We present evidence here that abundantly expressed b-catenin-triggered NF-kB-dependent upregulation of inducible nitric oxide synthase(iNOS) found in hepatoma Mahlavu cells (RT-resistant variant designated as RR-Mal), but not in Hep 3B cells (RT-sensitive variant designated as RS-3B) is a key element contribrting to the radioresisitance through the activation of two prominent radioprotective pathways. First, high iNOS expression found in RR-Mal, but not in RS-3B cells was found to perturb calcium homeostasis that triggered ER stress response leading to the overproduction of ER chaperone GRP-78 via robust generation of cleaved ATF-6a (50 kDa) subunits and their nuclear translocation. Meanwhile, both abundantly expressed NF-κB and COX-2 found in RR-Mal cells could also provoke an increased production of PGE2 resulting in robust production of Bcl-2. Interestingly, when RR-Mal cells were treated with PDTC (a NF-κB inhibitor) or celecoxib (a COX-2 inhibitor), a concentration-dependent downregulation of Bcl-2 could be demonstrated implying that Bcl-2 overexpression was indeed mediated through NF-κB/Cox-2/PGE2 pathway. Importantly, we also unveiled that siRNA-mediated silencing of survivin in RR-Mal cells could result in a concomitant downregulation of GRP-78 due to a severe inhibition of ATF-6a (50 kDa) expression. Taken together, our data demonstrate that constitutively overexpressed b-catenin/NF-κB/iNOS and NF-κB/COX-2/PGE2 pathways that overproducing GRP-78, survivin and Bcl-2 expressions are responsible for radioresistance acquisition in RR-Mal cells. Thus, both pathways could be served as potential targets for overcoming radioresistance.
Hepatocellular carcinoma (HCC) is one of the most common visceral neoplasms worldwide and one of the rare human neoplasms etiologically linked to viral factors. Chronic infection with the hepatitis B virus (HBV) and the hepatitis C virus (HCV) have implicated in about 80% of case worldwide [
Surgical resection has been the major treatment modality for HCC, but owing to the lack of early detection markers, HCC is often diagnosed at an advanced stage. For this reason, only a small fraction of patients can qualify for surgery. Chemotherapy remains the major treatment option for HCC, but despite the use of diverse chemotherapeutic compounds and treatment modalities, the survival rate has not improved for more than two decades. Multifaceted mechanisms are probably responsible for the low response rates, primary of which is intrinsic drug resistance [
Ionizing radiation (IR) is a widely used therapy for solid tumor and about 50% of cancer patients in the United States receive radiation therapy [
The major focus of the current study is to identify the genetically endowed radioresistance-associated molecular signatures of an established HCC clonal variant and to shed some lights into the mechanistic pathways that are involved in regulating the expression of these radioresistance effctors.
Two HCC cell lines, Hep3B and Mahlavu used in this study were grown in medium consisting of Dulbecco’s modified Eagle’s medium (Life Technologies, NY) supplemented with 10% (v/v) fetal bovine serum in 5% CO2, 37˚C humidified incubator.
The hepatoma cells (Mahlavu and Hep3B) were subcultured in glass cover slip and the cells were allowed to grow for 3 days before irradiation. The culture media was replaced with HESS buffer before the cells were treated with a linear accelerator (Varian Medical System, Palo Alto, CA, USA) using 6 megavolts of energy with a source-to-target distance of 100 cm. The cells were placed on a 1-cm bolus and treated with a posterior anterior direction portal to allow a 1-cm radiation buildup. A radiation absorption dose of 16 Gy in a single fraction was delivered to the hepatoma cells.
The treated cells were then fixed with 3.7% paraformaldehyde in medium 6 hrs after irradiation. DNA fragmentation was detected by terminal deoxynucleotidly transferase-mediated nick end labeling (TUNEL) using an Apo-BrdU in situ DNA Fragmentation Assay Kit (BioVision, Mountain View, CA) according to vendor’s instructions. Cells were stained for apoptosis using a confocal microscope to determine the percentage of the cells that have undergone programmed cell death.
To measure the production of intracellular NO, HCC cells were cultured in poly-L-lysine coated slides in 3-cm culture dishes. After reaching 80% cell density, cells were incubated with 2 μM DAF-FM diacetate in HEPES for 30 min in the dark and imaged using a Leica SP2 laser scanning confocal microscope (Leica-Microsystems, Mannheim, Germany). To measure cytosolic calcium concentrations, the same set of HCC cells were stained with 2 μmM Fluo-4 to detect mitochondrial and cytosolic calcium, respectively. Fluorescent images of Fluo-4 were obtained. At the end of each experimental period, cells were then mounted on the stage of a Leica SP2 laser scanning confocal microscope. The cells were randomly selected and imaged.
Endogenous Bcl-2 expression in Mahlavu and Hep3B cells was measured using an ELISA kit (Endogen, Woburn, MA). Briefly, 96-well microplates were precoated with a mouse monoclonal antihuman Bcl-2 antibody, and samples (50 L) were diluted 1:1 (v/v) with fluorescein isothiocyanate (FITC)-labeled secondary antibody in triplicate. The plates were incubated for 2 h at room temperature, washed, and followed by horseradish peroxide-labeled anti-FITC antibody. After 30 min incubation, plates were washed, and TMB/peroxide was added for color development. The reaction was stopped with sulfuric acid, and the optical density was measured at 450 nm using a microplate reader (Bio-Rad Laboratories, Philadelphia, PA). A Bcl-2 standard curve was generated to quantitate the amount of Bcl-2 in Units/mg total protein. One unit is defined as the amount of Bcl-2 protein in 1000 lysed cells of an internal control cell line (HL- 60). Intra-assay coefficients of variance were less than 8% in all measurements.
Endogenous PGE2 expression in Mahlavu and Hep3B cells was measured using an ELISA EIA kit (Cayman Chemical Company, MI, USA). Mahlavu and Hep-3B were seeded 1 × 106 in Dulbecco’s Modified Eagle Medium and 10 cm culture dish at 37˚C, 5% CO2 and incubated for 80% confluence. We collected and washed cells 2 - 3 time by 1x PBS solution. We then lysed cell by RIPA Lysis Buffer System (Santa Cruz, Inc.), and the cell lysates were incubated with enzyme immunoassay buffer (contained 50 mM Tri-HCl (ph 7.4), 100 mM NaCl, 1 mM CaCl2, 1 mg/ml D-glucose, 28 M indomethacin) in ice for 30 sec. And centrifuge sample at 1000 g, 4˚C for 15 mins and collecting supernatants for the detection of PGE2 according to vendor’s instructions.
Cells plated at 1 × 106 per 10-cm culture dishes were allowed to grow for 24 hrs at 37˚C in a 5% CO2 incubator and then treated with various concentrations of PDTC (25 to 50 g/ml) and celecoxib (25 to 75 g/ml) for 24 hrs. Protein samples were collected in RIPA buffer (50 mM Tris．HCl pH 7.5, 150 mM sodium chloride, 1 mM EDTA, 1% Triton X-100, 0.25% sodium deoxycholate, 0.1% SDS) containing 50 mM sodium fluoride, 1 mM sodium orthovanadate, 10 mM b-glycerolphosphate and 1x protease inhibitor Cocktail (Sigma-Aldrich, St Louis, MO). Protein concentrations were assayed using Bio-Rad protein Assay Kit (Bio-Rad, Richmond, CA). Protein extracts representing 40μg were separated on a 12% SDS-PAGE gel and electrophoretically transferred to a polyvinylidene difluoride (PVDF) membrane. Membranes were blocked in 5% skim milk powder in TBST solution (Tris-buffered saline containing 0.1% Tween 20) for 1 hr at room temperature followed by incubation with first antibodies against COX-2 (1:500), Grp78 (1:1000), ATF-6 (50 kDa) (1:1000), Bcl-2 (1:1000), Survivin (1:1000) [Sata Cruz Biotech, Santa Cruz, CA]; β-catenin (0.3 g/ml) [Upstate], phosphate-Akt (1:4000) [Epitomics], NFkB (1:5000) [Millipore], iNOS (1:250) [BD Biosciences] and actin (1:10,000) [Sigma-Aldrich, St. Louis, MO]. Following washing with TBST solution, blots were incubated with the appropriate HRP-labelled secondary antibody for 1 hr at room temperature. The antigen-antibody complexes were detected by the enhanced chemiluminescence (ECL) with a chemiluminescence analyzer.
Cell pellet added 200 μl Buffer A [10 mM HEPES (pH 7.9) (Sigma), 10 mM KCl (Sigma), 0.1 mM EDTA, 0.1 mM EGTA (Sigma), 1 mM DTT, 0.5 mM PMSF (Sigma)], mixed gently, and added 6.25 μl 10% NP-40 (Fluka) in ice for 20 minutes (mixed gently every 5 minutes). Then, we used centrifuge at 12,000 rpm in 4˚C for 30 sec and collected supernatants (cytosol fraction) in new Eppendorf. The remined pellets added 50 μl Buffer B [20 mM HEPES (pH 7.9), 0.4 M NaCl (Sigma), 1 mM EDTA, 1 mM EGTA, 1 mM DTT, 1 mM PMSF, 2 g/ml leupeptin (Sigma), 2 g/ml aprotinin (Sigma), 1% protease inhibitor cocktail (Sigma)] vortex strongly for 15 sec in ice for 10 minutes and repeated vortex strongly. Then we used centrifuge at 12,000 rpm in 4˚C for 20 minutes and collected supernatants (nucleus fraction) in new eppendorf. Then the samples were detected by Western blot.
The expression of GRP-78 was ablated in Mahlavu cells with small interfering RNA (siRNA). Iubrief, the target sequence for the human GRP-78 mRNA was 5’- AAGGTTACCCATGCAGTTGTT -3’. The scrambled siRNA sequence was 5’-AAGGTGGTTGTTTTGTTCACT-3’. The GRP-78 and scramble siRNA were inserted into pSUPERIOR vector and transfected into Mahlavu cells and selected the stably transfected cells by antibiotic as previous described [
All data was presented as means ± standard derviation from at least 3 independent experiments and analyzed using Student’s t test. A p value of less than 0.05 was considered statistically significant.
The complexicity of radioresistance acquisition makes it necessary to identify a panel of radioresistance-related effectors rather than a single determinant that may be involved in a radioresistant cancer cell. For this reason, we set out to investigate what may be the possible effectors associated with the radioresistance acquisition of HCC Mahlavu cells (
As revealed in
As also revealed in
sociated with the overexpressions of b-catenin, phosphorylated Akt, iNOS and nuclear NF-κB. These data implicated that b-catenin/NF-κB/iNOS Pathway might be involved. Interestingly, siRNA silencing of survivin on Mahlavu cells caused concomitantly the downregulation of b-catenin implying that survivin expression was modulated by b-catenin through Wnt signaling pathway for which survivin and iNOS were the downstream genes regulated by this pathway.
As revealed in
Statistical data revealed that more than 50% of patients diagnosed with cancer were treated with radiotherapy
(RT) [
Using a pair of p53 non-functional human HCC as cell models with distinct disparity in radioresistance (
Overexpression of Bcl-2 has been established as a molecular marker of radioresistance in a variety of cancer types through its function of forestalling apoptosis during radiotherapy [9-14]. However, whether there is an unifying mechanism for regulating Bcl-2 overexpression among various cancer types is thus far incompletely understood. Based on this premise, we thus set out to identify the possible mechanistic pathways involved that underlying Bcl-2 overexpression. As analogus to other cancer types, radioresistant HCC Mahlavu cells were estimated to have a significantly higher intrinsic Bcl-2 expression (419 ± 7 u/mg) than radiosensitive Hep 3B (22 ± 1 u/mg) cells did (
Survivin, originally identified as a member of the inhibitor-of-apoptosis (IAP) family, is a bifunctional protein that acts as a suppressor of apoptosis and plays a central role in cell division [
In line with the finding that radioresistant HCC Mahlavu cells overexpressed Bcl-2 and survivin, these cells can also uniquely and highly boost their production of glucose-regulated protein 78 (GRP-78) (
This study was supported by grant from Chi-Mei Medical Research Foundation (98CM-TMU-01-01). The editorial assistance of Miss Wei-Ching Lo is greatly appreciated.