of purified KGD-prourokinase was determined by fibrin-plate assay as described [14]. Based on above data, specific activity of fibrinolysis of recombinant KGD-prourokinase was calculated as 80,000 IU/mg, with the control of native prourokinase, 10,000 IU/mg. The result shows that recombinant KGD-prourokinase retained most of fibrinolytic activity as compared with native prourokinase and the stereo-structure of prourokinase enzymatic region was almost the same as that of native molecule and not affected by foregin Lys-Gly-Asp-motif introduced, which is in agreement with our expectation based on homology modelling and structural simulatin. The inhibitory activity of adenosine 5’-diphosphate-induced human platelet aggregation by the KGD-prourokinase was tested, as shown in Figure 7. Light transmission of ADP-induced platelet aggregation was detected and demonstrate that the KGD-prourokinase shows high platelet aggregation inhibitory activity (data not shown). The IC50 value calculated is about 9.6 uM, while native human prourokinase, under the same conditions, shows no inhibitory activity of the platelet aggregation (Figure 7). The results suggested that the KGDW-motif introduced between the Gly118 site and Ile119 site of native human prourokinase exhibits its functional conformation, and can interact directly with corresponding glycoprotein IIb/IIIa receptor on the platelet cell surface. The potent inhibitory activity of the KGD-prourokinase agrees well with our expectation based on the result of structural simulation of the KGD-motif among chimera protein.