<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article  PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd"><article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article"><front><journal-meta><journal-id journal-id-type="publisher-id">AJMB</journal-id><journal-title-group><journal-title>American Journal of Molecular Biology</journal-title></journal-title-group><issn pub-type="epub">2161-6620</issn><publisher><publisher-name>Scientific Research Publishing</publisher-name></publisher></journal-meta><article-meta><article-id pub-id-type="doi">10.4236/ajmb.2012.22014</article-id><article-id pub-id-type="publisher-id">AJMB-18947</article-id><article-categories><subj-group subj-group-type="heading"><subject>Articles</subject></subj-group><subj-group subj-group-type="Discipline-v2"><subject>Biomedical&amp;Life Sciences</subject></subj-group></article-categories><title-group><article-title>
 
 
  Expression of the transcription factor Xvent-2 in &lt;i&gt;Xenopus laevis&lt;/i&gt; embryogenesis
 
</article-title></title-group><contrib-group><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>lena</surname><given-names>Pshennikova</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib><contrib contrib-type="author" xlink:type="simple"><name name-style="western"><surname>Anna</surname><given-names>Voronina</given-names></name><xref ref-type="aff" rid="aff1"><sup>1</sup></xref><xref ref-type="corresp" rid="cor1"><sup>*</sup></xref></contrib></contrib-group><aff id="aff1"><addr-line>A. N. Bach Institute of Biochemistry, Russian Academy of Sciences, Moscow, Russia</addr-line></aff><author-notes><corresp id="cor1">* E-mail:<email>pshennikova57@mail.ru(LP)</email>;<email>voronina_a@mail.ru(AV)</email>;</corresp></author-notes><pub-date pub-type="epub"><day>28</day><month>04</month><year>2012</year></pub-date><volume>02</volume><issue>02</issue><fpage>124</fpage><lpage>131</lpage><history><date date-type="received"><day>12</day>	<month>March</month>	<year>2012</year></date><date date-type="rev-recd"><day>26</day>	<month>March</month>	<year>2012</year>	</date><date date-type="accepted"><day>2</day>	<month>April</month>	<year>2012</year></date></history><permissions><copyright-statement>&#169; Copyright  2014 by authors and Scientific Research Publishing Inc. </copyright-statement><copyright-year>2014</copyright-year><license><license-p>This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/</license-p></license></permissions><abstract><p>
 
 
  Till now the transcription factor Xvent-2 has been studied in 
  Xenopus embryos only by the mRNA testing. We use immunochemical methods for testing of the Xvent-2 protein and gradient-centrifugation methods for estimation of activity of its mRNA. Our results show that the Xvent-2 protein is present in eggs and early embryos. The Xvent-2 mRNA is absent at any of these developmental stages. The majority of mRNA synthesized on the zygotic genome was stored in informosomes, while only its small part could be revealed in polysomes. The spatial patterning of the Xvent-2 protein at different developmental stages did not entirely agree with that of its mRNA. These data indicate that the Xvent-2 protein functioning in 
  Xenopu embryos is regulated not only at the transcription, but at translation and posttranslation as well. We propose that the activation of translation on the masked Xvent-2 mRNA may lead to blood differentiation and cell migration.
 
</p></abstract><kwd-group><kwd>Whole-Mount Immunostaining; Posttranscriptional Regulation; Informosomes; Blood Differentiation</kwd></kwd-group></article-meta></front><body><sec id="s1"><title>1. INTRODUCTION</title><p>Usually an expression of a gene implies the synthesis of corresponding mRNA. There is a tacit consent that an absence or a presence of a certain mRNA suggests an absence or a presence of the protein. However there are lots of evidences that mRNA may present in a cell in inactive ribonucleoprotein complexes, called by different names, from informosomes to p-bodies [<xref ref-type="bibr" rid="scirp.18947-ref1">1</xref>]. As a rule the start up of protein synthesis on such messengers is regulated by the modifications of the mRNA-binding proteins and the translation factors [<xref ref-type="bibr" rid="scirp.18947-ref2">2</xref>]. The new-synthesized proteins also undergo some modifications, and that causes their activities. Thus the gene expression can be regulated on different levels: transcription, processing, translation and final activation of the protein molecule. The rule in molecular embryology is to see the expression of the gene by a method of in situ hybridization. It indicates the gene activity (regulation on the level of transcription) but none on availability of the protein. We compared patterning of the individual protein, the transcription factor Xvent-2, with that of its mRNA at different stages of Xenopus laevis development.</p><p>Four closely identical mRNAs (Xvent-2, Xom, Vox and Xbr) have been found in X. laevis embryos at gastrula and neurula stages [3-6]. At later stages, these mRNAs are detectable in the developing eye, tail bud, somites, bronchial arch, and about proctodeum. The mRNAs are encoded by the related genes: Xvent-2B, Xbr-1b/ Vox1, Xvent-2/Xbr-1a, Vox15, and Xom [<xref ref-type="bibr" rid="scirp.18947-ref7">7</xref>]. The presence of the homeodomain and its specific sequence certificate this protein to be a transcription factor of a BarH subfamily. This gene is a target of the BMP signaling pathway in Xenopus and plays an important role in the dorsoventral patterning in amphibia and fish [3-13].</p><p>The spatial patterning of the Xvent-2 mRNA in Xenopus embryos is closely studied [3-6]. The specific Ab to the Xvent-2 protein enabled us to determine spatial and temporal patterning of this protein in early embryos. We show that the Xvent-2 protein is stored in eggs when its mRNA is absent. This protein is revealed at all studied developmental stages. The Xvent-2 mRNA synthesis started and grew from midblastula on, reached maximum at neurula and then it was slowly vanishing by stages 39 - 40. The major part of the Xvent-2 mRNA is masked in informosomes and is not translated in the embryos. Spatial patterning of the Xvent-2 protein and its mRNA in Xenopus laevis embryos coincide only partially. The most coincidence is revealed at neurula. The spatial patterning permits us to propose that the activation of translation on the masked Xvent-2 mRNA may lead to blood differentiation and cell migration.</p></sec><sec id="s2"><title>2. MATERIALS AND METHODS</title><sec id="s2_1"><title>2.1. Analysis of RNA</title><p>X. laevis embryos were obtained, cytoplasmic extracts prepared, and centrifugation in CsCl or sucrose density gradients were performed as described previously [<xref ref-type="bibr" rid="scirp.18947-ref14">14</xref>]. RNA isolation, electrophoresis, and Northern blotting followed the standard protocols [<xref ref-type="bibr" rid="scirp.18947-ref15">15</xref>]. Radioactive labeled probes were prepared and dot hybridization was performed as described previously [<xref ref-type="bibr" rid="scirp.18947-ref14">14</xref>]. For RT-PCR we used forward primer: 5’atgactaaagctttctcctctgtt 3’ and reverse primer: 5’gccttggatcctaataggccagag 3’. Amplification was performed: 10 min at 94˚C; 30 cycles of 30 s at 96˚C, 30 s at 54˚C, and 4 min at 65˚C; and 7 min at 65˚C. PCR products were analyzed by 6% PAGE.</p></sec><sec id="s2_2"><title>2.2. Isolation of Protein Fraction of Embryos</title><p>The stages of the Xenopus development were determined according to the tables by [<xref ref-type="bibr" rid="scirp.18947-ref16">16</xref>]. The embryos were homogenized in 5 volumes of a following solution: 0.1 M Tris-HCl, pH 8.0; 0.1 M KCl; 10% glycerol; 2% b-mercaptoethanol and 1 mM PMSF. After 10 min centrifugation at 10000 g a supernatant was mixed with 1.5 volumes of 4 M ammonium sulfate and left for 2 days at 4˚C. The precipitate was collected by centrifugation at 10000 g and dissolved in Laemmli sample buffer.</p></sec><sec id="s2_3"><title>2.3. Production of the Recombinant reXvent-2 Protein</title><p>Expression and isolation of reXvent-2 protein were described previously [<xref ref-type="bibr" rid="scirp.18947-ref17">17</xref>]. We got a construction encoding the Xvent-2 with 22 amino acids (MGHHHHHHHHHSSGHIDDDD) at the N-end that was controlled by a commercial sequence determination procedure (VGNKI, Moscow). The isolated product was subjected to a commercial MALDI (IBC RAS). The results agreed with the predicted amino acid sequence. The program MS FIT was used (http://prospector.ucsf.edu).</p></sec><sec id="s2_4"><title>2.4. Production of Antiserum and Purified Antibodies (Ab)</title><p>The reXvent-2 protein was concentrated by methanol precipitation, dissolved in phosphate buffer and used to raise polyclonal antiserum in rabbits [<xref ref-type="bibr" rid="scirp.18947-ref17">17</xref>]. This serum was used in immunobloting. For whole-mount immunostaining anti-reXvent-2 rabbit Ab were purified and conjugated to horseradish peroxidase (IMTEK, Moscow).</p></sec><sec id="s2_5"><title>2.5. Immunoblotting</title><p>Proteins were electrophoresed in SDS-PAAG, transferred onto nitrocellulose membrane and stained with 0.1% Ponceaus S to control the transfer. Then the membrane was washed in water and treated consequently with blocking solution (5% milk), rabbit anti-reXvent-2 serum (1:1000) and goat anti-rabbit Ab conjugated to horseradish peroxidase p-SAR Iss (IMTEK, Moscow) (1:20000) as it was proposed by Promega. The peroxidase substrate TMB (tetramethilbenzydine) (“BioTestSystems” Moscow) served for staining.</p></sec><sec id="s2_6"><title>2.6. Whole-Mount Immunostaining of Embryos</title><p>Embryos were fixed according to Klymkowsky lab manual [<xref ref-type="bibr" rid="scirp.18947-ref18">18</xref>] in 20% DMSO: 80% methanol (Dent’s fixative). After 2 h gentle shaking at room temperature the embryos were transferred to ice cold acetone for10 min and to 100% methanol where they could be stored at –20˚C indefinitely. For staining, embryos were washed twice with Tris-buffered saline (TBS) for five minutes each time and if necessary bleached in 5% formamide, 0.5X SSC, 1% H<sub>2</sub>O<sub>2</sub> for a night. They were then incubated overnight at 4˚C in blocking solution: 20% normal rabbit serum, 2% DMSO diluted into TBS and after that for a day in antiXvent-2 rabbit Ab conjugated to horseradish peroxidase diluted 1:500 into the blocking solution. The embryos were then washed in TBS once for 15 min, once for 30 min, once for 1 h, once for 2 h. Bound peroxidase-conjugated Ab were visualized using the peroxidase substrate TMB for 1 to 2 h (dark blue staining). The reaction was stopped by changing the substrate for TBS.</p></sec><sec id="s2_7"><title>2.7. Control Whole-Mount Immunostainings</title><p>In the absence of Ab we found no staining of embryos with TMB. We used some controls to avoid any nonspecific Ab staining. Control 1: immunostaining with conjugate of anti-human-immunoglobulins rabbit Ab with peroxidase. Control 2: immunostaining with the conjugate of rabbit antiXvent-2 Ab with peroxidase depleted with the reXvent-2 protein. 2ml of the working solution of the conjugated anti-Xvent-2 Ab were sequentially incubated with three pieces of nitrocellulose membrane 3 &#215; 3 cm carrying 30 - 60 mcg of the reXvent-2 protein each. The third membrane after appropriate washing could hardly be stained with peroxidase substrate and thus we considered these anti-reXvent-2 Ab to be depleted with the reXvent-2 protein.</p></sec></sec><sec id="s3"><title>3. RESULTS AND DISCUSSION</title><sec id="s3_1"><title>3.1. Detection of the Xvent-2 Protein and mRNA in the Embryos at Different Developmental Stages</title><p>The anti-Xvent-2 immune rabbit serum was characterized in our earlier paper [<xref ref-type="bibr" rid="scirp.18947-ref17">17</xref>]. Control immunoblotting experiments showed that the serum reacted with a major band in the extract of E coli cells transformed with the plasmid containing the Xvent-2 cDNA insert and did not stain any protein in the extract of E. coli cells transformed with the empty vector.</p><p>The PAGE and immunoblotting of protein fractions obtained from X. laevis embryos at different developmental stages from eggs to tadpoles are shown in <xref ref-type="fig" rid="fig1">Figure 1</xref>. The immune serum revealed a single protein band in eggs and embryos of all developmental stages examined (<xref ref-type="fig" rid="fig1">Figure 1</xref>(a)). The same staining of the membrane treated with nonimmune rabbit serum with secondary Ab did not reveal any bands (not shown). The electrophoretic mo-</p><p>bility of X. laevis Xvent-2 was slightly higher than that of the recombinant protein reXvent-2 owing to the lack of a polyhistidine tag and corresponded to a protein of about 45 kDa. The calculated molecular mass for the Xvent-2 is 36.5 kDa, but some proteins, for example transcription factor Ybox1 [<xref ref-type="bibr" rid="scirp.18947-ref19">19</xref>], demonstrate the less mobility than theoretically counted one. The amount of the Xvent-2 was approximately the same at all the developmental stages and slightly higher in the eggs. This was quite unexpected, because the Xvent-2 mRNA synthesis did not start until the middle blastula [3-6]. To verify this, the RNA was examined by Northern blotting and RTPCR (Figures 1(b), (c)). The results confirmed that the Xvent-2 mRNA was undetectable at cleavage and early blastula stages. Then, its amount increases, reaches maximum at the stages 12 - 15, and decreases in further development. At the stages 39 - 40 neither Northern blotting nor RT-PCR could detect Xvent-2 mRNA. It is not connected with worse RNA extraction for the amount of rRNA is increasing in these samples (<xref ref-type="fig" rid="fig1">Figure 1</xref>(d)). The Xvent-2 protein content in embryos does not correlate with the accumulation and degradation of the Xvent-2 mRNA. The discrepancy in the detection of the mRNA and protein suggests a strict regulation of the amount of Xvent-2 protein at transcriptional, translational and protein-stability levels.</p></sec><sec id="s3_2"><title>3.2. Spatial Patterning of the Xvent-2 Protein in Embryos at Cleavage and Blastula Stages</title><p>Intensive nonspecific staining of embryos was revealed in our preliminary experiments where the standard procedure with primary and secondary Ab was performed. That is why in the sequel we used the affine-isolated rabbit anti-Xvent2 Ab conjugated to the horseradish peroxidase. A normal rabbit serum diluted 1:5 in TBS served as a blocking solution and as a solution for anti-Xvent-2 Ab to exclude any nonspecificity.</p><p>The results of the whole-mount immunostaining of embryos at the stages of 16 - 32 blastomers and blastula are presented in <xref ref-type="fig" rid="fig2">Figure 2</xref>. The Xvent-2 is revealed in the cytoplasm apical area of animal blastomers at cleavage stages (Figures 2(a)-(c)). At midblastula the Xvent-2 is seen in the animal hemisphere (Figures 2(d), (e)). The higher magnification shows the possible nuclear localization of the Xvent-2 protein at stage 8 (<xref ref-type="fig" rid="fig2">Figure 2</xref>(e*)). It seems that the transcription factor Xvent-2 migrates from cytoplasm to nucleus just before the transcription start at zygote genome. As it was shown earlier [<xref ref-type="bibr" rid="scirp.18947-ref20">20</xref>] there was revealed specific proteinase activity against the Xom/Xvent2 protein in embryos at stage 7. At the stages 9 - 10 this activity decreased dramatically and then it grew at gastrulation. One can suppose this proteinase destroyed the cytoplasmic Xvent-2 which had not entered the nucleus.</p></sec><sec id="s3_3"><title>3.3. Most of the Xvent-2 mRNA Is Not Translated</title><p>The expression of many genes in embryo development of eukaryotes is regulated at the translational level by variety of mechanisms [<xref ref-type="bibr" rid="scirp.18947-ref2">2</xref>]. The individual templates differ in specific localization within the embryo, activity time, and mechanisms of masking and translational activation. In our previous works we showed that some zygotic mRNAs starting to be expressed immediately at midblastula transition came to polysomes only at middle gastrula [<xref ref-type="bibr" rid="scirp.18947-ref14">14</xref>]. A translational regulation has been demonstrated for several Xenopus genes involved in the BMP signaling pathway [<xref ref-type="bibr" rid="scirp.18947-ref21">21</xref>]. The stored mRNAs arrived to polysomes at different periods: translation on the Smad1 and ALK2 mRNAs started in oocyte maturation, on the BMP-4 and XSTK9 mRNAs—soon after fertilization and only in early gastrula—on the ALK3 mRNA. Specific mRNAs encoding for the proteins participating in dorsoventral differentiation (Xwnt-11, Xnot-2, Xbra, and Xgsc) demonstrated individual dynamics of activation and inactivation during early embryogenesis [<xref ref-type="bibr" rid="scirp.18947-ref22">22</xref>]. Here we show the distribution of Xvent-2 mRNAs between polysomes and informosomes in X. laevis embryos at the gastrula (<xref ref-type="fig" rid="fig3">Figure 3</xref>). It is seen that most of the Xvent-2 mRNA sedimented in sucrose gradient at post ribosome zone (<xref ref-type="fig" rid="fig3">Figure 3</xref>(a), II), only few—at polysome zone (<xref ref-type="fig" rid="fig3">Figure 3</xref>(a), I). It was confirmed with Northern blotting (<xref ref-type="fig" rid="fig3">Figure 3</xref>(b)). The buoyant density in CsCl of Xvent-2 mRNP from zone I is 1.54 g/cm<sup>3</sup> as that of polysomes (<xref ref-type="fig" rid="fig3">Figure 3</xref>(c)) and the buoyant density in CsCl of Xvent-2 mRNP from zone II (free mRNP) is 1.4 g/cm<sup>3</sup> like that of informosomes. The Northern blotting of the RNA from the CsCl gradient confirmed the existence of the most of the Xvent-2 mRNA in inactive form (<xref ref-type="fig" rid="fig3">Figure 3</xref>(d)). The most part of Xvent-2 mRNA was detected in informo-</p><p>somes at all the developmental stages examined (from 9 to 17.5), and only its minor fraction was associated with polysomes [<xref ref-type="bibr" rid="scirp.18947-ref23">23</xref>]. From our data it follows that the most of the Xvent-2 mRNA detected by in situ hybridization does not participate in the protein synthesis and thus, the in situ hybridization cannot reproduce the protein pattern.</p></sec><sec id="s3_4"><title>3.4. Spatial Patterning of the Xvent-2 Protein in Embryos at Gastrula, Neurula and Tadpoles</title><p><xref ref-type="fig" rid="fig4">Figure 4</xref> shows the Xvent-2 protein immunostaining of the embryos at the gastrula stages. It is seen that at early gastrula the Xvent-2 protein is located in the animal hemisphere with a shift towards dorsal side of blastopore. At the late gastrula (st. 11.5 - 12) the Xvent-2 protein spreads all over the embryo excepting blastopore (Figures 4(e), (f)). From the literature [3-6] it is clear that the Xvent-2 mRNA is detected at the gastrula in the same aria except for a region above the dorsal blastopore lip (prospective the neural plate and the notochord) (<xref ref-type="fig" rid="fig4">Figure 4</xref>(i)). To the termination of gastrulation Xvent-2 mRNA disappear on each side (<xref ref-type="fig" rid="fig4">Figure 4</xref>(j)). According to the data shown (<xref ref-type="fig" rid="fig3">Figure 3</xref>) Xvent-2 mRNA is practically not translated at gastrula. Thus with immunostaining we probably see to a greater extent the Xvent-2 protein which had been stored in eggs.</p><p>An animal pole-derived ectoderm plays a critical role in blood cells formation [<xref ref-type="bibr" rid="scirp.18947-ref24">24</xref>]. Expression of BMP-4 not only in ventral mesoderm but in the overlying ectoderm is important for primitive red blood cells induction. As it was shown earlier, the Xvent-2 have activated the BMP-4 and Xvent-1 genes involved in ventral mesoderm formation in embryo development of fish and amphibians [7-12]. We propose that just the Xvent-2 protein (stored in the animal hemisphere of an egg and being found in the ectoderm due to cell movements at gastrulation) activates the synthesis of the BMP-4 and as a result the red blood cells formation in mesoderm.</p><p>At the neurula and early tailbud stages (<xref ref-type="fig" rid="fig5">Figure 5</xref>)</p><p>immunostaining reveals Xvent-2 along the edge of the neural tube, the presumptive brain and eyes, in the bronchial arc, in the otic vesicle, in the somites and the cement gland. The staining of the cement gland may be an artifact, as an occasional nonspecific staining of it was found earlier [<xref ref-type="bibr" rid="scirp.18947-ref18">18</xref>]. Presumptive myeloid blood cells were concentrated at these stages in the middle of ventral area of embryo [<xref ref-type="bibr" rid="scirp.18947-ref25">25</xref>]. We saw the Xvent-2 protein staining in this area too (<xref ref-type="fig" rid="fig5">Figure 5</xref>(c)).</p><p>Results of other authors on the in situ hybridization at the neurula and early tailbud stages revealed that the Xvent-2 mRNA patterns were generally overlapped with those of the protein. The mRNA was found along the edge of the neural tube [3,5,6,9] along the edge of the presumptive forebrain [<xref ref-type="bibr" rid="scirp.18947-ref13">13</xref>], in the presumptive eyes, bronchial arch, tail bud [3-6] somites [<xref ref-type="bibr" rid="scirp.18947-ref3">3</xref>] and in the areas of the mieloid ventral blood island [4,5,25]. The Xvent-2 mRNA was absent in the cement gland [3-6].</p><p>At the stages 30-35 the Xvent-2 mRNA was seen in three areas: in the tail tip, the dorsal parts of eyecups and in the bronchial arch [3,5,6,9].</p><p>Our study revealed the Xvent-2 protein at stage 35 in both anterior and posterior red blood island [24,26], in the lymphatic caudal dorsal vessel, in the tail fin and around the eyes, the bronchial arches and the proctodeum (<xref ref-type="fig" rid="fig6">Figure 6</xref>). Thus coincidence of mRNA and protein patterning at these stages is only partial (<xref ref-type="fig" rid="fig6">Figure 6</xref>(c)). The immunostaining of albino tadpoles at the stage 45 revealed stained granules chains along the lymphatic caudal dorsal vessel, near the proctodeum and in the head (<xref ref-type="fig" rid="fig7">Figure 7</xref>). In addition there were stained numerous filaments winding the eyes and ramifying throughout the head. These filaments might be blood or lymphatic vessels. The chains observed are rather like lymphatic vessels.</p><p>It was shown earlier [<xref ref-type="bibr" rid="scirp.18947-ref23">23</xref>] that the Xvent-2 mRNA from cut tail at tailbud stages was present in informosomes and so it was not translated. The presence of the Xvent-2</p><p>mRNA and lack of the protein in a tail tip confirm it. We propose, that as soon as a cell (under any signal) starts to synthesize the Xvent-2 protein, it moves towards a developing lymphatic or blood vessel. That is why Xvent-2 mRNA had not been detected either in globins-containing ventral blood island or in lymphatic or blood vessels. We propose that a possible function of the Xvent-2 protein may be not only the dorsoventral axis formation in the early embryo, but also participating in the blood and lymph development. That is why the cells which synthesize the Xvent-2 protein can be revealed along the edge of some presumptive organs at neurula. They may participate in creation of the blood system of these organs.</p><p>Our results corroborate our hypothesis on the role of activation of some mRNAs in cell transition from a competence to the determination at an embryogenesis [<xref ref-type="bibr" rid="scirp.18947-ref2">2</xref>].</p></sec></sec><sec id="s4"><title>4. CONCLUSION</title><p>A pattern of mRNA cannot sometimes give a perfect reflection of a corresponding protein pattern because of the existence of inactive mRNAs or long-living proteins. It also may be a case when after activation of some protein synthesis, cells migrate and the protein appears at another place. Thus one must investigate the pattern of gene expression not only with in situ hybridization but with immunostaining of the protein too. For transcription factor Xvent-2 we showed, that it was stored in eggs and in animal blastomers when its mRNA was absent. The major of the Xvent-2 mRNA synthesized after midblastula transition was not translated in the embryos. The spatial patterning permits us to propose that the activation of translation on the masked Xvent-2 mRNA may lead to the blood differentiation and cell migration.</p></sec><sec id="s5"><title>REFERENCES</title></sec><sec id="s6"><title>NOTES</title></sec></body><back><ref-list><title>References</title><ref id="scirp.18947-ref1"><label>1</label><mixed-citation publication-type="other" xlink:type="simple">Voronina, A.S. and Pshennikova, E.S. (2010) mRNPs: From informosomes to stress granules. Molecular Biology, 44, 520-528. doi:10.1134/S0026893310040035</mixed-citation></ref><ref id="scirp.18947-ref2"><label>2</label><mixed-citation publication-type="other" xlink:type="simple">Voronina, A.S. (2002) Translational regulation in early development of eukaryotes. Molecular Biology, 36, 956-969. doi:10.1023/A:1021669506664</mixed-citation></ref><ref id="scirp.18947-ref3"><label>3</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Onichtchouk</surname><given-names> D.</given-names></name>,<name name-style="western"><surname> Gawantka</surname><given-names> V.</given-names></name>,<name name-style="western"><surname> Dosch</surname><given-names> R.</given-names></name>,<name name-style="western"><surname> Delius</surname><given-names> H.</given-names></name>,<name name-style="western"><surname> Hirschfeld</surname><given-names> K.</given-names></name>,<name name-style="western"><surname> Blumenstock</surname><given-names> C. and Niehrs</given-names></name>,<name name-style="western"><surname> C. </surname><given-names>  </given-names></name>,<etal>et al</etal>. (<year>1996</year>)<article-title>The Xvent-2 homeobox gene is part of the BMP-4 signalling parthway controlling dorsoventral patterning of Xenopus mesoderm</article-title><source> Development</source><volume> 122</volume>,<fpage> 3045</fpage>-<lpage>3053</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.18947-ref4"><label>4</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Schmidt</surname><given-names> J.E.</given-names></name>,<name name-style="western"><surname> von Dassow</surname><given-names> G. and Kimelman</given-names></name>,<name name-style="western"><surname> D. </surname><given-names>  </given-names></name>,<etal>et al</etal>. (<year>1996</year>)<article-title>Regulation of dorsal-ventral patterning: The ventralizing effects of the novel Xenopus homeobox gene Vox</article-title><source> Development</source><volume> 122</volume>,<fpage> 1711</fpage>-<lpage>1721</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.18947-ref5"><label>5</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Ladher</surname><given-names> R.</given-names></name>,<name name-style="western"><surname> Mohun</surname><given-names> N.J.</given-names></name>,<name name-style="western"><surname> Smith</surname><given-names> J.C. and Snape</given-names></name>,<name name-style="western"><surname> A.M. </surname><given-names>  </given-names></name>,<etal>et al</etal>. (<year>1996</year>)<article-title>Xom: A Xenopus homeobox gene that mediates the early effects of BMP-4</article-title><source> Development</source><volume> 122</volume>,<fpage> 2385</fpage>-<lpage>2394</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.18947-ref6"><label>6</label><mixed-citation publication-type="other" xlink:type="simple">Papalopulu, N. and Kintner, C. (1996) A Xenopus gene, Xbr-1, defines a novel class of homeobox genes and is expressed in the dorsal ciliary margin of the eye. Developmental Biology, 174, 104-114. 
doi:10.1006/dbio.1996.0055</mixed-citation></ref><ref id="scirp.18947-ref7"><label>7</label><mixed-citation publication-type="other" xlink:type="simple">Rastegar, S., Friedle, H., Frommer, G. and Knochel, W. (1999) Transcriptional regulation of Xvent homeobox genes. Mechanisms of Development, 81, 139-149. 
doi:10.1016/S0925-4773(98)00239-1</mixed-citation></ref><ref id="scirp.18947-ref8"><label>8</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Onichtchouk</surname><given-names> D.</given-names></name>,<name name-style="western"><surname> Glinka</surname><given-names> A. and Niehrs</given-names></name>,<name name-style="western"><surname> C. </surname><given-names>  </given-names></name>,<etal>et al</etal>. (<year>1998</year>)<article-title>Requirement for Xvent-1 and Xvent-2 gene function in dorsoventral patterning of Xenopus mesoderm</article-title><source> Development</source><volume> 125</volume>,<fpage> 1447</fpage>-<lpage>1456</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.18947-ref9"><label>9</label><mixed-citation publication-type="other" xlink:type="simple">Melby, A.E., Clements, W.K. and Kimelman, D. (1999) Regulation of dorsal gene expression in Xenopus by the ventralizing homeodomain gene Vox. Developmental Biology, 211, 293-305. doi:10.1006/dbio.1999.9296</mixed-citation></ref><ref id="scirp.18947-ref10"><label>10</label><mixed-citation publication-type="other" xlink:type="simple">Trindade, M., Tada, M. and Smith, J.C. (1999) DNA-binding specificity and embryological function of Xom (Xvent-2). Developmental Biology, 216, 442-456. 
doi:10.1006/dbio.1999.9507</mixed-citation></ref><ref id="scirp.18947-ref11"><label>11</label><mixed-citation publication-type="other" xlink:type="simple">Melby, A.E., Beach, C., Mullins, M. and Kimelman, D. (2000) Patterning the early Zebrafish by the opposing actions of bozozok and vox/vent. Developmental Biology, 224, 275-285. doi:10.1006/dbio.2000.9780</mixed-citation></ref><ref id="scirp.18947-ref12"><label>12</label><mixed-citation publication-type="other" xlink:type="simple">Schuler-Metz, A., Knochel, S., Kaufmann, E. and Knochel, W. (2000) The homeodomain transcription factor Xvent-2 mediates autocatalytic regulation of BMP-4 expression in Xenopus embryos. The Journal of Biological Chemistry, 275, 34365-34374.  
doi:10.1074/jbc.M003915200</mixed-citation></ref><ref id="scirp.18947-ref13"><label>13</label><mixed-citation publication-type="other" xlink:type="simple">Martynova, N., Eroshkin, F., Ermakova, G., Bayramov, A., Gray, J., Grainger, R. and Zaraisky, A. (2004) Patterning the forebrain: FoxA4a/Pintallavis and Xvent-2 determine the posterior limit of Xanf1 expression in the neural plate. Development, 131, 2329-2338. doi:10.1242/dev.01133</mixed-citation></ref><ref id="scirp.18947-ref14"><label>14</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Voronina</surname><given-names> A.S. and Potekhina</given-names></name>,<name name-style="western"><surname> E.S. </surname><given-names>  </given-names></name>,<etal>et al</etal>. (<year>1999</year>)<article-title>Translational regulation of synthesis of proteins responsible for dorsoventral differentiation of Xenopus laevis embryos</article-title><source> Russian Journal of Developmental Biology</source><volume> 30</volume>,<fpage> 83</fpage>-<lpage>90</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.18947-ref15"><label>15</label><mixed-citation publication-type="other" xlink:type="simple">Maniatis, T., Fritsch, E.F. and Sambrook, J. (1982) Molecular cloning: A laboratory manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor.</mixed-citation></ref><ref id="scirp.18947-ref16"><label>16</label><mixed-citation publication-type="other" xlink:type="simple">Nieuwkoop, P.D. and Faber, J. (1956) Normal table of Xenopus laevis (daudin): A systematical and chronologica survey of the development from the fertilized egg till the end of metamorphosis. North-Holland, Amsterdam.</mixed-citation></ref><ref id="scirp.18947-ref17"><label>17</label><mixed-citation publication-type="other" xlink:type="simple">Pshennikova, E.S. and Voronina, A.S. (2008) Detection of the Xvent-2 transcription factor in early development of Xenopus laevis. Molecular Biology, 42, 901-905. 
doi:10.1134/S0026893308060101</mixed-citation></ref><ref id="scirp.18947-ref18"><label>18</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Dent</surname><given-names> J.A.</given-names></name>,<name name-style="western"><surname> Polson</surname><given-names> A.G. and Klymkowsky</given-names></name>,<name name-style="western"><surname> M.W. </surname><given-names>  </given-names></name>,<etal>et al</etal>. (<year>1989</year>)<article-title>A whole-mount immunocytochemical analysis of the expression of the intermediate filament protein vimentin in Xenopus</article-title><source> Development</source><volume> 105</volume>,<fpage> 61</fpage>-<lpage>74</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.18947-ref19"><label>19</label><mixed-citation publication-type="other" xlink:type="simple">Evdokimova, V.M., Wei, C.L., Sitikov, A.S., Simonenko, P.N., Lazarev, O.A., Vasilenko, K.S., Ustinov, V.A., Hershey, J.W. and Ovchinnikov, L.P. (1995) The major protein of messenger ribonucleoprotein particles in somatic cells is a member of the Y-box binding transcription factor family. The Journal of Biological Chemistry, 270, 3186-3192. doi:10.1074/jbc.270.7.3186</mixed-citation></ref><ref id="scirp.18947-ref20"><label>20</label><mixed-citation publication-type="other" xlink:type="simple">Zhu, Z. and Kirschner, M. (2002) Regulated proteolysis of Xom mediates dorsoventral pattern formation during early Xenopus development. Developmental Cell, 3, 557-568. doi:10.1016/S1534-5807(02)00270-8</mixed-citation></ref><ref id="scirp.18947-ref21"><label>21</label><mixed-citation publication-type="other" xlink:type="simple">Fritz, B.R. and Sheets, M.D. (2001) Regulation of the mRNAs encoding proteins of the BMP signaling pathway during the maternal stages of Xenopus development. Developmental Biology, 236, 230-243. 
doi:10.1006/dbio.2001.0324</mixed-citation></ref><ref id="scirp.18947-ref22"><label>22</label><mixed-citation publication-type="other" xlink:type="simple">Voronina, A.S. and Pshennikova, E.S. (2006) Activity of specific mRNAs in early development of Xenopus and Rana embryos. Journal of Biological Sciences, 6, 115-120. doi:10.3923/jbs.2006.115.120</mixed-citation></ref><ref id="scirp.18947-ref23"><label>23</label><mixed-citation publication-type="other" xlink:type="simple">Voronina, A.S., Pshennikova, E.S. and Shatilov, D.V. (2003) Distribution of the Xvent-2 mRNA between informosomes and polysomes in early frog development. Molecular Biology, 37, 429-435. 
doi:10.1023/A:1024279025289 
doi:10.1023/A:1024295528924</mixed-citation></ref><ref id="scirp.18947-ref24"><label>24</label><mixed-citation publication-type="journal" xlink:type="simple"><name name-style="western"><surname>Kikkawa</surname><given-names> M.</given-names></name>,<name name-style="western"><surname> Yamazaki</surname><given-names> M.</given-names></name>,<name name-style="western"><surname> Izutsu</surname><given-names> Y. and Maéno</given-names></name>,<name name-style="western"><surname> M. </surname><given-names>  </given-names></name>,<etal>et al</etal>. (<year>2001</year>)<article-title>Two step induction of primitive erythrocytes in Xenopus laevis embryos: Signals from the vegetal endoderm and the overlying ectoderm</article-title><source> The International Journal of Developmental Biology</source><volume> 45</volume>,<fpage> 387</fpage>-<lpage>396</lpage>.<pub-id pub-id-type="doi"></pub-id></mixed-citation></ref><ref id="scirp.18947-ref25"><label>25</label><mixed-citation publication-type="other" xlink:type="simple">Ciau-Uitz, A., Liu, F. and Patient, R. (2010) Genetic control of hematopoietic development in Xenopus and zebrafish. The International Journal of Developmental Biology, 54, 1139-1149. doi:10.1387/ijdb.093055ac</mixed-citation></ref><ref id="scirp.18947-ref26"><label>26</label><mixed-citation publication-type="other" xlink:type="simple">Iraha, F., Saito, Y., Yoshida, K., Kawakami, M., Izutsu, Y., Daar, I.O. and Maéno, M. (2002) Common and distinct signals specify the distribution of blood and vascular cell lineages in Xenopus laevis embryos. Development, Growth and Differentiation, 44, 395-407. 
doi:10.1046/j.1440-169X.2002.00653.x</mixed-citation></ref></ref-list></back></article>