iso e males (of a stock with isogenized third chromosomes marked with ebony) were placed in vials containing Whatman paper saturated with 25 mM ethylmethanesulfonate (EMS) in 1% dextrose for 12 hours. These males were crossed to virgin weak GMR-Z females. Male progeny were scored for modification of the weak GMR-Z phenotype.

Recombination mapping: AJ101 was mapped against the third chromosome P element stocks #13230, 14984, 13372, 14258, 13115, 13114, 15252, 16532, 12803, 13126, 12824, 12868, 12629, 12694, 12719 from the Bloomington Stock Center. The lowest level of recombination was found between AJ101 and stock 13115 (at position 70A8). Deficiency mapping: AJ101 was crossed to 18 overlapping deficiencies spanning the region 69A to 77B. All stocks were acquired from the Bloomington Stock Center. AJ101 failed to complement the stock #3126 (with breakpoints 70D2-3; 71E4-5), as well as the smaller deficiency 8074 (70F4-71E1); all other deficiencies in the area complemented AJ101, narrowing the region of AJ101 to 70F. The available mutant alleles for the genes within this region were tested, including Trl (stocks 12088, 13334), CG9384 (stock 22582), mop (stock 15817), bmm (stocks 25926, 15828), CG13472 (stocks 12790, 15978), gnu (stock 3321), and CG17839 (stocks 19525, 22869). AJ101 failed to complement the CG9384 mutant allele only.

The AJ101 chromosome was balanced over a GFPmarked balancer chromosome, creating the stock AJ101/ TM3 GFP Ser. Adults of this stock were allowed to lay embryos on molasses plates, and the plates examined under a fluorescent dissecting microscope to separate GFP-expressing embryos (heterozygotes) and non-GFP embryos (homozygotes). Separated embryos were allowed to develop into third instar larvae.

Genomic DNA was isolated from homozygous AJ101 larvae. Briefly, larvae were squished in 50 μL of buffer SB (10 mM Tris pH 8.2, 1 mM EDTA pH 8.0, 25 mM NaCl, 200 μg/ml proteinase K), incubated at 25˚C for 30 min, then incubated at 95˚C for 2 min 5 μL of the lysate was added to PCR reactions (GoTaq, Promega) with three sets of primers from the CG9384 gene sequence (set 1: 5’CAGCGCCTGCATTAGTCATA3’, 5’GTTTCGTTCT GCTCCTCGTC3’; set 2: 5’GTAAGGGTGGCAGTGCA AAT3’, 5’TTTCCTTTCAGCGACGAACT- 3’; set 3: 5’A GTCCAAGGTTTGTCGCACG3’, 5’GCTACCACGAC TGCATCTCA3’). DNA was isolated from an agarose gel with the GeneClean III kit (Q-BIOgene), according to manufacturer’s directions. The primers used for PCR were also used for sequencing the three overlapping gene segments.

AGS-BDneo (gift of Lindsey Hutt-Fletcher) is an EBVpositive gastric carcinoma cell line and was maintained in Ham’s F12 medium supplemented with 10% fetal bovine serum, penicillin, streptomycin, fungicide, and 500 μg/ml G418. Cells were transfected with either vector alone or a Gnt-IVb-expressing vector (OriGene SC110257) with FuGene HD transfection reagent (Promega), as per the manufacturer’s instructions. 24 hr. post-transfection, cells were either left uninduced, or were induced into lytic replication by the addition of 20 ng/ml TPA and 3 mM sodium butyrate.

Cells were removed from their culture dishes, washed with PBS, and fixed with 60% acetone in PBS for 10 min. at 4˚C. Cells were washed with PBS/0.5% BSA, and incubated in anti-BMRF1 antibody (Capricorn), diluted 1:200 in Incubation mix (0.3% BSA, 5% goat serum, 0.1% Triton X in PBS) for 1 hr. at room temperature. Cells were washed with PBS/0.5% BSA, and incubated in donkey-anti-mouse-DyLight 488 secondary antibody (Jackson Immunoresearch), diluted 1:400 in Incubation mix, for 1 hr. at room temperature. Cells were washed with PBS/0.5% BSA and resuspended in PBS. Flow cytometry was performed with a Guava easyCyte flow cytometer.

To find genetic modifiers of Z, Drosophila iso e male flies were mutagenized with 25 mM ethylmethanesulfonate (EMS) and crossed to weak GMR-Z females, as detailed in Material and Methods. Over 10,000 male progeny were examined for modification of the weak GMR-Z phenotype. One of the modifiers identified, which we named AJ101, yielded a significant enhancement of the weak GMR-Z phenotype (Figure 1). This enhancement included a flattening of the ommatidia, yielding a smoother eye cuticle (compare Figures 1(D) to 1(F)), and a complete loss of eye pigment.

While AJ101 heterozygotes had no mutant phenotype on their own, the AJ101 mutation was found to be homozygous lethal (data not shown). AJ101 homozygotes died at the third instar larval stage.

To identify the Drosophila gene which corresponded to the AJ101 modifier, we performed recombination mapping. We initially determined that AJ101 resided on the third chromosome, thus we mapped the location of AJ101 against fifteen P element insertions along the third chromosome. This mapping indicated that AJ101 mapped to a location near chromosomal region 70A8 (data not shown). We then crossed AJ101 to eighteen overlapping deficiencies, spanning chromosomal regions 69A to 77B. The lethal AJ101 mutation failed to complement one of these deficiencies, a deficiency with

                          500×              2000×

breakpoints of 70D2-3; 71E4-5 (#3126; see Figure 2). Crosses with smaller deficiencies within these breakpoints narrowed the location of AJ101 to 70F (including #8073, 6551, 8074, 8075, and 24945; Figure 2). Within this area were ten genes for consideration [14]. AJ101 was crossed to available mutant alleles for these genes (Figure 2), and failed to complement a mutation in CG9384. Specifically, we crossed AJ101 to the CG9384 mutant fly line CG9384^EY22766/TM3 Sb¹ Ser¹ (Bloomington stock number 22582). The mutation in this line is due to a P element insertion inserted within the gene, which disrupts the upstream untranslated region at the 5’ end of the mRNA [14]. The resulting AJ101/CG9384^EY22766 trans-heterozygote was lethal at third instar, just as the AJ101 homozygotes were. As AJ101 failed to complement this specific mutation, we confirmed the identity of AJ101 as CG9384.

To identify the genomic alteration that caused the AJ101 mutation, the genomic DNA corresponding to CG9384 was PCR-amplified from AJ101 homozygous larvae and sequenced. A nucleotide mutation was found that would cause a conversion of amino acid 512 from a serine to an asparagine within the CG9384 protein.

CG9384 appears to have one spliced transcript, 1764 nucleotides in length, encoding a 587 amino acid long protein. The transcript contains a 105 nucleotide region that is 70% identical to the human mannosyl (alpha-1,3-) glycoprotein beta-1,4-N-acetylglucosaminyltransferase, isozyme B (also called MGAT4B) [14]. The CG9384 protein is 46% identical (65% with conservative substitutions) across amino acids 120 - 567 to the MGAT4B protein, and contains an N-acetylglucosaminyltransferase-IV (GnT-IV) conserved region from amino acids 99 - 412.

N-acetylglucosaminyltransferases (GnTs) participate

in sugar-chain branch formation within the Golgi apparatus [8,9]. In vertebrates there are six GnTs, which are designated as GnT-I to -VI; these catalyze the transfer of GlcNAc to the core mannose residues of asparaginelinked sugar chains. GnT-IV specifically catalyzes the transfer of GlcNAc from UDP-GlcNAc to the GlcNAc 1 - 2 Man 1 - 3 arm of core oligosaccharide, and forms a GlcNAc 1 - 4 (GlcNAc 1 - 2) Man 1 - 3 structure on the core oligosaccharide [8].

To determine whether altered levels of human Gnt-IVb in a human cell line would impact EBV lytic replication, we overexpressed the human Gnt-IVb gene in AGSBDneo cells (gastric carcinoma cells latently infected with EBV), and assessed the impact upon EBV early lytic replication. The EBV early protein BMRF1 is commonly used as an indicator of EBV early lytic replication (for example [15-17]). Figure 3 shows that when cells overexpressed Gnt-IVb, and were subsequently induced into lytic replication, the cells displayed significantly higher levels of the EBV early lytic protein BMRF1, in a dose-dependent manner.