<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.4 20241031//EN" "JATS-journalpublishing1-4.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.4" xml:lang="en">
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">ajps</journal-id>
      <journal-title-group>
        <journal-title>American Journal of Plant Sciences</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2158-2750</issn>
      <issn pub-type="ppub">2158-2742</issn>
      <publisher>
        <publisher-name>Scientific Research Publishing</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.4236/ajps.2026.179058</article-id>
      <article-id pub-id-type="publisher-id">ajps-154267</article-id>
      <article-categories>
        <subj-group>
          <subject>Article</subject>
        </subj-group>
        <subj-group>
          <subject>Biomedical</subject>
          <subject>Life Sciences</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Molecular Identification of Organisms from Tomato (Solanum lycopersicum) Collected from Choba Market, Rivers State, Nigeria</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name name-style="western">
            <surname>Akiti</surname>
            <given-names>Famous Ovworayini</given-names>
          </name>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author" corresp="yes">
          <name name-style="western">
            <surname>Chuku</surname>
            <given-names>Sobomate</given-names>
          </name>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name name-style="western">
            <surname>Jude</surname>
            <given-names>Keayiabarido</given-names>
          </name>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name name-style="western">
            <surname>Uzoma</surname>
            <given-names>Miracle</given-names>
          </name>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name name-style="western">
            <surname>Bakpo</surname>
            <given-names>Emmanuel</given-names>
          </name>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author" corresp="yes">
          <name name-style="western">
            <surname>Numbere</surname>
            <given-names>Aroloye</given-names>
          </name>
          <xref ref-type="aff" rid="aff1">1</xref>
          <xref ref-type="aff" rid="aff2">2</xref>
        </contrib>
      </contrib-group>
      <aff id="aff1"><label>1</label> Biology and Biotechnology, School of Laboratory Science and Technology, University of Port Harcourt, Choba, Nigeria </aff>
      <aff id="aff2"><label>2</label> Animal and Environmental Biology, University of Port Harcourt, Choba, Nigeria </aff>
      <author-notes>
        <fn fn-type="conflict" id="fn-conflict">
          <p>The authors declare no conflicts of interest regarding the publication of this paper.</p>
        </fn>
      </author-notes>
      <pub-date pub-type="epub">
        <day>09</day>
        <month>09</month>
        <year>2026</year>
      </pub-date>
      <pub-date pub-type="collection">
        <month>09</month>
        <year>2026</year>
      </pub-date>
      <volume>17</volume>
      <issue>09</issue>
      <fpage>956</fpage>
      <lpage>969</lpage>
      <history>
        <date date-type="received">
          <day>10</day>
          <month>06</month>
          <year>2026</year>
        </date>
        <date date-type="accepted">
          <day>26</day>
          <month>09</month>
          <year>2026</year>
        </date>
        <date date-type="published">
          <day>29</day>
          <month>09</month>
          <year>2026</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>© 2026 by the authors and Scientific Research Publishing Inc.</copyright-statement>
        <copyright-year>2026</copyright-year>
        <license license-type="open-access">
          <license-p> This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license ( <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">https://creativecommons.org/licenses/by/4.0/</ext-link> ). </license-p>
        </license>
      </permissions>
      <self-uri content-type="doi" xlink:href="https://doi.org/10.4236/ajps.2026.179058">https://doi.org/10.4236/ajps.2026.179058</self-uri>
      <abstract>
        <p>Tomatoes (<italic>Solanum lycopersicum</italic>) are highly nutritious but prone to microbial contamination due to their high moisture content. This study investigated fungal species associated with tomatoes sold in three markets in Choba (TO1 - TO3), evaluated potential health risks, and provided molecular data relevant to food safety. Tomato samples from three different markets (n = 3 × 10) were cultured on Potato Dextrose Agar (PDA) and examined using morphological, microscopic, and molecular techniques. Distinct colonies were characterized, and DNA was extracted for amplification of the Internal Transcribed Spacer (ITS) region using Polymerase Chain Reaction (PCR) followed by Sanger sequencing. Phylogenetic analysis was used to determine evolutionary relationships among isolates. Results indicated a high fungal load, with colony counts ranging from 50 to too numerous to count (TNTC). Morphological and microscopic observations revealed predominant fungi as <italic>Aspergillus niger</italic>, <italic>Mucor spp</italic>., and yeast-like species. Molecular identification revealed that isolates were closely related to <italic>Fusarium verticillioides</italic>,<italic>Geotrichum candidum</italic>, and <italic>Puccinia brachypodii</italic>, with sequence similarities of 87.7%, 99.6%, and 88.8%, respectively. Phylogenetic tree analysis showed these identifications and highlighted potential spoilage and health risks associated with the isolates. The low percentages derived may be due to small sample size and limited sequencing. This study demonstrates that tomatoes from Port Harcourt markets may harbor diverse fungal species capable of reducing fruit quality and posing health risks to consumers. Next study will consider increasing the sample size, conducting the experiments in a more aseptic condition and conducting more sequencing.</p>
      </abstract>
      <kwd-group kwd-group-type="author-generated" xml:lang="en">
        <kwd>Bacteria</kwd>
        <kwd>DNA Sequencing</kwd>
        <kwd>Fungal Infection</kwd>
        <kwd>Phylogenetic Tree</kwd>
        <kwd>Spoilage</kwd>
        <kwd>Tomatoes</kwd>
      </kwd-group>
    </article-meta>
  </front>
  <body>
    <sec id="sec1">
      <title>1. Introduction</title>
      <p>Tomato (<italic>Solanum lycopersicum</italic>), a member of the Solanaceae family, is one of the most widely cultivated and consumed vegetable crops globally and serves as a major component of human diets due to its high nutritional content [<xref ref-type="bibr" rid="B1">1</xref>]. In Nigeria, tomato remains a staple vegetable frequently consumed across various regions and socio-economic classes, often eaten raw in salads, cooked in stews, or processed into pastes and sauces [<xref ref-type="bibr" rid="B2">2</xref>]. Its popularity stems from its health benefits, which include being a rich source of antioxidants such as lycopene, vitamins A, C, and E, flavonoids, folic acid, potassium, and dietary fiber—all of which contribute to reducing the risk of chronic illnesses like cardiovascular diseases, cancer, and diabetes [<xref ref-type="bibr" rid="B3">3</xref>].</p>
      <p>Despite its importance, tomato is highly perishable and susceptible to microbial spoilage, especially in tropical environments like Nigeria where high humidity and temperatures provide ideal conditions for microbial growth [<xref ref-type="bibr" rid="B4">4</xref>]. The short shelf-life of tomatoes is attributed to both physical injuries during harvest and post-harvest handling as well as microbial contamination from various sources including soil, irrigation water, human handling, storage equipment, and transport systems [<xref ref-type="bibr" rid="B5">5</xref>]. These sources often introduce a wide array of spoilage and pathogenic microorganisms onto the surface and internal tissues of tomatoes, potentially leading to foodborne illnesses when consumed raw or undercooked [<xref ref-type="bibr" rid="B6">6</xref>].</p>
      <p>The global burden of foodborne illnesses remains a significant public health concern, and the World Health Organization (WHO) has consistently emphasized the importance of improving food safety, particularly in developing countries where regulatory frameworks are weak and hygienic standards are often poorly enforced [<xref ref-type="bibr" rid="B7">7</xref>]. In Nigeria, the microbial safety of fresh produce such as tomatoes is of growing concern due to the frequent detection of pathogenic organisms like <italic>Escherichia coli</italic>, <italic>Salmonella spp.</italic>, <italic>Staphylococcus aureus</italic>, <italic>Fusarium spp.</italic>, and <italic>Aspergillus spp.</italic> on tomatoes sold in open markets [<xref ref-type="bibr" rid="B8">8</xref>]. These organisms can cause serious diseases ranging from gastrointestinal infections to more severe complications such as hemolytic uremic syndrome, especially in children, the elderly, and immunocompromised individuals [<xref ref-type="bibr" rid="B9">9</xref>].</p>
      <p>Traditionally, microbial identification has been conducted using culture-dependent techniques involving the growth of organisms on selective and differential media followed by biochemical tests [<xref ref-type="bibr" rid="B10">10</xref>]. Although these methods are inexpensive and accessible, they are often limited in scope, time-consuming, and incapable of detecting viable but non-culturable (VBNC) organisms or distinguishing closely related microbial species [<xref ref-type="bibr" rid="B11">11</xref>]. Moreover, culture-based techniques often fail to provide sufficient resolution to characterize the genetic diversity and phylogenetic relationships among microorganisms, which are essential for effective microbial surveillance and control [<xref ref-type="bibr" rid="B9">9</xref>].</p>
      <p>To overcome these limitations, molecular techniques have been increasingly adopted in microbial studies due to their speed, sensitivity, specificity, and ability to detect a broader range of microbial taxa, including unculturable organisms [<xref ref-type="bibr" rid="B12">12</xref>]. These techniques rely on the analysis of nucleic acids (DNA or RNA) to identify and classify organisms based on their genetic signatures. Polymerase Chain Reaction (PCR), quantitative PCR (qPCR), and DNA sequencing of conserved regions such as the 16S rRNA gene for bacteria and Internal Transcribed Spacer (ITS) regions for fungi have revolutionized microbial taxonomy and diagnostics [<xref ref-type="bibr" rid="B13">13</xref>]. These tools allow for the accurate detection and identification of microbial communities at species and even strain levels, offering better insights into the microbial ecology of food systems.</p>
      <p>The aim of this study is to molecularly identify the microorganisms associated with tomatoes sold in markets within Port Harcourt, Nigeria. The study focuses on identifying fungal species responsible for spoilage and contamination.</p>
      <p>The objectives of the study include the following: </p>
      <p>1) To carry out morphological identification of fungal species in spoilt tomatoes collected from the market;</p>
      <p>2) To conduct a molecular identification of fungal species in spoilt tomatoes collected from the market;</p>
      <p>3) To assess the safety risk of spoilage of tomatoes retrieved from the market.</p>
    </sec>
    <sec id="sec2">
      <title>2. Materials and Method</title>
      <sec id="sec2dot1">
        <title>2.1. Study Design</title>
        <p>This research adopted an experimental laboratory design. The study was conducted in two major phases: the morphological and microscopic characterization phase, and the molecular analysis phase. The laboratory investigations were carried out at the Microbiology Laboratory of the University of Port Harcourt, while molecular characterization was conducted at MyAfroDNA Laboratory, Port Harcourt. The design of this study was selected to ensure accurate identification of spoilage fungi through both traditional and molecular approaches.</p>
      </sec>
      <sec id="sec2dot2">
        <title>2.2. Sample Collection and Preparation</title>
        <p>All the tomatoes samples (n = 30) used were obtained in their fresh form at Choba. Each sample was placed in sterile polythene bags and transported to the Microbiology Laboratory within two hours of collection. In the laboratory, the tomato samples were first washed with sterile distilled water to remove dirt and debris. The surface of each tomato was then sterilized with 70% ethanol for two minutes and rinsed with sterile distilled water to eliminate transient surface microorganisms [<xref ref-type="bibr" rid="B14">14</xref>]. After sterilization, the samples were aseptically sliced using sterile scalpels and crushed with sterile mortar and pestle to obtain a homogenized pulp, which was later used for fungal isolation before carrying out further Laboratory analysis following the example of Senadheera <italic>et al</italic><italic>.</italic> [<xref ref-type="bibr" rid="B15">15</xref>]. Each tomato sample was appropriately labeled to ensure proper identification throughout the experiment. The isolates were designated as TO1, TO2, and TO3, representing samples obtained from the different markets in Choba.</p>
      </sec>
      <sec id="sec2dot3">
        <title>2.3. Reagents and Materials</title>
        <p>All reagents and materials used for this study were obtained from Sigma-Aldrich, USA, and BDH Chemicals, England. Materials used included sterile bowls, calibrated test tubes, Petri dishes, inoculating loops, Bunsen burner, test tube racks, spreader, weighing balance, volumetric flasks, and syringes. Reagents and chemicals included Potato Dextrose Agar (PDA), normal saline, ethanol (70%), distilled water, aluminium foil, cotton plugs, filter papers, and lactophenol cotton blue stain. A light microscope (Olympus CX23) was used for microscopic observation of fungal structures. Other essential equipment included an autoclave (TOMY SX-700, Japan) for sterilization and a NanoDrop spectrophotometer (Thermo Fisher Scientific, USA) for DNA quantification during molecular analysis.</p>
      </sec>
      <sec id="sec2dot4">
        <title>2.4. Sterilization Procedures</title>
        <p>All glassware, reagents, and materials were sterilized before use to prevent contamination. Petri dishes, conical flasks, and test tubes were wrapped in aluminium foil and sterilized using an autoclave at a temperature of 121˚C and a pressure of 15 psi for 15 minutes. The working surfaces of the laboratory benches were wiped thoroughly with 70% ethanol before and after use to maintain aseptic conditions. All inoculating loops and needles were flame-sterilized using a Bunsen burner before and after each inoculation. The culture medium was sterilized separately in the autoclave and dispensed aseptically into Petri dishes within a laminar flow cabinet to avoid contamination [<xref ref-type="bibr" rid="B16">16</xref>].</p>
      </sec>
      <sec id="sec2dot5">
        <title>2.5. Serial Dilution</title>
        <p>The fresh tomatoes were allowed to stay for a period of 3 - 5 days, when spoilage was noticed. A tenfold serial dilution technique was used to reduce the microbial population for effective isolation of distinct fungal colonies. One gram of homogenized tomato pulp was transferred into 9 mL of sterile normal saline to obtain a 10<sup>−</sup><sup>1</sup> dilution. From this suspension, 1 mL was transferred into another 9 mL of sterile saline to produce a 10<sup>−</sup><sup>2</sup> dilution, and the process was repeated serially up to 10<sup>−</sup><sup>4</sup>. Aliquots of 0.1 mL from 10<sup>−</sup><sup>2</sup>, 10<sup>−</sup><sup>3</sup>, and 10<sup>−</sup><sup>4</sup> dilutions were then plated on freshly prepared Potato Dextrose Agar plates using the spread plate method to ensure uniform distribution of spores and mycelia fragments, while streaking method was used alongside the spread plate to isolate the microbial type in the samples as described by Murgia <italic>et al</italic><italic>.</italic> [<xref ref-type="bibr" rid="B17">17</xref>].</p>
      </sec>
      <sec id="sec2dot6">
        <title>2.6. Media Preparation</title>
        <p>Potato Dextrose Agar (PDA) was used for the cultivation and isolation of fungi. A total of 39 grams of PDA powder was weighed and dissolved in 1 liter of distilled water in a conical flask. The mixture was stirred continuously and gently heated until it completely dissolved. The prepared medium was then sterilized in an autoclave at 121˚C for 15 minutes. After sterilization, the medium was allowed to cool to approximately 45˚C before being poured aseptically into sterile Petri dishes (about 20 mL per plate) and left to solidify under sterile conditions [<xref ref-type="bibr" rid="B17">17</xref>].</p>
      </sec>
      <sec id="sec2dot7">
        <title>2.7. Culturing and Isolation of Fungi</title>
        <p>Each plate was inoculated with 0.1 mL of the appropriate dilution and spread evenly using a sterile glass spreader. The plates were then incubated in an inverted position at 28˚C for five to seven days. Fungal colonies began to appear after 48 hours and were observed daily for changes in morphology, colour, texture, and sporulation. Distinct colonies were picked and sub-cultured on freshly prepared PDA plates to obtain pure cultures. These pure isolates were used for both morphological identification and subsequent molecular studies [<xref ref-type="bibr" rid="B17">17</xref>].</p>
      </sec>
      <sec id="sec2dot8">
        <title>2.8. Sub-Culturing and Preservation of Pure Cultures</title>
        <p>Sub-culturing was done to obtain pure fungal cultures. Individual colonies with distinct characteristics were picked using a sterile inoculating loop and streaked onto fresh PDA plates. The plates were incubated at 28˚C for 3 - 5 days to allow sufficient growth. Pure cultures were maintained on PDA slants in universal bottles, covered with cotton plugs, and stored at 4˚C for preservation until further analysis [<xref ref-type="bibr" rid="B18">18</xref>].</p>
      </sec>
      <sec id="sec2dot9">
        <title>2.9. Morphological and Microscopic Identification</title>
        <p>The fungal isolates were characterized based on both macroscopic and microscopic features. Macroscopic examination involved observation of colony colour, surface texture, margin shape, and spore formation on PDA plates. Microscopic examination was conducted using the lactophenol cotton blue staining technique. A small portion of the fungal mycelium was placed on a clean glass slide, stained with a drop of lactophenol cotton blue, and covered with a cover slip. The prepared slides were observed under the microscope at ×40 magnification. The arrangement of hyphae, shape of conidia, and other diagnostic features were recorded and compared with standard descriptions in fungal identification manuals.</p>
      </sec>
      <sec id="sec2dot10">
        <title>2.10. Molecular Analysis</title>
        <p>The molecular characterization of the isolates involved DNA extraction, PCR amplification, gel electrophoresis, sequencing, and phylogenetic analysis. DNA was extracted using the ZymoBIOMICS DNA Microprep Kit following the manufacturer’s protocol. Fungal cells were lysed mechanically using ZR Bashing Beads, and DNA was isolated through a series of lysis, washing, and elution steps. The extracted DNA was quantified using a NanoDrop spectrophotometer, and purity was determined by measuring absorbance at 260 nm and 280 nm. PCR amplification of the Internal Transcribed Spacer (ITS) region was performed using universal primers ITS1 and ITS2. The reaction mixture contained template DNA, primers, and FirePol Master Mix in a total volume of 20 µL. The amplification conditions consisted of initial denaturation at 95˚C for 5 minutes, followed by 35 cycles of denaturation at 95˚C for 30 seconds, annealing at 55˚C for 30 seconds, and extension at 72˚C for one minute, with a final extension at 72˚C for 5 minutes. The amplified DNA fragments were separated on 2% agarose gel prepared in 1 × TBE buffer containing Safe Green stain, and the results were visualized under a UV transilluminator.</p>
        <p>Purified PCR products were sent for sequencing using the BigDye<sup>TM</sup> Direct Cycle Sequencing Kit. The resulting sequences were analyzed using ChromasLite and BioEdit software. Species identification was achieved through sequence comparison with existing data in the NCBI BLAST database. Multiple sequence alignment was performed using ClustalW, while phylogenetic relationships were established using MEGA11 software through the Neighbor-Joining method with 500 bootstrap replications.</p>
      </sec>
      <sec id="sec2dot11">
        <title>2.11. Data Analysis</title>
        <p>All data obtained from the morphological, microscopic, and molecular analyses were analyzed using descriptive statistics. DNA concentration and purity values were expressed as mean ± standard deviation, while fungal identity was determined based on percentage similarity from BLAST results (<bold>Appendix</bold>). Comparative analysis was also made between the morphological characteristics observed in this study and those reported in previous research to establish species confirmation. The data were presented in the form of tables, figures, and phylogenetic trees to illustrate the relationships between the isolates obtained.</p>
      </sec>
    </sec>
    <sec id="sec3">
      <title>3. Results</title>
      <sec id="sec3dot1">
        <title>3.1. Culturing Observations</title>
        <p>The culturing of tomato samples on Potato Dextrose Agar (PDA) revealed significant fungal growth after 72 hours of incubation at 28˚C. Distinct colonies were observed across different dilution plates (10<sup>2</sup>, 10<sup>3</sup>, and 10<sup>4</sup>). The plate count results showed that colonies were <italic>Too Numerous</italic><italic>To</italic><italic>Count</italic>(<italic>TNTC</italic>) on the 10<sup>2</sup> dilution plate, while the 10<sup>3</sup> dilution recorded 75 and 85 colonies for the first and second replicates respectively (<bold>Table 1</bold>). The 10<sup>4</sup> dilution yielded fewer colonies, with counts of 50 and 80 for the replicates. This means the higher the dilutions, the fewer the colony counts. This result indicates that the samples harbored a high fungal load, especially in the lower dilutions, reflecting substantial microbial contamination in the tomato samples obtained from Choba Markets.</p>
        <p>The macroscopic observation of the fungal colonies revealed different cultural characteristics that facilitated preliminary identification. Isolate TO1 developed black colonies with a cream reverse, a cream-colored margin, and dense black spores without surface cracks. Isolate TO2 showed a white colony with a cream reverse and dry powdery surface. Isolate TO3 produced white colonies with cream margins, non-cracked surfaces, and a yeast-like texture (<xref ref-type="fig" rid="fig1">Figure 1</xref>).</p>
        <p><bold>Table 1.</bold>Plate count results on PDA medium.</p>
        <table-wrap id="tbl1">
          <label>Table 1</label>
          <table>
            <tbody>
              <tr>
                <td>
                  <bold>Dilution</bold>
                </td>
                <td>
                  <bold>Replicate 1</bold>
                </td>
                <td>
                  <bold>Replicate 2</bold>
                </td>
              </tr>
              <tr>
                <td>
                  10
                  <sup>2</sup>
                </td>
                <td>TNTC</td>
                <td>TNTC</td>
              </tr>
              <tr>
                <td>
                  10
                  <sup>3</sup>
                </td>
                <td>75</td>
                <td>85</td>
              </tr>
              <tr>
                <td>
                  10
                  <sup>4</sup>
                </td>
                <td>50</td>
                <td>80</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
        <fig id="fig1">
          <label>Figure 1</label>
          <graphic xlink:href="https://html.scirp.org/file/2606322-rId13.jpeg?20260929113608" />
        </fig>
        <p><bold>Figure 1.</bold> Colony Morphology of Fungal Isolates on PDA after 72 Hours of Incubation. (a) TO1: Presence of black spores in septate hyphae; (b) TO2: Presence of oval-shaped spores with powdery surface) TO3: showed oval yeast cells that stained purple<bold>.</bold></p>
      </sec>
      <sec id="sec3dot2">
        <title>3.2. Microscopy</title>
        <p>Microscopic examination using lactophenol cotton blue staining revealed distinct structural features that revealed a preliminary identification of the fungal isolates. Isolate TO1 showed septate hyphae bearing conidiophores and black spores characteristic of <italic>Aspergillus niger</italic>. Isolate TO2 exhibited oval-shaped conidia arranged singly, corresponding to <italic>Mucor</italic> morphology. Isolate TO3 showed oval yeast cells that stained purple, suggesting <italic>Geotrichum</italic> or <italic>Candida</italic>-like yeast (<xref ref-type="fig" rid="fig2">Figure 2</xref>). These preliminary microscopic findings complemented the macroscopic characteristics and provided the basis for subsequent molecular identification.</p>
        <fig id="fig2">
          <label>Figure 2</label>
          <graphic xlink:href="https://html.scirp.org/file/2606322-rId14.jpeg?20260929113609" />
        </fig>
        <p><bold>Figure 2.</bold> Microscopic View of Fungal Isolates using Lactophenol Cotton Blue Stain. (a) TO1 showing septate hyphae with black spores; (b) TO2 showing oval conidia; (c) TO3 showing oval yeast cells.</p>
      </sec>
      <sec id="sec3dot3">
        <title>3.3. DNA Isolation</title>
        <p>High-quality genomic DNA was successfully extracted from all three fungal isolates (TO1, TO2, and TO3) (<bold>Table 2</bold>). The DNA samples showed distinct and sharp bands when subjected to agarose gel electrophoresis, confirming their integrity and absence of degradation. Spectrophotometric quantification revealed DNA concentrations of 28 ng/µL, 42 ng/µL, and 59 ng/µL for TO1, TO2, and TO3, respectively. The purity ratios (A260/A280) ranged between 1.84 and 1.88, indicating minimal protein contamination and suitability for downstream PCR analysis.</p>
        <p><bold>Table 2.</bold>DNA concentration and purity levels of fungal isolates.</p>
        <table-wrap id="tbl2">
          <label>Table 2</label>
          <table>
            <tbody>
              <tr>
                <td>
                  <bold>S/N</bold>
                </td>
                <td>
                  <bold>Code</bold>
                </td>
                <td>
                  <bold>PCR Target</bold>
                </td>
                <td>
                  <bold>DNA Concentration (ng/µL)</bold>
                </td>
                <td>
                  <bold>Duplicate</bold>
                </td>
                <td>
                  <bold>Mean</bold>
                </td>
                <td>
                  <bold>Purity (A260/A280)</bold>
                </td>
                <td>
                  <bold>Duplicate</bold>
                </td>
                <td>
                  <bold>Means</bold>
                </td>
              </tr>
              <tr>
                <td>1</td>
                <td>TO1</td>
                <td>ITS</td>
                <td>28</td>
                <td>30</td>
                <td>29</td>
                <td>1.86</td>
                <td>1.89</td>
                <td>1.88</td>
              </tr>
              <tr>
                <td>2</td>
                <td>TO2</td>
                <td>ITS</td>
                <td>42</td>
                <td>44</td>
                <td>43</td>
                <td>1.84</td>
                <td>1.82</td>
                <td>1.83</td>
              </tr>
              <tr>
                <td>3</td>
                <td>TO3</td>
                <td>ITS</td>
                <td>59</td>
                <td>60</td>
                <td>59.5</td>
                <td>1.88</td>
                <td>1.85</td>
                <td>1.87</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
        <p>These values suggest that the DNA extraction process was efficient across all isolates. The relatively higher concentration observed in TO3 indicates a more robust cellular structure or a denser mycelial mass, while the consistent purity across samples confirms that the DNA was of sufficient quality for PCR and sequencing.</p>
      </sec>
      <sec id="sec3dot4">
        <title>3.4. Fungal DNA Successfully Detected via PCR</title>
        <p>PCR amplification of the ITS region was successful across all three isolates, producing distinct bands of approximately 600 bp in size (<xref ref-type="fig" rid="fig3">Figure 3</xref>). The sharp and uniform bands observed in the agarose gel indicated strong and specific amplification of the fungal ITS gene. The results validated the effectiveness of the primers used and confirmed that the extracted DNA was suitable for molecular analysis.</p>
        <fig id="fig3">
          <label>Figure 3</label>
          <graphic xlink:href="https://html.scirp.org/file/2606322-rId15.jpeg?20260929113609" />
        </fig>
        <p><bold>Figure 3.</bold> Lane M: 100 bp DNA Ladder; S3, S4, S5: Fungal Isolates TO1, TO2, and TO3 showing distinct ITS amplification bands (~600 bp). This indicates the likely presence of fungal DNA in all isolates, establishing the success of the DNA extraction and amplification stages.</p>
      </sec>
      <sec id="sec3dot5">
        <title>3.5. Fungal Species Identified via Sanger Sequencing</title>
        <p>The amplified ITS gene fragments were sequenced using the Sanger sequencing method. The resulting chromatograms exhibited clear and well-defined peaks, indicating high-quality sequences. Subsequent BLAST analysis against the NCBI GenBank database identified the isolates with varying degrees of similarity to known fungal species (<bold>Table 3</bold>).</p>
        <p><bold>Table 3.</bold> BLAST results summary for fungal isolates.</p>
        <table-wrap id="tbl3">
          <label>Table 3</label>
          <table>
            <tbody>
              <tr>
                <td>
                  <bold>S/N</bold>
                </td>
                <td>
                  <bold>Code</bold>
                </td>
                <td>
                  <bold>Name of Organism</bold>
                </td>
                <td>
                  <bold>Closest Gen Bank Match</bold>
                </td>
                <td>
                  <bold>% Identity</bold>
                </td>
              </tr>
              <tr>
                <td>1</td>
                <td>TO1</td>
                <td>
                  <italic>Fusarium verticillioides</italic>
                </td>
                <td>
                  <italic>Fusarium verticillioides</italic>
                  isolate 42FEB
                </td>
                <td>87.7</td>
              </tr>
              <tr>
                <td>2</td>
                <td>TO2</td>
                <td>
                  <italic>Geotrichum candidum</italic>
                </td>
                <td>
                  <italic>Geotrichum candidum</italic>
                  isolate PD10019
                </td>
                <td>99.6</td>
              </tr>
              <tr>
                <td>3</td>
                <td>TO3</td>
                <td>
                  <italic>Puccinia brachypodii</italic>
                </td>
                <td>
                  <italic>Puccinia brachypodii</italic>
                  isolate OTU0822
                </td>
                <td>88.8</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
        <p>The high similarity (99.6%) of TO2 with <italic>Geotrichum candidum</italic> indicates strong identity confirmation, while TO1 and TO3 showed lower identity percentages, suggesting potential sequence variations or mixed species presence.</p>
      </sec>
      <sec id="sec3dot6">
        <title>3.6. Blast and Phylogenetic Tree Construction</title>
        <p>Phylogenetic analysis was performed to establish the evolutionary relationships among the fungal isolates (<xref ref-type="fig" rid="fig4">Figure 4</xref>). The sequence alignment of isolate TO1 showed close similarity with members of the genus <italic>Fusarium</italic>, with the highest identity (87.7%) observed with <italic>Fusarium verticillioides</italic>. The constructed phylogenetic tree clustered TO1 within the <italic>Fusarium verticillioides</italic>, <italic>F. oxysporum</italic>, <italic>F. graminearum</italic> lineage, confirming its close association with <italic>Fusarium</italic> species.</p>
        <fig id="fig4">
          <label>Figure 4</label>
          <graphic xlink:href="https://html.scirp.org/file/2606322-rId16.jpeg?20260929113610" />
        </fig>
        <p><bold>Figure 4.</bold>Neighbor-Joining phylogenetic tree based on ITS gene sequences showing the relationship of isolate TO1 with reference sequences. Tree was constructed using the Jukes Cantor model with 500 bootstrap replicates, and bootstrap values are shown at the nodes. The analysis clusters TO1 within the <italic>Fusarium verticillioide</italic>, <italic>oxysporum</italic>, <italic>graminearum</italic> lineage, confirming its close evolutionary relationship with <italic>Fusarium</italic> species.</p>
        <p>Isolate TO2 showed 99.6% similarity to <italic>Geotrichum candidum</italic> and clustered tightly with other <italic>Geotrichum</italic> species in the phylogenetic tree (<xref ref-type="fig" rid="fig5">Figure 5</xref>). This high similarity and complete query coverage confirm the identity of TO2 as <italic>Geotrichum candidum</italic>, a common spoilage yeast known to affect soft fruits and vegetables.</p>
        <fig id="fig5">
          <label>Figure 5</label>
          <graphic xlink:href="https://html.scirp.org/file/2606322-rId17.jpeg?20260929113610" />
        </fig>
        <p><bold>Figure 5.</bold>Neighbor-Joining phylogenetic tree based on ITS gene sequences showing the relationship of isolate TO2 with reference sequences. The tree was constructed using the Jukes-Cantor model with 500 bootstrap replicates, and bootstrap values are shown at the nodes. The analysis clusters TO2 within the <italic>Geotrichum verticillioide</italic>, <italic>pandrossion</italic>, <italic>silvicola</italic> lineage, confirming its close evolutionary relationship with <italic>Geotrichum</italic> species.</p>
        <fig id="fig6">
          <label>Figure 6</label>
          <graphic xlink:href="https://html.scirp.org/file/2606322-rId18.jpeg?20260929113610" />
        </fig>
        <p><bold>Figure 6.</bold> Neighbor-Joining phylogenetic tree based on ITS gene sequences showing the relationship of isolate TO3 with reference sequences. The tree was constructed using the Jukes-Cantor model with 500 bootstrap replicates, and bootstrap values are shown at the nodes. The analysis clusters TO3 within diverse taxa, including <italic>Geotrichum</italic> spp. and <italic>Puccinia brachypodii</italic>.</p>
        <p>The sequence for TO3 showed 88.8% similarity to <italic>Puccinia brachypodii</italic> and also aligned with <italic>Geotrichum</italic> species, indicating conserved ITS regions and possible genetic relatedness across genera (<xref ref-type="fig" rid="fig6">Figure 6</xref>). The phylogenetic tree positioned TO3 in a diverse clade containing both <italic>Puccinia</italic> and <italic>Geotrichum</italic> sequences, suggesting that it shares conserved sequence motifs but could not be resolved precisely to species level.</p>
      </sec>
    </sec>
    <sec id="sec4">
      <title>4. Discussion</title>
      <p>The culturing observations revealed significant fungal growth, which agrees with the findings of Jaboro <italic>et al.</italic>, who reported high fungal contamination in Nigeria [<xref ref-type="bibr" rid="B19">19</xref>].</p>
      <p>Macroscopic observations revealed distinct colony morphologies, which were further corroborated by microscopic examination. These morphological characteristics align with those reported in similar studies on tomato spoilage fungi [<xref ref-type="bibr" rid="B20">20</xref>]. This observation is partly supported by the DNA analyses, which shows close relationship to the fungal species.</p>
      <p>Furthermore, sequencing results show some similarities to the fungal isolates of TO1, TO2 and TO3 as corroborated by other researchers [<xref ref-type="bibr" rid="B20">20</xref>][<xref ref-type="bibr" rid="B21">21</xref>]. The surprising outcome is the identification of <italic>Pucinia brachyopodii</italic>in TO3, which may be a result of contamination that would require more investigation in future studies. Although, <italic>Geotrichum candidum</italic> has high percentage identity, the other isolates were below 90%. </p>
      <p>Phylogenetic analysis based on ITS gene sequences confirmed the taxonomic placements of the fungal isolates. TO1 clustered within the <italic>Fusarium</italic> lineage, TO2 grouped with <italic>Geotrichum</italic> species, and TO3 was positioned among diverse taxa, including <italic>Puccinia</italic> and <italic>Geotrichum</italic>. The moderate identity percentages for TO1 and TO3 suggest possible sequence variations or mixed species presence, which is consistent with challenges in fungal identification based solely on the ITS region [<xref ref-type="bibr" rid="B21">21</xref>].</p>
      <p>The findings of this study are consistent with recent research on tomato spoilage fungi in Nigeria. Kabiru and Yusuf identified <italic>Rhizopus oryzae</italic>, <italic>Rhizopus microsporus</italic>, <italic>Aspergillus flavus</italic>, and <italic>Malassezia furfur</italic> as prevalent fungi in tomatoes from Biu markets [<xref ref-type="bibr" rid="B20">20</xref>]. Similarly, Amaechi <italic>et al.</italic> reported <italic>Aspergillus niger</italic> and other fungi associated with tomato spoilage in Port Harcourt markets [<xref ref-type="bibr" rid="B19">19</xref>].</p>
      <p>Further studies will carry out more investigation on the morphological and molecular aspects of the isolates. Similarly, more sequencing will be done to increase the percentage of species identification.</p>
    </sec>
    <sec id="sec5">
      <title>Appendix</title>
      <p>&gt;TO1_ITS1</p>
      <p>AAAAGTCSTAACAAGRWTCCRAAGSWGAGGAGCAAAYGGATCMTTAMSRAKTGAAMCCCRGGGGGAAAYTTGCGCASMWAACAATAGTTGTATAGKCGAAACAAAAATAATCCAAMYTTTTAAMAATGGRWCYCTTGGGTCCCCTAAACTCTAAGACTATATGGAACTTCTGAGTAACASGATAAAWAAATCAAAACTTTCAACAACGGA</p>
      <p>&gt;TO2</p>
      <p>ATAATCAAAACTTTTAACAATGGATCTCTTGTTTCTCGTATCGATGAAAAACGCAGCGAAACGCGATATTTCTTGTGAATTGCAGAAGTGAATCATCAGTTTTTGAACGCACATTGCACTTTGGGGTATCCCCCAAAGTATACTTGTTTGAGCGTTGTTTCTCTCTTGGAATTGCATTGCTTTTCTAAAATTTCGAATCAAATTCGTTTGAAAAACAACACTATTCAACCTCA</p>
      <p>&gt;TO3</p>
      <p>MTCGAWGACAAMGCAGARAACAAAAATGTTTCCTGAAGAATTGAAMATAGTTGGGAAAYTTACACAGCAAACAATAATTTTATAGTCAAAACAAAAATAATCAAAAYTTTTAAMAAYGAATCTCTTGGTCCCCGCACCGATGAAGAACGCATGGRYATTCTGAGTTTCTGCATAAATAAATCAAAACTTTCAACAACGGA</p>
    </sec>
  </body>
  <back>
    <ref-list>
      <title>References</title>
      <ref id="B1">
        <label>1.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Bajon, A., Kidoń, M. and Kobus-Cisowska, J. (2026) Tomato ( <italic>Solanum lycopersicum</italic> L.) as a Source of Bioactive Compounds: Functional Properties and Technological Aspects—A Review. <italic>Nutrients</italic>, 18, Article 2084. https://doi.org/10.3390/nu18132084 <pub-id pub-id-type="doi">10.3390/nu18132084</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3390/nu18132084">https://doi.org/10.3390/nu18132084</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Bajon, A.</string-name>
              <string-name>Kobus-Cisowska, J.</string-name>
            </person-group>
            <year>2026</year>
            <article-title>Tomato (Solanum lycopersicum L</article-title>
            <source>) as a Source of Bioactive Compounds: Functional Properties and Technological Aspects—A Review. Nutrients</source>
            <volume>18</volume>
            <elocation-id>2084</elocation-id>
            <pub-id pub-id-type="doi">10.3390/nu18132084</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B2">
        <label>2.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Muimba-Kankolongo, A., Banza Lubaba Nkulu, C., Mwitwa, J., Mujinga, F.K. and Nabuyanda, M.M. (2026) Agriculture and Food Production in the Region. In: <italic>Mining Impacts on the Environment in the Central African Copperbelt of Zambia and the Democratic Republic of Congo</italic>, Springer, 97-232. https://doi.org/10.1007/978-3-031-96786-3_6 <pub-id pub-id-type="doi">10.1007/978-3-031-96786-3_6</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1007/978-3-031-96786-3_6">https://doi.org/10.1007/978-3-031-96786-3_6</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Muimba-Kankolongo, A.</string-name>
              <string-name>Nkulu, C.</string-name>
              <string-name>Mwitwa, J.</string-name>
              <string-name>Mujinga, F.K.</string-name>
              <string-name>Nabuyanda, M.M.</string-name>
              <string-name>Congo, S</string-name>
            </person-group>
            <year>2026</year>
            <article-title>Agriculture and Food Production in the Region</article-title>
            <source>In: Mining Impacts on the Environment in the Central African Copperbelt of Zambia and the Democratic Republic of Congo</source>
            <volume>97</volume>
            <pub-id pub-id-type="doi">10.1007/978-3-031-96786-3_6</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B3">
        <label>3.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Garg, M., Rana, M.K., Sharma, S., Pathak, S., Karki, P., Tiwari, A., <italic>et al</italic>. (2026) The Role of Nutritional Foods in the Prevention of Chronic Diseases: A Comprehensive Review. <italic>Ecology</italic>, <italic>Environment and Conservation</italic>, 32, S90-S101. https://doi.org/10.53550/eec.2026.v32.i01s.015 <pub-id pub-id-type="doi">10.53550/eec.2026.v32.i01s.015</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.53550/eec.2026.v32.i01s.015">https://doi.org/10.53550/eec.2026.v32.i01s.015</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Garg, M.</string-name>
              <string-name>Rana, M.K.</string-name>
              <string-name>Sharma, S.</string-name>
              <string-name>Pathak, S.</string-name>
              <string-name>Karki, P.</string-name>
              <string-name>Tiwari, A.</string-name>
              <string-name>Ecology, E</string-name>
            </person-group>
            <year>2026</year>
            <article-title>The Role of Nutritional Foods in the Prevention of Chronic Diseases: A Comprehensive Review</article-title>
            <source>Ecology</source>
            <volume>32</volume>
            <pub-id pub-id-type="doi">10.53550/eec.2026.v32.i01s.015</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B4">
        <label>4.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Gropper, S.S. (2023) The Role of Nutrition in Chronic Disease. <italic>Nutrients</italic>, 15, 664. https://doi.org/10.3390/nu15030664 <pub-id pub-id-type="doi">10.3390/nu15030664</pub-id><pub-id pub-id-type="pmid">36771368</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3390/nu15030664">https://doi.org/10.3390/nu15030664</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Gropper, S.S.</string-name>
            </person-group>
            <year>2023</year>
            <article-title>The Role of Nutrition in Chronic Disease</article-title>
            <source>Nutrients</source>
            <volume>15</volume>
            <pub-id pub-id-type="doi">10.3390/nu15030664</pub-id>
            <pub-id pub-id-type="pmid">36771368</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B5">
        <label>5.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Didi, A., Essaidi, E.M., Krim, M., Badague, A., Aarab, I., Amsil, H. and Rrhioua, A. (2026) High-Resolution Trace Element Profiling of Culinary Spices Using ICP-MS: A Comparative Study on Nutritional and Toxicological Markers for Food Safety Surveillance. <italic>Exploration of Foods and Foodomics</italic>, 4, 1010139. https://doi.org/10.37349/eff.2026.1010139 <pub-id pub-id-type="doi">10.37349/eff.2026.1010139</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.37349/eff.2026.1010139">https://doi.org/10.37349/eff.2026.1010139</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Didi, A.</string-name>
              <string-name>Essaidi, E.M.</string-name>
              <string-name>Krim, M.</string-name>
              <string-name>Badague, A.</string-name>
              <string-name>Aarab, I.</string-name>
              <string-name>Amsil, H.</string-name>
              <string-name>Rrhioua, A.</string-name>
            </person-group>
            <year>2026</year>
            <article-title>High-Resolution Trace Element Profiling of Culinary Spices Using ICP-MS: A Comparative Study on Nutritional and Toxicological Markers for Food Safety Surveillance</article-title>
            <source>Exploration of Foods and Foodomics</source>
            <volume>4</volume>
            <pub-id pub-id-type="doi">10.37349/eff.2026.1010139</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B6">
        <label>6.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Molelekoa, T., Karoney, E.M., Siyoum, N. and Korsten, L. (2026) Postharvest Decay and Spoilage of Tomatoes from Small-Scale Production Systems. <italic>Acta Horticulturae</italic>, 1451, 161-168. https://doi.org/10.17660/actahortic.2026.1451.23 <pub-id pub-id-type="doi">10.17660/actahortic.2026.1451.23</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.17660/actahortic.2026.1451.23">https://doi.org/10.17660/actahortic.2026.1451.23</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Molelekoa, T.</string-name>
              <string-name>Karoney, E.M.</string-name>
              <string-name>Siyoum, N.</string-name>
              <string-name>Korsten, L.</string-name>
            </person-group>
            <year>2026</year>
            <article-title>Postharvest Decay and Spoilage of Tomatoes from Small-Scale Production Systems</article-title>
            <source>Acta Horticulturae</source>
            <volume>1451</volume>
            <pub-id pub-id-type="doi">10.17660/actahortic.2026.1451.23</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B7">
        <label>7.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Birara, A. and Motbainor, A. (2026) Food Safety Legislation, Standards, and Measures in Ethiopia: A Scoping Review. <italic>Environmental Health Insights</italic>, 20, Article 11786302261425324. https://doi.org/10.1177/11786302261425324 <pub-id pub-id-type="doi">10.1177/11786302261425324</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1177/11786302261425324">https://doi.org/10.1177/11786302261425324</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Birara, A.</string-name>
              <string-name>Motbainor, A.</string-name>
              <string-name>Legislation, S</string-name>
            </person-group>
            <year>2026</year>
            <article-title>Food Safety Legislation, Standards, and Measures in Ethiopia: A Scoping Review</article-title>
            <source>Environmental Health Insights</source>
            <volume>20</volume>
            <elocation-id>11786302261425324</elocation-id>
            <pub-id pub-id-type="doi">10.1177/11786302261425324</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B8">
        <label>8.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Ahiabor, W.K., Kotey, F.C.N., Tetteh-Quarcoo, P.B. and Donkor, E.S. (2024) Foodborne Microbiological Hazards in Ghana: A Scoping Review. <italic>Environmental Health Insights</italic>, 18, Article 1178630224126048. https://doi.org/10.1177/11786302241260485 <pub-id pub-id-type="doi">10.1177/11786302241260485</pub-id><pub-id pub-id-type="pmid">39055116</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1177/11786302241260485">https://doi.org/10.1177/11786302241260485</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Ahiabor, W.K.</string-name>
              <string-name>Kotey, F.C.N.</string-name>
              <string-name>Tetteh-Quarcoo, P.B.</string-name>
              <string-name>Donkor, E.S.</string-name>
            </person-group>
            <year>2024</year>
            <article-title>Foodborne Microbiological Hazards in Ghana: A Scoping Review</article-title>
            <source>Environmental Health Insights</source>
            <volume>18</volume>
            <elocation-id>1178630224126048</elocation-id>
            <pub-id pub-id-type="doi">10.1177/11786302241260485</pub-id>
            <pub-id pub-id-type="pmid">39055116</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B9">
        <label>9.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Kowalska, J. and Maćkiw, E. (2026) Nationwide Five-Year Official Surveillance of Microbiological Hazards in Retail Food in Poland. <italic>Foods</italic>, 15, 2902. https://doi.org/10.3390/foods15162902 <pub-id pub-id-type="doi">10.3390/foods15162902</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3390/foods15162902">https://doi.org/10.3390/foods15162902</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Kowalska, J.</string-name>
            </person-group>
            <year>2026</year>
            <article-title>Nationwide Five-Year Official Surveillance of Microbiological Hazards in Retail Food in Poland</article-title>
            <source>Foods</source>
            <volume>15</volume>
            <pub-id pub-id-type="doi">10.3390/foods15162902</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B10">
        <label>10.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Sobti, R.C. and Khan, M.A. (2026) Conventional Frameworks in Microbial Analysis: Strengths and Limitations. In: <italic>Next</italic>- <italic>Generation Approaches to Microbial Analysis</italic>, Springer, 9-32. https://doi.org/10.1007/978-981-95-8840-4_2 <pub-id pub-id-type="doi">10.1007/978-981-95-8840-4_2</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1007/978-981-95-8840-4_2">https://doi.org/10.1007/978-981-95-8840-4_2</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Sobti, R.C.</string-name>
              <string-name>Khan, M.A.</string-name>
              <string-name>Analysis, S</string-name>
            </person-group>
            <year>2026</year>
            <article-title>Conventional Frameworks in Microbial Analysis: Strengths and Limitations</article-title>
            <source>In: Next-Generation Approaches to Microbial Analysis</source>
            <volume>9</volume>
            <pub-id pub-id-type="doi">10.1007/978-981-95-8840-4_2</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B11">
        <label>11.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Kirby, T.O., Townsend, J.R., Walts, E.D., Kiefer, A., Zhu, J., Cormier, M., <italic>et al</italic>. (2026) Revisiting Strategies for Bacterial Enumeration: The Case for Viable but Nonculturable (VBNC) Cells in Supplement Products. <italic>Probiotics and Antimicrobial Proteins</italic>, 18, 6551-6564. https://doi.org/10.1007/s12602-026-10936-9 <pub-id pub-id-type="doi">10.1007/s12602-026-10936-9</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1007/s12602-026-10936-9">https://doi.org/10.1007/s12602-026-10936-9</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Kirby, T.O.</string-name>
              <string-name>Townsend, J.R.</string-name>
              <string-name>Walts, E.D.</string-name>
              <string-name>Kiefer, A.</string-name>
              <string-name>Zhu, J.</string-name>
              <string-name>Cormier, M.</string-name>
            </person-group>
            <year>2026</year>
            <article-title>Revisiting Strategies for Bacterial Enumeration: The Case for Viable but Nonculturable (VBNC) Cells in Supplement Products</article-title>
            <source>Probiotics and Antimicrobial Proteins</source>
            <volume>18</volume>
            <pub-id pub-id-type="doi">10.1007/s12602-026-10936-9</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B12">
        <label>12.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Labib, A.F. and Datta, S.K. (2026) Molecular Frontiers in Biodiversity Research from Bangladesh: A Review. <italic>Bioresearch Communications</italic>, 12, 2062-2069. https://doi.org/10.3329/brc.v12i1.86781 <pub-id pub-id-type="doi">10.3329/brc.v12i1.86781</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3329/brc.v12i1.86781">https://doi.org/10.3329/brc.v12i1.86781</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Labib, A.F.</string-name>
              <string-name>Datta, S.K.</string-name>
            </person-group>
            <year>2026</year>
            <article-title>Molecular Frontiers in Biodiversity Research from Bangladesh: A Review</article-title>
            <source>Bioresearch Communications</source>
            <volume>12</volume>
            <pub-id pub-id-type="doi">10.3329/brc.v12i1.86781</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B13">
        <label>13.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Ushakiran, P., Haria, J., Kumar, A. and Singh, S. (2026) Advances in Metagenomic Sequencing Technologies Enabling the Study of Microbial Communities. <italic>Journal of Cellular Biotechnology</italic>, 12, 87-100. https://doi.org/10.1177/23523689261442516 <pub-id pub-id-type="doi">10.1177/23523689261442516</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1177/23523689261442516">https://doi.org/10.1177/23523689261442516</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Ushakiran, P.</string-name>
              <string-name>Haria, J.</string-name>
              <string-name>Kumar, A.</string-name>
              <string-name>Singh, S.</string-name>
            </person-group>
            <year>2026</year>
            <article-title>Advances in Metagenomic Sequencing Technologies Enabling the Study of Microbial Communities</article-title>
            <source>Journal of Cellular Biotechnology</source>
            <volume>12</volume>
            <pub-id pub-id-type="doi">10.1177/23523689261442516</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B14">
        <label>14.</label>
        <citation-alternatives>
          <mixed-citation publication-type="book">Iyer-Pascuzzi, A.S. (2026) Protocols in Root-Microbe Interactions. Purdue University Press.</mixed-citation>
          <element-citation publication-type="book">
            <person-group person-group-type="author">
              <string-name>Iyer-Pascuzzi, A.S.</string-name>
            </person-group>
            <year>2026</year>
            <article-title>Protocols in Root-Microbe Interactions</article-title>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B15">
        <label>15.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Senadheera, U.E., Jayasanka, D.J., Hewawasam, C., Udayanga, D., Takimoto, Y. and Tadachika, N. (2026) Coordinated Lignocellulolysis: Topological Analysis Reveals Coordinated Lignocellulolysis in Klebsiella-Enterobacter-Mediated Rice Straw Degradation via Surface Delignification and Cellulose Crystallinity Modulation. <italic>Access Microbiology</italic>, 8, 001097-v3. https://doi.org/10.1099/acmi.0.001097.v3 <pub-id pub-id-type="doi">10.1099/acmi.0.001097.v3</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1099/acmi.0.001097.v3">https://doi.org/10.1099/acmi.0.001097.v3</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Senadheera, U.E.</string-name>
              <string-name>Jayasanka, D.J.</string-name>
              <string-name>Hewawasam, C.</string-name>
              <string-name>Udayanga, D.</string-name>
              <string-name>Takimoto, Y.</string-name>
              <string-name>Tadachika, N.</string-name>
            </person-group>
            <year>2026</year>
            <article-title>Coordinated Lignocellulolysis: Topological Analysis Reveals Coordinated Lignocellulolysis in Klebsiella-Enterobacter-Mediated Rice Straw Degradation via Surface Delignification and Cellulose Crystallinity Modulation</article-title>
            <source>Access Microbiology</source>
            <volume>8</volume>
            <pub-id pub-id-type="doi">10.1099/acmi.0.001097.v3</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B16">
        <label>16.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Patial, M., Bishnoi, S.K., Pal, D. and Pramanick, K.K. (2026) Bread Wheat ( <italic>Triticum aestivum</italic> L.) Doubled Haploid Production by Interspecific Crosses with Imperata Cylindrica. In: <italic>Methods in Molecular Biology</italic>, Springer, 93-111. https://doi.org/10.1007/978-1-0716-5245-9_6 <pub-id pub-id-type="doi">10.1007/978-1-0716-5245-9_6</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1007/978-1-0716-5245-9_6">https://doi.org/10.1007/978-1-0716-5245-9_6</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Patial, M.</string-name>
              <string-name>Bishnoi, S.K.</string-name>
              <string-name>Pal, D.</string-name>
              <string-name>Pramanick, K.K.</string-name>
              <string-name>Biology, S</string-name>
            </person-group>
            <year>2026</year>
            <article-title>Bread Wheat (Triticum aestivum L</article-title>
            <source>) Doubled Haploid Production by Interspecific Crosses with Imperata Cylindrica. In: Methods in Molecular Biology</source>
            <volume>93</volume>
            <pub-id pub-id-type="doi">10.1007/978-1-0716-5245-9_6</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B17">
        <label>17.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Murgia, C., Yazdi, Z. and Soto, E. (2025) Susceptibility of Non-Tuberculous Mycobacteria Biofilm to Common Disinfectants in Aquaculture Systems. <italic>Journal of Fish Diseases</italic>, 48, e14091. https://doi.org/10.1111/jfd.14091 <pub-id pub-id-type="doi">10.1111/jfd.14091</pub-id><pub-id pub-id-type="pmid">39920900</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1111/jfd.14091">https://doi.org/10.1111/jfd.14091</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Murgia, C.</string-name>
              <string-name>Yazdi, Z.</string-name>
              <string-name>Soto, E.</string-name>
            </person-group>
            <year>2025</year>
            <article-title>Susceptibility of Non-Tuberculous Mycobacteria Biofilm to Common Disinfectants in Aquaculture Systems</article-title>
            <source>Journal of Fish Diseases</source>
            <volume>48</volume>
            <pub-id pub-id-type="doi">10.1111/jfd.14091</pub-id>
            <pub-id pub-id-type="pmid">39920900</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B18">
        <label>18.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Mafe, A.N., Makut, M.D., Owuna, J.E., Nkene, I.H., Edo, G.I., Salisu, S.M., <italic>et al</italic>. (2026) Development, Functional Profiling, and Probiotic Evaluation of Indigenous LAB from Nigerian Fermented Foods: Antimicrobial Mechanisms, <italic>in Vivo</italic> Validation, and Applications in Food Preservation and Mycotoxin Risk Reduction. <italic>World Journal of Microbiology and Biotechnology</italic>, 42, Article No. 317. https://doi.org/10.1007/s11274-026-05051-4 <pub-id pub-id-type="doi">10.1007/s11274-026-05051-4</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1007/s11274-026-05051-4">https://doi.org/10.1007/s11274-026-05051-4</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Mafe, A.N.</string-name>
              <string-name>Makut, M.D.</string-name>
              <string-name>Owuna, J.E.</string-name>
              <string-name>Nkene, I.H.</string-name>
              <string-name>Edo, G.I.</string-name>
              <string-name>Salisu, S.M.</string-name>
              <string-name>Development, F</string-name>
            </person-group>
            <year>2026</year>
            <article-title>Development, Functional Profiling, and Probiotic Evaluation of Indigenous LAB from Nigerian Fermented Foods: Antimicrobial Mechanisms, in Vivo Validation, and Applications in Food Preservation and Mycotoxin Risk Reduction</article-title>
            <source>World Journal of Microbiology and Biotechnology</source>
            <volume>42</volume>
            <elocation-id>No</elocation-id>
            <pub-id pub-id-type="doi">10.1007/s11274-026-05051-4</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B19">
        <label>19.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Jaboro, A.G., Oghene, U.J., Alari, E.J. and Itila, G.N. (2026) Assessment of Mycological Profile and Heavy Metals Concentration of Orogodo River in Delta State, Nigeria. <italic>FUDMA Journal of Sciences</italic>, 10, 403-408. https://doi.org/10.33003/fjs-2026-1016-5855 <pub-id pub-id-type="doi">10.33003/fjs-2026-1016-5855</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.33003/fjs-2026-1016-5855">https://doi.org/10.33003/fjs-2026-1016-5855</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Jaboro, A.G.</string-name>
              <string-name>Oghene, U.J.</string-name>
              <string-name>Alari, E.J.</string-name>
              <string-name>Itila, G.N.</string-name>
              <string-name>State, N</string-name>
            </person-group>
            <year>2026</year>
            <article-title>Assessment of Mycological Profile and Heavy Metals Concentration of Orogodo River in Delta State, Nigeria</article-title>
            <source>FUDMA Journal of Sciences</source>
            <volume>10</volume>
            <pub-id pub-id-type="doi">10.33003/fjs-2026-1016-5855</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B20">
        <label>20.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Kabiru, S.M. and Yusuf, S.S. (2023) Isolation and Identification of Fungal Pathogens of Post-Harvest Rot of Tomato Fruit in Biu Markets, Biu Local Government Area of Borno State. <italic>Nigerian Journal of Botany</italic>, 36, 185-200. https://doi.org/10.4314/njbot.v36i2.7 <pub-id pub-id-type="doi">10.4314/njbot.v36i2.7</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.4314/njbot.v36i2.7">https://doi.org/10.4314/njbot.v36i2.7</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Kabiru, S.M.</string-name>
              <string-name>Yusuf, S.S.</string-name>
              <string-name>Markets, B</string-name>
            </person-group>
            <year>2023</year>
            <article-title>Isolation and Identification of Fungal Pathogens of Post-Harvest Rot of Tomato Fruit in Biu Markets, Biu Local Government Area of Borno State</article-title>
            <source>Nigerian Journal of Botany</source>
            <volume>36</volume>
            <pub-id pub-id-type="doi">10.4314/njbot.v36i2.7</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B21">
        <label>21.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Zakaria, L. (2023) Fusarium Species Associated with Diseases of Major Tropical Fruit Crops. <italic>Horticulturae</italic>, 9, Article 322. https://doi.org/10.3390/horticulturae9030322 <pub-id pub-id-type="doi">10.3390/horticulturae9030322</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3390/horticulturae9030322">https://doi.org/10.3390/horticulturae9030322</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Zakaria, L.</string-name>
            </person-group>
            <year>2023</year>
            <article-title>Fusarium Species Associated with Diseases of Major Tropical Fruit Crops</article-title>
            <source>Horticulturae</source>
            <volume>9</volume>
            <elocation-id>322</elocation-id>
            <pub-id pub-id-type="doi">10.3390/horticulturae9030322</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
    </ref-list>
  </back>
</article>