Interferon Regulatory Factor-2 (IRF-2) belongs to IRF family, was identified as a mammalian transcription factor involved in Interferon beta (IFN β) gene regulation. Besides that IRF-2 is involved in immunomodulation, hematopoietic differentiation, cell cycle regulation and oncogenesis. We have done molecular sub-cloning and expression of recombinant murine IRF-2 as GST (Glutathione-S-Transferase)- IRF-2 fusion protein in E. coli/XL-1blue cells. Recombinant IRF-2 with GST moiety at N-terminus expressed as GST-IRF-2 (~66 kd) in E. coli along with different low molecular mass degradation products revealed approximately 30, 42, 60 and 62 kd by SDS-PAGE and Western blot, respectively. We further confirm that degradation takes place at C-terminus of the fusion protein not at N-terminus as anti-GST antibody was detecting all bands in the immunoblot. The recombinant IRF-2 was biologically active along with their degradation products in terms of their DNA binding activity as assessed by Electrophoretically Mobility Shift Assay (EMSA). We observed three different molecular mass DNA/protein complexes (1 - 3) with Virus Response Element (VRE) derived from human Interferon IFN β gene and five different molecular mass complexes (1 - 5) with IRF-E motif (GAAAGT) 4 in EMSA gel. GST only expressed from empty vector did not bind to these DNA elements. To confirm that the binding is specific, all complexes were competed out completely when challenged with 100-X fold molar excess of IRF-E oligo under cold competition. It means degradation products along with full-length protein are able to interact with VRE β as well as IRF-E motif. This means degradation products may regulate the target gene (s) activation/repression via interacting with VRE/IRF-E.
IRF-2 is a transcription regulator of virusand IFNinduced signalling pathways, which plays a critical role in antiviral defence, immune response, cell growth regulation and oncogenesis [
Mutational analysis has shown that IRF-2 protein has N-terminal DNA binding domain (DBD) and C-terminal Repression domain (RD) [
Several studies have suggested that IRF-2 is oncogenic in nature. IRF-2 causes cancer when abnormally over expressed or mutated. In Pancreatic tumor, this gene is found to be over expressed [
In the present study, we have done molecular subcloning and expression of recombinant IRF-2 as a GST (Glutathione-S-Transferase)-IRF-2 fusion protein. We demonstrated four different lower molecular mass degradation products along with full length recombinant protein. Furthermore, we have shown that degradation took place at C-terminus. These degradation products are capable for bind with VREβ and IRF-E motif. This means degradation products are biologically active in terms of DNA binding and may influence the target gene(s) expression.
Mouse IRF-2 cDNA (pIRF2.5 Plasmid), pGEM®-T Vector Systems (Promega), pGEX2TK expression plasmid, E. coli DH5α- and XL-1Blue cells for IRF-2 sub-cloning and expression, respectively, forward primer (IRF-2P1: 5’AAGGATCCATGCCGGTGGAACGGATGCGA 3’) and reverse primer (IRF-2P2: 5’AAGGATCCTTAACAGCTCTTGACACGGGC 3’), anti-GST (G7781, Sigma-aldrich, USA) and anti-rabbit IgG-HRP antibodies (A9169, Sigma-aldrich, USA), antiIRF-2 antibody (H-229: sc-13042, Santa Cruz Biotech, USA), Taq DNA polymerase (Stratagene), restriction enzymes, T4 DNA ligase and T4 polynucleotide kinase (New England Biolabs, MBI Fermentas) and molecular biology grade reagents (Sigma Chemicals Co.). The most commonly used molecular biology methods were adopted from the reference [
The PCR products were separated on a 1% agaroseethidium bromide gel, cut out from the gel and purified (Gel Extraction Kit, Qiagen). Two microliters of purified PCR product (~25 ng) was ligated into pGEM-T easy vector (Promega) in the following mix: 2 µl of gel purified IRF-2 ORF, 2 µl pGEMT easy vector (25 ng/µl), 1 µl T4 DNA Ligase (3U/µl), 5 µl ligation buffer (2X) (30 mM Tris-HCl pH 7.8, 10 mM MgCl2, 10 mM DTT, 10 mM ATP, 5% polyethylene glycol). Four microlitres of a ligation mix were added to 200 µl of E. coli/DH5α competent cells and plated onto 100 µg/ml ampicillin containing LB agar plates. White colonies were picked and checked for the presence of the insert by PCR. PCR-positive colonies were grown overnight in 5 ml of 100 µl/ml ampicillin containing LB medium. Plasmids were extracted from bacteria, purified (Miniprep purification Kit, Qiagen) and its insert sequenced commercially on an ABI 377 Automated Sequencer (TCGA, New Delhi) using M13 reverse and forward primers. Chromatograms were then analysed with Chromas software.
The IRF-2 ORF fragment was sub-cloned into pGEX2TK vector at BamHI site after digesting pGEMT-IRF-2 clone with BamHI restriction endonuclease followed by gel purification. Ligation reaction was set up as follows: 5 µl IRF-2 ORF gel purified insert (~ 50 ng), 7 µl pGEX2TK vector (150 ng) BamHI digested, dephosphorylated and gel purified, 1 µl of T4 DNA Ligase (NEB) (400 U/µl), 3 µl ligation buffer (5X) (30 mM Tris-HCl pH 7.8, 10 mM MgCl2, 10 mM DTT, 200 mM ATP, 5% polyethylene glycol). Four microliters of a ligation mix were added to 200 µl of E. coli/ XL-1 blue competent cells and plated onto 100 µl/ ml Ampicillin Containing LB agar plates. Colonies were picked and checked for the presence of the insert by BamHI Restriction digestion.
Five milliliter LB medium containing ampicillin (100 mg/ml) was inoculated with a single colony of pGEXIRF-2 /E. coli XL-1 and grown overnight at 37˚C. 100 ml of the overnight grown culture was used to inoculate another 10 ml LB with appropriate ampicillin and grown for 3 - 4 hours at 37˚C until O.D600 nm reached between 0.6 to 0.8. IPTG (0.5 mM) induction was carried out at 37˚C for 3 hours along with the control (E. coli XL-1 blue cells containing pGEX-2TK vector). Extracts from the equal number of cells (~1.0 O.D600 nm) was prepared and used to assess GST-IRF-2 expression. Cell pellet from 1.0 O.D. volume of each culture was resuspended in 150 ml of water and 50 ml of 4X loading dye (0.06 M Tris Cl, pH.8.0, 2% SDS, 10% Glycerol, 0.025% Bromophenol blue) and subjected to boil in a water bath at 95˚C for 10 minutes. The samples were given a spin at 10 K rpm, RT for 30 seconds and resolved in 10% SDS-PAGE at 100 V for 6 hrs. The gel was stained with Coomassie brilliant blue R250.
IPTG-induced and uninduced E. coli/XL-1blue cells expressing recombinant IRF-2 cell extracts were resolved on 10% SDS-PAGE, electroblot to nitro-cellulose filters, blocked by 5% milk in PBST (PBS with Tween-20), washed by PBST and incubated with anti-GST (1:2000) antibody, washed by PBST, further incubated with antirabbit IgG-HRP secondary antibody (1:3000), washed by PBST and developed by DAB (3,3’-diaminobenzidine)- staining.
Fifty milliliter of the IPTG-induced culture were centrifuged at 5 k rpm for 5 minutes at 4˚C. The cell pellet was washed with 5 ml PBS and resuspended in 5 ml of lysis buffer (10 mM HEPES, pH 7.9; 2 mM EDTA, pH 8.0; 1 mM EGTA 400 mM KCl; 0.1% Triton X-100; 10% glycerol; 1 mM DTT; 1 mM PMSF and 1mg/ml of the protease inhibitors: Aprotinin, Leupeptin and Benzamidine), sonicated on ice at 15 micron amplitude for 15 seconds, repeated six times with intervals of one minute. The extract was clarified by centrifugation at 12 krpm for 5 minutes at 4˚C. The supernatant was aliquoted and stored at –80˚C for further use. Protein concentration of the extract was estimated by Bradford’s reagent.
One picomole of (GAAAGT)4 and VREβ
(5’-GGGAGAAGTGAAAGGGGGAAATTCCTCTGA ATAGAGAGAGGAC-3’) oligonucleotides were
32P-labeled at the 5’ end by using g [32P] ATP and T4 polynucleotide kinase; the labeled oligonucleotide was separated from the free label by Sephadex G-50 spin column. The 32P-labeled oligonucleotide was annealed into the double-stranded oligonucleotide by mixing it with nine pmol of the complementary oligonucleotide. A typical DNA binding reaction contained 2.0 mg of bacterial cell extract, 50 fmol of double stranded 32P(GAAAGT)4 or 32PVREβ (specific activity: 2 – 3 × 106 cpm/pmol) in the reaction buffer (20 mM HEPES, pH 7.9, 0.4 mM EDTA, pH 8.0, 0.4 mM DTT, 5% glycerol) containing 2.0 mg of calf thymus DNA and was incubated at 37˚C for 30 minutes. In cold-competition assay 100 X-fold molar excess of the double stranded (GAAAGT)4 competitors was added in addition. The sample was mixed with loading dye and resolved in 7.5% native polyacrylamide gel ran at 150 V for four hours. The gel was dried on 3-mm filter paper at 80˚C for 1 h, exposed to the phosphor screen and the image was developed in a fujifilm FLA 5000 phosphoimager and pixels per DNAprotein complex and free label were quantitated from the primary TIFF-image by image gauge V2.54 software.