jbmJournal of Biosciences and Medicines2327-509X2327-5081Scientific Research Publishing10.4236/jbm.2026.1411006jbm-155098ArticleBiomedicalLife SciencesLow Prevalence of the Genetic Determinants of OXA-1 and AAC (6’) Resistance in Escherichia coli Isolated from Broiler Chicken Droppings in Azaguié, Côte d’Ivoire: A Surveillance StudyKouadioKpandji Isidore1TahouEric Joël1AssouaMessou Anicet-Charles2TouvoliAurelie Mirabelle1N’GuettaAssanvo Simon-Pierre1GuessenndKouadio Nathalie2 Université Félix Houphouët Boigny, UFR Biosciences, Laboratoire de Biotechnologie, Agriculture et Valorisation des Ressources Biologiques, UPR Génétique, Abidjan, Côte d’Ivoire Institut Pasteur de Côte d’Ivoire, Abidjan, Côte d’Ivoire
The authors declare no conflicts of interest regarding the publication of this paper.
Background: The rise in avian antibiotic resistance poses a major risk to public health. In Côte d’Ivoire, surveillance studies on the genetic determinants of resistance in avian Escherichia coli remain limited. Objective: The aim of this surveillance study is to assess the prevalence of the OXA-1 and AAC (6’) resistance genes in E. coli strains isolated from broiler chicken droppings in the town of Azaguié, Côte d’Ivoire. Methods: A cross-sectional collection of droppings samples was conducted at 14 broiler farms from June 24 to 26, 2024. After isolating and identifying E. coli strains, susceptibility testing for seven antibiotics was performed using the antibiotic disk diffusion method on agar medium, followed by testing for extended-spectrum beta-lactamase (ESBL) production using the double synergy method. Conventional PCR was performed to detect the OXA-1 and AAC (6’) genetic determinants and class 1 integrons (Int1). Results: A total of 57 strains of E. coli were isolated. They showed complete susceptibility to beta-lactams (AMC, ceftriaxone, cefotaxime, ceftazidime), 17.54% resistance to gentamicin, 45.61% resistance to nalidixic acid, and 100% resistance to colistin. Molecular analysis of resistant E. coli strains revealed the presence of the oxa-1 and aac (6) genes in 12.50% and 25% of the isolates, respectively, with a significant co-occurrence of the two genes (p= 0.00988). Furthermore, molecular analysis revealed the presence of class 1 integrons (Int1) at a rate of 70.83%, with no significant association with the blaOXA-1 gene (p= 0.47) or the aac (6’) gene (p =0.321). Conclusion:This study revealed low prevalences of resistance determinants. However, the high prevalence of class 1 integrons (Int1) suggests a potential risk of resistance spreading in poultry farms in the Azaguié area, hence the need to continue surveillance within a “One Health” framework to prevent the emergence and spread of antibiotic resistance.
Antibiotics are among the most commonly prescribed drugs, particularly in Africa [1]. In animal husbandry, these drugs can be used either as a preventive treatment, as a metaphylactic treatment, or as a curative treatment. They are also used as growth promoters in animal husbandry [2]. The overuse of antibiotics in poultry farming is a major factor in the selection of resistant bacteria, thereby reducing the number of susceptible bacteria in the animals’ gut flora [3]. Among these bacteria, Escherichia coli is the leading pathogen responsible for deaths related to antibiotic resistance in humans [1].
Furthermore, the intensive and inappropriate use of antibiotics poses a major zoonotic threat. Indeed, since E. coli is a commensal bacterium in the digestive tract of animals, it serves as a reservoir of resistance genes that can be disseminated into the environment, contributing to a decline in the effectiveness of these antibiotics and the inability to cure some bacterial diseases in both humans and animals [4][5].
Antibiotic resistance results from genetic factors (mutations and gene acquisition via plasmids) and biochemical mechanisms (enzymatic inactivation of the antibiotic, target modification, membrane impermeability, and efflux pump activity) [6][7]. Among these mechanisms, OXA-1-type beta-lactamases, which inhibit penicillins and some cephalosporins, and AAC (6’) modification enzymes, which inactivate aminoglycosides, are particularly prevalent [8].
In Côte d’Ivoire, antibiotic resistance in E. coli strains isolated from various livestock sectors has reached alarming levels in several livestock-raising areas [9][10]. Resistance has been documented in poultry to several antibiotics, with rates reaching as high as 100% for colistin in particular [11][12]. However, despite the alarming rates of antibiotic resistance in poultry, molecular detection of resistance determinants is very limited. This surveillance study aims to address this gap by determining the prevalence of the OXA-1 and AAC (6’) resistance genes in E. coli strains isolated from the droppings of broiler chickens in the town of Azaguié, Côte d’Ivoire, in order to assess the health risks associated with this activity.
2. Materials and Methods2.1. Study Site
Azaguié is a town in southern Côte d’Ivoire, located 40 km north of Abidjan, the country’s economic capital. The area has a subequatorial climate characterized by hot and humid temperatures (25˚C - 28˚C). The town’s two neighborhoods (Azaguié-Ahoua and Azaguié-Gare), as well as the villages of M’bromé and Abbê, served as the setting for this cross-sectional study, which took place from June 24 to 26, 2024.
2.2. Collecting Droppings Samples
Sixteen broiler farms housing chickens of all ages were visited throughout the study area. In each poultry house, droppings were collected according to the standard protocol [13], which specifies that 20 droppings must be collected per 1000 birds. Thus, 15 to 104 freshly laid droppings were collected from the floor along the two diagonals and the two medians of each rearing building. The droppings collected along each characteristic line of the building were placed in a polyethylene plastic bag, then stored on ice for transport to the laboratory, where they were kept at +4˚C.
2.3. Microbiological Analyses
2.3.1. Isolation of Escherichia coli Strains
E. coli strains were isolated according to the standard protocol described in the NF EN ISO 6579 standard (ISO-6579, 2002E). The process began with pre-enrichment, which consisted of incubating each sample—suspended in buffered peptone water at a 1:10 ratio—in test tubes at 37˚C for 18 to 24 hours. Next, the pre-enriched solutions were used to inoculate pre-labeled TBx agar plates using the quadrant method. These plates were then incubated at 37˚C for 24 hours. The typical (blue-green) colonies obtained after this enrichment process were collected for bacterial identification.
2.3.2. Identification of Escherichia coli Strains
Colonies suspected of being E. coli strains isolated from TBx agar plates were inoculated into 1.5 mL of brain heart broth (BCC) in labeled hemolysis tubes. The mixtures were incubated at 37˚C for 24 hours. They were then selectively cultured on plates containing EMB agar at 37˚C for 24 hours to identify E. coli strains based on their classic morphological and biochemical characteristics.
2.4. Antibiotic Susceptibility Testing
The bacterial susceptibility of E. coli strains was determined using the antibiotic-impregnated disk diffusion method on Mueller-Hinton agar, as proposed by Kirby-Bauer, in accordance with the recommendations of the Antibiogram Committee of the French Society of Microbiology [14]. Seven antibiotics (BIORAD) were used in the tests. These included four compounds or combinations from the beta-lactam family: ceftazidime (30 µg), cefotaxime (30 µg), ceftriaxone (30 µg), amoxicillin plus clavulanic acid (30 µg), gentamicin (10 µg), colistin (10 µg), and nalidixic acid (30 µg).
2.5. Screening for the Production of Extended-Spectrum Beta-Lactamase
The double-synergy method was used to identify bacteria that produce extended-spectrum beta-lactamases (ESBL). This technique involves screening Mueller-Hinton agar for a synergy pattern resembling a “Champagne cork” between an antibiotic disc containing a beta-lactamase inhibitor such as amoxicillin plus clavulanic acid and third-generation cephalosporin (3GC) discs, notably ceftazidime, cefotaxime, and ceftriaxone, in accordance with the recommendations provided by CASFM [15].
2.6. Molecular Detection of Antibiotic Resistance Genes
Twenty-four strains of Escherichia coli were selected at random from those exhibiting antibiotic resistance profiles for the purpose of identifying resistance genes. DNA extraction was performed using heat shock. A standard polymerase chain reaction (PCR) was used to detect the oxa-1 and aac(6) antibiotic resistance genes and class 1 integrons (Int1) using specific primer pairs (Table 1). PCR amplification was performed in a 30 µl volume using a thermal cycler (Perkin® Elmer GenAmp Applied Biosystems 9700). The amplification conditions are summarized in Table 2. The reaction mixture consisted of 10 μl of DNA, 1X Master
Table 1. List of primers used for the polymerase chain reaction.
Genes
Primers
Sequences 5’-3’
Amplicon size (bp)
Reference
bla OXA-
1
F
GCAGCGCCAGTGCATCAAC
198
Maynard
et al
., 2003
R
CCGCATCAAATGCCATAAGTG
bla aac
(6)
F
TTGCGATGCTCTATGAGTGGCTA
482
Park
et al
., 2006
R
CTCGAATGCCTGGCGTGTTT
Int
1
F
CCTCCCGCACGATGATC
280
Goldstein
et al
., 2001
R
TCCACGCATCGTCAGGC
F: Forward, R: Reverse, bp: base pair.
Table 2. Conditions for amplifying antibiotic resistance genes.
Amplification steps
Conditions
OXA-1gene
aac(6)gene
Int1
Initial denaturation
95˚C/5 min
95˚C/5 min
95˚C/5 min
Cyclic denaturation
95˚C/30 s
95˚C/30 s
95˚C/30 s
Annealing
58˚C/30 s
60˚C/30 s
60˚C/30 s
Cyclic extension
72˚C/4 min
72˚C/4 min
72˚C/4 min
Final extension
72˚C/10 min
72˚C/10 min
72˚C/10 min
Number of cycles
30
30
30
Mix, and 10 μM of each specific primer for each target. Another reaction mixture without DNA was used as a negative control. The amplified products were analyzed by electrophoresis on a 1.5% agarose gel (Invitrogen) stained with SYBR Safe. The gel was imaged using an ultraviolet imaging system (GelDoc).
2.7. Data Analysis
The data collected during this study were entered and recorded in an Excel 2016 spreadsheet. The frequencies of phenotypic resistance and the prevalences of the OXA-1 and AAA(6’) genes, as well as those of class 1 integrons (Int1), were calculated. Fisher’s exact test was used to identify significant associations between the simultaneous presence of the two resistance genes, as well as between carriage of the Int 1 integron and the presence of the resistance genes. The threshold for statistical significance was set at 5%, and the analyses were performed using STATA software, version 9.2.
A total of 16 chicken coops were sampled across all four sites in the study area. As a result, sixty-four (64) samples of broiler chicken droppings—four per coop—were collected. Fifty-seven (57) Escherichia coli strains were identified in these droppings (Table 3).
Table 3. Distribution of identified E. coli strains by sampling site.
Bacterial strains
Sampling sites
Total
Ahoua
Abbê
Gare
M’brome
Escherichia coli.
16
20
9
12
57
3.2. Antibiotic Resistance Profiles of
<italic>Escherichia coli</italic>
Strains
The results of susceptibility testing of E. coli strains to the antibiotics tested indicated complete susceptibility to beta-lactams (AMC, ceftriaxone, cefotaxime, ceftazidime), with 0% resistance. In contrast, resistance was 17.54% for gentamicin (aminoglycoside class), 45.61% for nalidixic acid (quinolone class), and 100% for colistin (polymyxin class) (Table 4).
Table 4. Resistance rates of Escherichia coli isolates to the antibiotics tested.
The synergy test conducted to confirm the production of extended-spectrum beta-lactamases was negative for all Escherichia coli strains tested. Review of the results revealed the absence of a “champagne cork” pattern—which indicates synergy—between the antibiotic-impregnated discs containing third-generation cephalosporins (C3G) and the amoxicillin-clavulanic acid (AMC) inhibitor.
3.4. Molecular Characteristics of Antibiotic-Resistant
<italic>E. coli</italic>
Strains
3.4.1. Amplification Profile of the blaOXA-1 and aac (6’) Resistance Genes in E. coli
PCR analysis of 24 resistant strains of E. coli revealed the presence of the oxa-1 gene in 3 of them (12.50%) characterized by a 298-bp band (Figure 1). Furthermore, the aac (6) gene, identified by a 482-bp band, was detected in 6 of these strains, representing a rate of 25% (Figure 2). The aac (6) resistance determinant was twice as common as the oxa-1 gene in this Azaguié location. Furthermore, the search for significant associations revealed a co-occurrence between the oxa-1 and aac (6) genes (p =0.00988). There is therefore a link between these two biomarkers.
3.4.2. Prevalence of Class 1 Integrons (Int1)
Molecular analysis of strains that were phenotypically resistant to the antibiotics tested revealed the presence of class 1 integrons (Int1). Thus, 17 of the 24 E. coli strains analysed carried this integron, representing a rate of 70.83% (Figure 3).
Lane M: molecular weight marker (Invitrogen, 100bp DNA Ladder), Lane CN: Negative Control, Lane CP: Positive Control OXA-1 (298 pb), Lanes 3, 4 and 5: Negative samples, Lanes 1 and 2: Positive samples forOXA-1.
Figure 1. 1% agarose gel electrophoresis showing a simplex PCR for the detection of the OXA-1 gene in E. coli.
Lane M: molecular weight marker (Invitrogen, 100 bp DNA Ladder), Lane CN: Negative Control, Lane CP: Positive Control aac (6) (482 bp), Lanes 1, 2 and 5: Negative samples, Lanes 3 and 4: Positive samples for aac (6).
Figure 2. 1% agarose gel electrophoresis showing a simplex PCR for the detection of the aac (6) gene in E. coli.
Lane M: molecular weight marker (Invitrogen, 100 bp DNA Ladder), Lane CN: Negative Control, Lane CP: Positive Control Int1 (600 pb), Lane 2: Negative sample, Lanes 1, 3, 4 and 5: Positive samples for Int1.
Figure3. Agarose gel electrophoresis using 1% agarose, showing a simplex PCR assay for the detection of class 1 integrons in E. coli.
Furthermore, an investigation into associations between the presence of class 1 integrons and resistance genes showed that the class 1 integron was not significantly associated with either the blaOXA-1 gene (p =0.47) or the aac (6’) gene (p =0.321).
4. Discussion
Several studies have shown that E. coli, a commensal bacterium found in the digestive tract of animals, acts as a reservoir of resistance genes which can be released into the environment, thereby contributing to a reduction in the efficacy of these antibiotics and the inability to treat some bacterial diseases in both humans and animals [4][5][15]. Furthermore, class 1 integrons (Int1) have already been reported in E. coli strains isolated from broiler chickens [16].
This study, which was conducted as part of an antibiotic resistance surveillance programme, aimed to determine the prevalence of the OXA-1 and AAC (6’) resistance genes in E. coli strains isolated from the droppings of broiler chickens in the town of Azaguié in Côte d’Ivoire, with a view to assessing the health risks associated with this activity.
Our results showed that all strains of Escherichia coli isolated from droppings and tested were fully susceptible to beta-lactams (amoxicillin + clavulanic acid, ceftazidime, ceftriaxone and cefotaxime), indicating the absence of extended-spectrum beta-lactamase (ESBL) production. These drugs remain fully effective and could constitute a first-line treatment for infections caused by E. coli strains circulating in local poultry farms. This absence of resistance could be explained by the lack of use or limited use of these drugs on farms in the Azaguié area. These results are similar to those of authors, who reported no resistance in broiler chickens in Tunisia [17]. They are very close to those reported by another author in Algeria, who found a very low rate of 1.96% of avian E. coli strains exhibiting the ESBL phenotype [18]. However, higher rates of 38.89%, 51.72% and 93.5% were reported by different authors in Togo [19], in Algeria [20] and in Nigeria [21], respectively.
The results of this study also revealed a gentamicin resistance rate (Aminoglycoside family) of 17.54%. This rate, which indicates the active circulation of aminoglycoside resistance determinants, could be explained by the unregulated use of gentamicin in poultry farming.
Similar results were obtained by some authors in Algeria, who, in their study on pathogenic avian E. coli strains, found resistance rates of 18.46% [22]. Particularly high rates have been reported by other authors: 32.50% in Algeria [23], 58.09% in China [24] and 91.7% in Nigeria [3].
Testing the susceptibility of E. coli strains to colistin, an antibiotic belonging to the polymyxin family, revealed a resistance rate of 100%. This total resistance to colistin may be due to intense selection pressure linked to its historical or recent use for metaphylaxis or as a growth promoter on poultry farms in the study area. Indeed, colistin is widely used in the poultry industry to treat colibacillosis and salmonellosis, even though it is classified by the WHO as a critically important antibiotic of major priority. It should not be used as a first-line antibiotic in the treatment of bacterial infections in animals. Our results are far higher than those obtained by two authors in Morocco, who reported no resistance [25], and by other authors in Senegal, who reported a rate of 2.2% [26].
The susceptibility of E. coli strains was tested using nalidixic acid, a member of the quinolone family. The resistance rate of E. coli strains to this compound is 45.61%. This high rate could be explained by the widespread prescription of fluoroquinolones following β-lactams in Africa, and particularly in Côte d’Ivoire [27], or by frequent chromosomal mutations in the target genes (gyrA and parC genes) that encode topoisomerases [28]. This rate is similar to that obtained in a study of pathogenic avian E. coli strains in Algeria. Indeed, the authors found a resistance rate of 49.15% for this substance [22]. However, a lower rate of resistance to nalidixic acid (28.57%) was reported in Togo [19].
PCR analysis of resistant E. coli strains revealed the presence of the oxa-1 and aac (6’) genes at rates of 12.50% and 25% respectively. The oxa-1 gene encodes a class D beta-lactamase. It confers resistance to penicillins (such as amoxicillin) and clavulanic acid inhibitors on E. coli, hence the potential failure of Augmentin [8]. The detection of the blaOXA-1 gene in E. coli strains that are fully susceptible to beta-lactams (amoxicillin + clavulanic acid, ceftazidime, ceftriaxone and cefotaxime) could be explained by a defect in gene expression due to mutations in the promoter region or in the gene’s coding sequence [29]. As for theaac (6) gene, it encodes an enzyme that modifies aminoglycosides, thereby leading to resistance to several antibiotics in this class, including gentamicin [30].
The resistance rates obtained in this study relate solely to the group of strains previously identified as resistant. Thus, the majority of strains are more resistant to aminoglycosides than to penicillins. This suggests either frequent use of aminoglycosides or effective clonal or plasmid-mediated spread within the study area.
The 12.50% prevalence of the oxa-1 gene reported in this study is identical to that obtained in avian strains of E. coli in Ghana [31]. This prevalence is, however, higher than the 4% (1/25) reported on broiler chickens in Tunisia [17]. Our results are, however, considerably lower than those obtained in Senegal (59.37%) in a study screening for TEM, SHV and OXA-1 ESBL genes in E. coli strains [32].
Furthermore, the 25% prevalence of the aac (6’) gene identified in this study differs completely from the results reported by a study, which found no E. coli isolates positive for the aac (6’) gene on broiler farms in the peri-urban area of Dakar, Senegal [33]. Similarly, our findings report clearly higher prevalence rates than the 9.37% and 5.40% rates reported respectively in different studies in Algeria for avian strains of ESBL-producing E. coli harbouring the aac (6’)-Ib-cr variant [34], and in Nigeria during a study on broiler chickens and the poultry environment [35].
The association between these two resistance biomarkers, oxa-1 and aac (6), identified in this study reveals a multidrug-resistant (MDR) profile in the E. coli strains investigated. This co-occurrence of the two genes suggests co-selection of the two biomarkers. Indeed, these two resistance determinants to beta-lactams and aminoglycosides co-exist on the same plasmids or within genetic cassettes such as class 1 integrons in Enterobacteriaceae [36]. The co-occurrence of antibiotic resistance determinants has been reported in poultry farming by some authors. Indeed, associations involving the oxa-1 and aac (6) genes in avian E. coli isolates have been identified in Ghana [31]. Similarly, a co-presence of the aac (6) gene with other resistance markers in a study characterising multi-drug-resistant Enterobacteriaceae strains of avian origin has been found in western Algeria [34].
The co-presence of these two markers could compromise the efficacy of several last-resort antibiotics: the oxa-1 gene could confer resistance to combinations such as penicillin and beta-lactamase inhibitors, whilst the gene could neutralise crucial aminoglycosides.
The search for class 1 integrons (Int1) in E. coli strains that were phenotypically resistant to the antibiotics tested revealed a prevalence of 70.83% during this study. This result suggests that 70.83% of the phenotypic resistance observed is attributable to this genetic element, which acts as a system for the capture, expression and dissemination of genes in the form of cassettes. It plays a role in the dissemination of antibiotic resistance genes. Resistance in the other strains (29.17%) could be due to other classes of integrons or genetic mutations leading to a change in the antibiotic binding site, or to active efflux pumps [37][38]. The high prevalence of class 1 integrons (Int1) could considerably reduce the effectiveness of first-line antibiotic treatments, as these genetic elements promote the rapid spread of resistance not only to bacterial descendants but also to other bacterial species [39][40].
Similarly high rates of class 1 integrons (Int1) have also been reported in other studies. A prevalence of 49.8% in pathogenic avian strains of E. coli has been obtained in northern Italy [41], whereas prevalence rates of up to 72.70% in pathogenic E. coli strains isolated from broiler chickens have been found in southern Iran [17].
Furthermore, this study showed no significant association between the presence of class 1 integrons and the blaOXA-1 and aac (6’) resistance genes. This finding suggests that resistance to beta-lactams and aminoglycosides may be carried by plasmids or free integrons [42].
5. Conclusion
This study revealed that the 57 E. coli strains isolated from droppings collected from 14 broiler farms sampled in the Azaguié area were fully susceptible to beta-lactams and completely resistant to colistin (100 per cent), with confirmed carriage of the oxa-1 (12.50%) and aac (6) (25%). Although the prevalence of resistance determinants was low, the E. coli strains exhibited a high prevalence of class 1 integrons (Int1) (70.83%), suggesting a potential risk of resistance spreading within poultry farms in the Azaguié area.
Acknowledgements
We would like to express our gratitude to the poultry farmers’ group in the locality of Azaguié, who facilitated sampling at the various study sites. We would also like to thank the entire team at the laboratory of the Genetic Research and Teaching Unit at Université Félix Houphouët-Boigny in Côte d’Ivoire.
ReferencesMurray, C.J.L., Ikuta, K.S., Sharara, F., Swetschinski, L., Robles Aguilar, G., Gray, A., et al. (2022) Global Burden of Bacterial Antimicrobial Resistance in 2019: A Systematic Analysis. TheLancet, 399, 629-655. https://doi.org/10.1016/s0140-6736(21)02724-0 10.1016/s0140-6736(21)02724-035065702https://doi.org/10.1016/s0140-6736(21)02724-0Murray, C.J.L.Ikuta, K.S.Sharara, F.Swetschinski, L.Aguilar, G.Gray, A.2022Global Burden of Bacterial Antimicrobial Resistance in 2019: A Systematic AnalysisThe Lancet67362110.1016/s0140-6736(21)02724-035065702Van, T.T.H., Yidana, Z., Smooker, P.M. and Coloe, P.J. (2020) Antibiotic Use in Food Animals Worldwide, with a Focus on Africa: Pluses and Minuses. Journal of Global Antimicrobial Resistance, 20, 170-177. https://doi.org/10.1016/j.jgar.2019.07.031 10.1016/j.jgar.2019.07.03131401170https://doi.org/10.1016/j.jgar.2019.07.031Van, T.T.H.Yidana, Z.Smooker, P.M.Coloe, P.J.2020Antibiotic Use in Food Animals Worldwide, with a Focus on Africa: Pluses and MinusesJournal of Global Antimicrobial Resistance2010.1016/j.jgar.2019.07.03131401170Ibanga, I.A., Ekong, U.S., Akan, O.D., Akpabio, U. and Christopher, M. (2026) Antibiotic Resistance in Chicken Gut Bacteria: A Study on Bacterial Diversity and Drug Sensitivity in Some Nigerian Poultry Farms. BMC Microbiology, 26, Article No. 491. https://doi.org/10.1186/s12866-026-04972-2 10.1186/s12866-026-04972-2https://doi.org/10.1186/s12866-026-04972-2Ibanga, I.A.Ekong, U.S.Akan, O.D.Akpabio, U.Christopher, M.2026Antibiotic Resistance in Chicken Gut Bacteria: A Study on Bacterial Diversity and Drug Sensitivity in Some Nigerian Poultry FarmsBMC Microbiology26No10.1186/s12866-026-04972-2Lavigne, J.P. (2007) Effet des antibiotiques et mécanismes de résistance. Faculté de Médecine Montpellier, 5 p.Lavigne, J.P.2007Effet des antibiotiques et mécanismes de résistanceFaculté de Médecine Montpellier5Chabou, S., Leulmi, H., Davoust, B., Aouadi, A. and Rolain, J. (2018) Prevalence of Extended-Spectrum β-Lactamase-and Carbapenemase-Encoding Genes in Poultry Faeces from Algeria and Marseille, France. Journal of Global Antimicrobial Resistance, 13, 28-32. https://doi.org/10.1016/j.jgar.2017.11.002 10.1016/j.jgar.2017.11.00229138113https://doi.org/10.1016/j.jgar.2017.11.002Chabou, S.Leulmi, H.Davoust, B.Aouadi, A.Rolain, J.Marseille, F2018Prevalence of Extended-Spectrum β-Lactamase-and Carbapenemase-Encoding Genes in Poultry Faeces from Algeria and Marseille, FranceJournal of Global Antimicrobial Resistance1310.1016/j.jgar.2017.11.00229138113Mainardi, J.L. (2015) Mécanismes d’action et de résistance aux antibiotiques: Session interactive autour de l’antibiogramme. Document de formation/PPT. SPILF.Mainardi, J.L.2015Mécanismes d’action et de résistance aux antibiotiques: Session interactive autour de l’antibiogrammeGuillaumy, L. (2024) Antibiorésistance en Afrique de l’ouest: Émergence, luttes et enjeux. Thèse de doctorat, Aix Marseille Université, 115 p.Guillaumy, L.2024Antibiorésistance en Afrique de l’ouest: Émergence, luttes et enjeuxThèse de doctorat115Haouachi, R. (2018) Etude de la résistance aux antibiotiques des bactéries à gram négatif productrices de β-Lactamase à spectre étendu ou élargi au niveau du CHU-BENBADIS Constantine. Master’s Thesis, Université Frères Mentouri Constantine 1.Haouachi, R.Thesis, U2018Etude de la résistance aux antibiotiques des bactéries à gram négatif productrices de β-Lactamase à spectre étendu ou élargi au niveau du CHU-BENBADIS ConstantineMaster’s ThesisAkre, D.S.T., Okou, O.C., Koffi, A.E., Ebe, K.B. and Ackah, J.A.A.B. (2023) Prévalence et Phénotypes de Résistances aux Antibiotiques des Souches d’ Escherichiacoli responsables des diarrhées de veaux à daloa, Côte d’Ivoire. International Journal of Biological and Chemical Sciences, 16, 2685-2698. https://doi.org/10.4314/ijbcs.v16i6.18 10.4314/ijbcs.v16i6.18https://doi.org/10.4314/ijbcs.v16i6.18Akre, D.S.T.Okou, O.C.Koffi, A.E.Ebe, K.B.Ackah, J.A.A.B.2023Prévalence et Phénotypes de Résistances aux Antibiotiques des Souches d’Escherichia coli responsables des diarrhées de veaux à daloa, Côte d’IvoireInternational Journal of Biological and Chemical Sciences1610.4314/ijbcs.v16i6.18Gnali, G., Vakou, S., N’guessan Kouame, P.N.K., Adou, L., Yao, E., Tetty, M., et al. (2025) Prévalence de Salmonella et Escherichiacoli dans les élevages de porcs de Yopougon (Côte d’Ivoire). Revue africaine de santé et de productions animales, 3, 36-45. https://doi.org/10.46298/raspa.14942 10.46298/raspa.14942https://doi.org/10.46298/raspa.14942Gnali, G.Vakou, S.Kouame, P.N.K.Adou, L.Yao, E.Tetty, M.2025Prévalence de Salmonella et Escherichia coli dans les élevages de porcs de Yopougon (Côte d’Ivoire)Revue africaine de santé et de productions animales310.46298/raspa.14942M’Bari, B. and Gragnon, G. (2026) Prévalence du portage et profil d’antibiorésistance des souches d’ E. coli O157:H7 isolées chez des poules pondeuses issues des élevages avicoles modernes de la Commune de Bouaké (Centre de la Côte d’Ivoire): Etude préliminaire. Revueafricainedesantéetdeproductionsanimales, 3, 1-14. https://doi.org/10.46298/raspa.17023 10.46298/raspa.17023https://doi.org/10.46298/raspa.17023Bari, B.Gragnon, G.2026Prévalence du portage et profil d’antibiorésistance des souches d’Ecoli O157:H7 isolées chez des poules pondeuses issues des élevages avicoles modernes de la Commune de Bouaké (Centre de la Côte d’Ivoire): Etude préliminaire. Revue africaine de santé et de productions animales310.46298/raspa.17023Tahou, E.J., Kouadio, K.I., Ouattara, M.B., Touvoli, A.M., N’guetta, A.S.P. and Guessennd, K.N. (2025) Prevalence and Antibiotic Resistance in Escherichiacoli Strains Isolated from Poultry Farms in Azaguie, Côte d’Ivoire. World Journal of Advanced Research and Reviews, 26, 611-617. https://doi.org/10.30574/wjarr.2025.26.2.1186 10.30574/wjarr.2025.26.2.1186https://doi.org/10.30574/wjarr.2025.26.2.1186Tahou, E.J.Kouadio, K.I.Ouattara, M.B.Touvoli, A.M.Guessennd, K.N.Azaguie, C2025Prevalence and Antibiotic Resistance in Escherichia coli Strains Isolated from Poultry Farms in Azaguie, Côte d’IvoireWorld Journal of Advanced Research and Reviews2610.30574/wjarr.2025.26.2.1186Williams, R.B. (1995) Epidemiological Studies of Coccidiosis in the Domesticated Fowl ( Gallus gallus): II. Physical Condition and Survival of Eimeria acervulina Oocysts in Poultry-House Litter. Applied Parasitology, 36, 90-96.Williams, R.B.1995Epidemiological Studies of Coccidiosis in the Domesticated Fowl (Gallus gallus): IIPhysical Condition and Survival of Eimeria acervulina Oocysts in Poultry-House Litter. Applied Parasitology36CASFM (2023) Comité de l’antibiogramme de la Société Française de Microbiologie, Recommandations Vétérinaires 2023. 15 p.Microbiologie, R2023Comité de l’antibiogramme de la Société Française de Microbiologie, Recommandations Vétérinaires 2023Nnah, E.P., Asante, J., Amoako, D.G., Abia, A.L.K. and Essack, S.Y. (2025) Antibiotic-resistant Escherichiacoli ( E. coli) at One Health Interfaces in Africa: A Scoping Review. Science of the Total Environment, 958, Article ID: 177580. https://doi.org/10.1016/j.scitotenv.2024.177580 10.1016/j.scitotenv.2024.17758039642619https://doi.org/10.1016/j.scitotenv.2024.177580Nnah, E.P.Asante, J.Amoako, D.G.Abia, A.L.K.Essack, S.Y.2025Antibiotic-resistant Escherichia coli (Ecoli) at One Health Interfaces in Africa: A Scoping Review. Science of the Total Environment958177580ID10.1016/j.scitotenv.2024.17758039642619Kalantari, M., Sharifiyazdi, H., Asasi, K. and Abdi-Hachesoo, B. (2021) High Incidence of Multidrug Resistance and Class 1 and 2 Integrons in Escherichiacoli Isolated from Broiler Chickens in South of Iran. Veterinary Research Forum, 12, 101-107.Kalantari, M.Sharifiyazdi, H.Asasi, K.Abdi-Hachesoo, B.2021High Incidence of Multidrug Resistance and Class 1 and 2 Integrons in Escherichia coli Isolated from Broiler Chickens in South of IranVeterinary Research Forum12Soufi, L., Abbassi, M.S., Sáenz, Y., Vinué, L., Somalo, S., Zarazaga, M., et al. (2009) Prevalence and Diversity of Integrons and Associated Resistance Genes in Escherichiacoli Isolates from Poultry Meat in Tunisia. Foodborne Pathogens and Disease, 6, 1067-1073. https://doi.org/10.1089/fpd.2009.0284 10.1089/fpd.2009.028419642918https://doi.org/10.1089/fpd.2009.0284Soufi, L.Abbassi, M.S.Somalo, S.Zarazaga, M.2009Prevalence and Diversity of Integrons and Associated Resistance Genes in Escherichia coli Isolates from Poultry Meat in TunisiaFoodborne Pathogens and Disease610.1089/fpd.2009.028419642918Boutaiba, B.M. (2017) Antibiorésistance des entérobactéries d’origine aviaire au niveau de l’ouest Algérien. Master’s Thesis, Université IBN Khaldoun de Tiaret, 133 p.Boutaiba, B.M.Thesis, U2017Antibiorésistance des entérobactéries d’origine aviaire au niveau de l’ouest AlgérienMaster’s Thesis133Touglo, K., Djeri, B., Sina, H., Boya, B., Ayadokoun, G.G., Baba-Moussa, L., et al. (2025) First Detection of Resistance Genes and Virulence Factors in Escherichiacoli and Salmonellaspp in Togo: The Case of Imported Chicken and Frozen By-Products. BMC Microbiology, 25, Article No. 349. https://doi.org/10.1186/s12866-025-04076-3 10.1186/s12866-025-04076-340457192https://doi.org/10.1186/s12866-025-04076-3Touglo, K.Djeri, B.Sina, H.Boya, B.Ayadokoun, G.G.Baba-Moussa, L.2025First Detection of Resistance Genes and Virulence Factors in Escherichia coli and Salmonella spp in Togo: The Case of Imported Chicken and Frozen By-ProductsBMC Microbiology25No10.1186/s12866-025-04076-340457192Boutaiba Benklaouz, M., Aggad, H. and Benameur, Q. (2020) Resistance to Multiple First-Line Antibiotics among Escherichiacoli from Poultry in Western Algeria. Veterinary World, 13, 290-295. https://doi.org/10.14202/vetworld.2020.290-295 10.14202/vetworld.2020.290-29532255971https://doi.org/10.14202/vetworld.2020.290-295Benklaouz, M.Aggad, H.Benameur, Q.2020Resistance to Multiple First-Line Antibiotics among Escherichia coli from Poultry in Western AlgeriaVeterinary World1310.14202/vetworld.2020.290-29532255971Kolapo, A., Amosun, E., Olatoye, O., Adeoye, F. and Oladele, O. (2022) Escherichiacoli O157:H7 and Salmonella Species Isolated from Ducks and Indigenous Chickens in Live-Bird Markets in Ibadan, Oyo State, Nigeria. Veterinaria Italiana, 58, 369-378.Kolapo, A.Amosun, E.Olatoye, O.Adeoye, F.Oladele, O.Ibadan, OState, N2022Escherichia coli O157:H7 and Salmonella Species Isolated from Ducks and Indigenous Chickens in Live-Bird Markets in Ibadan, Oyo State, NigeriaVeterinaria Italiana58Rabia, A.Y., Tamani, T. and Amroun, S. (2023) Isolement, identification et antibiorésistance de souches d’ Escherichiacoli aviaires pathogènes. Master’s Thesis, Université Mouloud Mammeri de Tizi Ouzou, 68 p.Rabia, A.Y.Tamani, T.Amroun, S.Thesis, U2023Isolement, identification et antibiorésistance de souches d’Escherichia coli aviaires pathogènesMaster’s Thesis68Aberkane, C., Messaï, A., Messaï, C.R. and Boussaada, T. (2023) Antimicrobial Resistance Pattern of Avian Pathogenic Escherichiacoli with Detection of Extended-Spectrum β-Lactamase-Producing Isolates in Broilers in East Algeria. Veterinary World, 16, 449-454. https://doi.org/10.14202/vetworld.2023.449-454 10.14202/vetworld.2023.449-45437041836https://doi.org/10.14202/vetworld.2023.449-454Aberkane, C.Boussaada, T.2023Antimicrobial Resistance Pattern of Avian Pathogenic Escherichia coli with Detection of Extended-Spectrum β-Lactamase-Producing Isolates in Broilers in East AlgeriaVeterinary World1610.14202/vetworld.2023.449-45437041836Tang, B., Wang, J., Zheng, X., Chang, J., Ma, J., Wang, J., et al. (2022) Antimicrobial Resistance Surveillance of Escherichiacoli from Chickens in the Qinghai Plateau of China. Frontiers in Microbiology, 13, Article 885132. https://doi.org/10.3389/fmicb.2022.885132 10.3389/fmicb.2022.88513235935206https://doi.org/10.3389/fmicb.2022.885132Tang, B.Wang, J.Zheng, X.Chang, J.Ma, J.Wang, J.2022Antimicrobial Resistance Surveillance of Escherichia coli from Chickens in the Qinghai Plateau of ChinaFrontiers in Microbiology1388513210.3389/fmicb.2022.88513235935206Oubouyahia, L. and Nassik, S. (2021). Colibacillose aviaire au Maroc: Infection redoutable à double impact. Revue Marocaine des Sciences Agronomiques et Vétérinaires, 9, 383-389.Oubouyahia, L.Nassik, S.2021Vounba, P., Rhouma, M., Arsenault, J., Bada Alambédji, R., Fravalo, P. and Fairbrother, J.M. (2019) Prevalence of Colistin Resistance and mcr-1/mcr-2 Genes in Extended-Spectrum β-Lactamase/AmpC-Producing Escherichiacoli Isolated from Chickens in Canada, Senegal and Vietnam. Journal of Global Antimicrobial Resistance, 19, 222-227. https://doi.org/10.1016/j.jgar.2019.05.002 10.1016/j.jgar.2019.05.00231100501https://doi.org/10.1016/j.jgar.2019.05.002Vounba, P.Rhouma, M.Arsenault, J.Fravalo, P.Fairbrother, J.M.Canada, S2019Prevalence of Colistin Resistance and mcr-1/mcr-2 Genes in Extended-Spectrum β-Lactamase/AmpC-Producing Escherichia coli Isolated from Chickens in Canada, Senegal and VietnamJournal of Global Antimicrobial Resistance1910.1016/j.jgar.2019.05.00231100501Dosso, M., Bissagnene, E., Coulibaly, M., Paye, H.K., N’Douba, A., Guessennd, N., et al. (2000) Résistances acquises et prescriptions d’antibiotiques en Afrique: Quelles adéquations? MédecineetMaladies Infectieuses, 30, s197-s204. https://doi.org/10.1016/s0399-077x(00)89090-3 10.1016/s0399-077x(00)89090-3https://doi.org/10.1016/s0399-077x(00)89090-3Dosso, M.Bissagnene, E.Coulibaly, M.Paye, H.K.Douba, A.Guessennd, N.2000Résistances acquises et prescriptions d’antibiotiques en Afrique: Quelles adéquations? Médecine et Maladies Infectieuses, 30, s197-s20410.1016/s0399-077x(00)89090-3Delville, A. (2021) Les résistances bactériennes aux fluoroquinolones. Sciences pharmaceutiques. Thèse de doctorat, Universite de Picardie Jules Verne, 63 p.Delville, A.2021Les résistances bactériennes aux fluoroquinolonesSciences pharmaceutiques. Thèse de doctorat63Vale, A.P., Shubin, L., Cummins, J., Leonard, F.C. and Barry, G. (2021) Detection of blaOXA-1, blaTEM-1, and Virulence Factors in E. coli Isolated from Seals. Frontiers in Veterinary Science, 8, Article 583759. https://doi.org/10.3389/fvets.2021.583759 10.3389/fvets.2021.58375933763460https://doi.org/10.3389/fvets.2021.583759Vale, A.P.Shubin, L.Cummins, J.Leonard, F.C.Barry, G.2021Detection of blaOXA-1, blaTEM-1, and Virulence Factors in Ecoli Isolated from Seals. Frontiers in Veterinary Science858375910.3389/fvets.2021.58375933763460Guillard, T. and Cambau, E. (2012) Une brève histoire des résistances plasmidiques aux quinolones. JournaldesAnti-infectieux, 15, 1-8. https://doi.org/10.1016/j.antinf.2013.02.002 10.1016/j.antinf.2013.02.002https://doi.org/10.1016/j.antinf.2013.02.002Guillard, T.Cambau, E.2012Une brève histoire des résistances plasmidiques aux quinolonesJournal des Anti-infectieux1510.1016/j.antinf.2013.02.002Okyere, I.J., Semevor, G.O., Ablordey, A., Johnson, S. and Donkor, E.S. (2026) Genomic Profiling of Extended-Spectrum β-Lactamase-Producing Escherichiacoli Isolated from Poultry and Poultry Farm Workers in Accra, Ghana. Scientific Reports, 16, Article No. 7400. https://doi.org/10.1038/s41598-026-36471-9 10.1038/s41598-026-36471-9https://doi.org/10.1038/s41598-026-36471-9Okyere, I.J.Semevor, G.O.Ablordey, A.Johnson, S.Donkor, E.S.Accra, G2026Genomic Profiling of Extended-Spectrum β-Lactamase-Producing Escherichia coli Isolated from Poultry and Poultry Farm Workers in Accra, GhanaScientific Reports16No10.1038/s41598-026-36471-9Diagne, R., Diallo, A.A., Ka, R., Ngom, B., Lo, S., Dia, M.L., et al. (2019) Antimicrobial Resistance and Characterization of Broad-Spectrum Batalactamases and Quinolone Resistance Genes of Urinary E. coli Isolated in Senegal between 2009 and 2017. Journal of Bacteriology and Mycology, 6, Article 1106.Diagne, R.Diallo, A.A.Ka, R.Ngom, B.Lo, S.Dia, M.L.2019Antimicrobial Resistance and Characterization of Broad-Spectrum Batalactamases and Quinolone Resistance Genes of Urinary Ecoli Isolated in Senegal between 2009 and 2017. Journal of Bacteriology and Mycology61106Vounba P. (2012) Prévalence des gènes de virulence et d’antibiorésistance des Escherichiacoli dans les fermes de poulets de chair de la zone péri-urbaine de Dakar (Sénégal). Master’s Thesis, Université Cheikh Anta Diop de Dakar, 45 p.Thesis, U2012Prévalence des gènes de virulence et d’antibiorésistance des Escherichia coli dans les fermes de poulets de chair de la zone péri-urbaine de Dakar (Sénégal)Master’s Thesis45Boutaiba, B.M. (2023) Caractérisation des souches d’entérobactéries multirésistantes d’origine aviaire au niveau de l’ouest Algérien. Ph.D. Thesis, Université Ibn Khaldoun-Tiaret, 178 p.Boutaiba, B.M.Thesis, U2023Caractérisation des souches d’entérobactéries multirésistantes d’origine aviaire au niveau de l’ouest AlgérienPh.D. Thesis178Aworh, M.K., Kwaga, J., Okolocha, E., Harden, L., Hull, D., Hendriksen, R.S., et al. (2020) Extended-Spectrum ß-Lactamase-Producing Escherichiacoli among Humans, Chickens and Poultry Environments in Abuja, Nigeria. One Health Outlook, 2, Article No. 8. https://doi.org/10.1186/s42522-020-00014-7 10.1186/s42522-020-00014-733829130https://doi.org/10.1186/s42522-020-00014-7Aworh, M.K.Kwaga, J.Okolocha, E.Harden, L.Hull, D.Hendriksen, R.S.Humans, CAbuja, N2020Extended-Spectrum ß-Lactamase-Producing Escherichia coli among Humans, Chickens and Poultry Environments in Abuja, NigeriaOne Health Outlook2No10.1186/s42522-020-00014-733829130Petitjean, M. (2018) Évolution génotypique et phénotypique d’une souche épidémique de Pseudomonas aerugi-nosa au cours des 11 ans de sa diffusion hospitalière. Bactériologie. Université Bourgogne Franche-Comté, 164 p.Petitjean, M.2018Évolution génotypique et phénotypique d’une souche épidémique de Pseudomonas aerugi-nosa au cours des 11 ans de sa diffusion hospitalièreBactériologie. Université Bourgogne Franche-Comté164Mkaouar, D., Mahjoubi, F., Mezghani, S., Znazen, A., Ktari, S. and Hammami, A. (2008) Étude de la résistance des entérobactéries aux céphalosporines de troisième génération dans les hôpitaux de Sfax, Tunisie (1999-2005). MédecineetMaladies Infectieuses, 38, 293-298. https://doi.org/10.1016/j.medmal.2007.11.017 10.1016/j.medmal.2007.11.01718191516https://doi.org/10.1016/j.medmal.2007.11.017Mkaouar, D.Mahjoubi, F.Mezghani, S.Znazen, A.Ktari, S.Hammami, A.Sfax, T2008Étude de la résistance des entérobactéries aux céphalosporines de troisième génération dans les hôpitaux de Sfax, Tunisie (1999-2005)Médecine et Maladies Infectieuses3810.1016/j.medmal.2007.11.01718191516Sabbagh, P., Rajabnia, M., Maali, A. and Ferdosi-Shahandashti, E. (2021) Integron and Its Role in Antimicrobial Resistance: A Literature Review on Some Bacterial Pathogens. Iranian Journal of Basic Medical Sciences, 24, 136-142. https://doi.org/10.22038/ijbms.2020.48905.11208 10.22038/ijbms.2020.48905.1120833953851https://doi.org/10.22038/ijbms.2020.48905.11208Sabbagh, P.Rajabnia, M.Maali, A.Ferdosi-Shahandashti, E.2021Integron and Its Role in Antimicrobial Resistance: A Literature Review on Some Bacterial PathogensIranian Journal of Basic Medical Sciences2410.22038/ijbms.2020.48905.1120833953851Gillings, M., Boucher, Y., Labbate, M., Holmes, A., Krishnan, S., Holley, M., et al. (2008) The Evolution of Class 1 Integrons and the Rise of Antibiotic Resistance. Journal of Bacteriology, 190, 5095-5100. https://doi.org/10.1128/jb.00152-08 10.1128/jb.00152-0818487337https://doi.org/10.1128/jb.00152-08Gillings, M.Boucher, Y.Labbate, M.Holmes, A.Krishnan, S.Holley, M.2008The Evolution of Class 1 Integrons and the Rise of Antibiotic ResistanceJournal of Bacteriology19010.1128/jb.00152-0818487337Zhang, A.N., Li, L., Ma, L., Gillings, M.R., Tiedje, J.M. and Zhang, T. (2018) Conserved Phylogenetic Distribution and Limited Antibiotic Resistance of Class 1 Integrons Revealed by Assessing the Bacterial Genome and Plasmid Collection. Microbiome, 6, Article No. 130. https://doi.org/10.1186/s40168-018-0516-2 10.1186/s40168-018-0516-230031405https://doi.org/10.1186/s40168-018-0516-2Zhang, A.N.Li, L.Ma, L.Gillings, M.R.Tiedje, J.M.Zhang, T.2018Conserved Phylogenetic Distribution and Limited Antibiotic Resistance of Class 1 Integrons Revealed by Assessing the Bacterial Genome and Plasmid CollectionMicrobiome6No10.1186/s40168-018-0516-230031405Cavicchio, L., Dotto, G., Giacomelli, M., Giovanardi, D., Grilli, G., Franciosini, M.P., et al. (2015) Class 1 and Class 2 Integrons in Avian Pathogenic Escherichiacoli from Poultry in Italy. Poultry Science, 94, 1202-1208. https://doi.org/10.3382/ps/pev095 10.3382/ps/pev09525840964https://doi.org/10.3382/ps/pev095Cavicchio, L.Dotto, G.Giacomelli, M.Giovanardi, D.Grilli, G.Franciosini, M.P.2015Class 1 and Class 2 Integrons in Avian Pathogenic Escherichia coli from Poultry in ItalyPoultry Science9410.3382/ps/pev09525840964Vounba P. (2018) Pathogénicité potentielle et résistance antimicrobienne des Escherichiacoli isolés des poulets au Sénégal, au Canada (Québec) et au Vietnam. Thèse de Doctorat, Université de Montréal, 322 p.Doctorat, U2018Pathogénicité potentielle et résistance antimicrobienne des Escherichia coli isolés des poulets au Sénégal, au Canada (Québec) et au VietnamThèse de Doctorat322