Mature leaves and stem of Z. spina-christi were procured from Dargai, District Malakand, Khyber Pakhtunkhwa, Pakistan. It is located at 34˚30′21ʺ N latitude and 71˚54′12ʺ E longitude. The Malakand average temperature is 22.51˚C, with an annual precipitation of approximately 133.32 mm and 147.32 days of rainfall.

Plant tissues were surface sterilized by immersion in 70% ethanol and in 2% sodium hypochlorite for 3 - 5 min, and then rinsed three times with sterile distilled water to remove sterilized agents. The tissues were divided into small segments (about 0.5 cm) and inoculated onto potato dextrose agar (PDA) plates added with chloramphenicol (50 mg/L) to inhibit bacterial contamination. The PDA media consisted of potato infusion (200g/L), dextrose (20 g/L) and agar (15 - 20 g/L). The inoculated Plates were incubated at 28˚C for a period of 7 to 14 days. Emerged fungal colonies were subcultured on fresh PDA plates to obtain pure isolates [7].

Molecular methods were utilized to identify the particular fungal isolate ZS1. DNA was extracted with the standard Qiagen DNA extraction spin technique with a DNeasy mini-DNA extraction kit. Sequencing was conducted by First Base Laboratory (Apical Scientific) in Malaysia. PCR amplicons were sequenced using Celemics BTSeqTM. The internal transcribed spacer (ITS) region of fungal isolate was amplified by utilizing universal ITS1 (CTTGGTCATTTAGAGGAAGTAA) and ITS4 (TCCTCCGCTTATTGATAGC). Consensus sequences were analyzed with the NCBI Genbank database utilizing the BLASTn tool to identify closely related taxa [8]. Multiple sequence alignments were conducted with MEGA-X. The phylogenetic tree was created by neighbor joining tree method [9]. The sequences were submitted to GenBank, to provide accession number. Bootstrap values of 70% or above were significant for clade support [10].

For extract preparation the fungal endophytes pure colonies were cultured in Czapek media (10 g of glucose, 10 g of peptone, 5 g of MgSO4, and 5 g of KCl in one liter of distilled water) to produce biomass and cultural filtrate. The cultivated flasks were subsequently incubated in a shaking incubator for 15 days at 30˚C and 120 rotations per minute. The 15-day culture filtrate was added with an equal volume of ethyl acetate in a 250 ml flask, sealed, cultured for an additional 3 days, and subsequently vaporized at 40˚C by using a rotary evaporator [11].

Fifteen male specific-pathogen-free Wistar albino rats (180 - 200) were carried out from the veterinary research institute Peshawar. Rats were accommodated in polypropylene cages under conventional laboratory circumstances (12-hour light/dark cycle, 22 ± 2˚C, relative humidity 50% - 60%) with viable laboratory meals. The experiment on rats were approved by the animal ethical committee of Abdul Wali Khan University, Department of Botany, Mardan with reference number (No. AWKUM/BOT/2024/567), and followed to the rules established by the National Research Council [12].

To evaluate the acute toxicity of an extract on Wistar rats weighing followed by Guideline 425 of the Organization for Economic Cooperation and Development (Guideline, 2001). If the rats exhibited significant behavioral alterations, including tremors, muscle stiffness, excessive salivation, reduced appetite, increased tear production, diarrhea, and mortality, over a period of 15 days, indicating signs of toxicity [13].

Hypertension was induced in rats by administering a high-salt diet including 8% NaCl (w/w) for a duration of 4 weeks [14]. Systolic and diastolic blood pressure were assessed weekly with the non-invasive tail-cuff technique (CODA™, Kent Scientific, USA). Rats exhibiting systolic blood pressure ≥ 140 mmHg after 4 weeks were classified as hypertensive and chosen for the experiment [15].

Rats were divided into five groups (n = 3 per group), Group I (Normal control) given standard diet with 0.5% CMC. Group II (Hypertensive control) were given elevated salt diet with 0.5% CMC. Group III (Positive control) were given high-salt diet with captopril (30 mg/kg body weight). Group IV (Test group 1) with high-salt with fungal extract (100 mg/kg body weight). Group V (Test group 2) were given high-salt diet with fungal extract (200 mg kg body weight). Oral treatments were administered for a period of 21 consecutive days [16].

A diastolic and systolic blood pressure was measured on day 21 using the tail-cuff method. At the end of the experiment, blood samples tests were collected under light anesthesia via retro-orbital puncture. Serum was extracted and evaluated for creatinine and urea level, using standard commercial kits (BioSystems, Spain) [17].

The renin inhibitory activity was evaluated with the fluorometric method [18]. Angiotensin I synthesis was assessed fluorometrically using excitation/emission wavelengths of 340/490 nm with a fluorescence microplate reader (BioTek, USA). The percentage of renin inhibition was calculated using the formula:

% Inhibition = (F control − F sample)/F control × 100

Where F control indicates the fluorescence intensity of the control and F sample signifies the fluorescence in the presence of fungal extracts. Captopril served as the positive control.

The ACE inhibitory activity was assessed following the method [19], with minor changes. Through the help of ethyl acetate the release hippuric acid was extracted, evaporated, and dissolved in distilled water, with absorbance measured at 228 nm using a UV-visible spectrophotometer (Shimadzu, Japan). The percentage of ACE inhibition was determined using the formula:

Percentage inhibition= (control A − sample A)/a control × 100

Control A denotes the absorbance of the control, while sample A represents the absorbance in the presence of the fungal extract.

Upon conclusion of the experimental period, rats were sacrificed under profound anesthesia, and both kidneys were removed and preserved in 10% of neutral buffered formalin for 48 hrs. Kidneys tissue sections (5 μm thick) were synthesized with the help of a rotary microtome and affixed on glass slides. The sections were stained with hematoxylin and eosin (H&E) for comprehensive histopathological analysis. Slides were analyzed using a light microscope by 20x and 40x magnifications [20].

Extract phytochemical analysis were conducted using a GC-MS chromatograph (Agilent 7890 GC paired with 5977B MSD) using a DB-5MS/HP-5MS capillary column. Compound identification was conducted through the comparison of electron ionization spectra with the NIST Mass Spectral Library using the MS Search Program, requiring a match of 80% or greater [21].

All the data were presented as mean ± standard error of mean (SEM). Statistical significance among groups was evaluated using one-way ANOVA, followed by Tukey’s post hoc test, employing GraphPad Prism (v9.0). A p-value less than 0.05 was considered as statistically significant.

From the sterilized leave of Z. spina-christi four fungal strains, specifically ZS1, ZS2, ZS3, and ZS4, were isolated. ZS1 demonstrated antihypertensive potential in comparison to other fungal isolates by in-vitro Renin and ACE inhibitory assay.

Phylogenetic analysis of ITS gene sequence obtained from Sanger sequencing indicated that the fungal isolate ZS1 clustered with Aspergillus aculeatus, deposited in the NCBI Genbank. The BLASTn analysis revealed 97% sequence identity, a query coverage of 59% and an E-value of 0.0, indicating a substantial alignment with the ZS1 strain. Phylogenetic tree was conducted utilizing the neighbor-joining (NJ) method, employing the Tamura-Nei model of nucleotide substitution, and examined across 21 nucleotide sequences which supported by a bootstrap value of 73% from 500 replications (Figure 1). The ITS gene sequence of strain ZS1 has been submitted to the NCBI GenBank with the accession number PQ192175.

Figure 1. Phylogenetic tree of the isolate ZS1 constructed by the neighbor joining method on ITS sequence. Tamura-Nei model were used to compute the evolutionary distances assessed by 500 bootstrap replications. The ZS1 isolate clustered with Aspergillus aculeatuswith 73% bootstrap support.

The safety data revealed that the ZS1 extract was safe up to 400 mg/kg body weight concentration. There was no indication of behavioral changes, lethality and mortality in the rats under close observation, which considered a therapeutic advantage.

The hypertensive control group showed an elevation in both systolic and diastolic blood pressure compared to the normal control group. Captopril treatment significantly reduced blood pressure toward normal level, demonstrating the antihypertensive potential. Oral administration of A. aculeatusextract showed a dose dependent antihypertensive activity. The 200 mg/kg extract significantly lowered both systolic and diastolic blood pressure (p < 0.05) compared to hypertensive group (Figure 2(a)).

Figure 2. (a) Impact of A. aculeatusextract and captopril on systolic and diastolic blood pressure of high salt induced hypertensive rats. (b) Impact of A. aculeatusextract and captopril on serum urea level of high salt induced hypertensive rats. (c) Impact of A. aculeatusextract and captopril on creatinine level of high salt-induced hypertensive rats. Values are expressed as mean ± SEM (n = 6). Different letters (a, b, c, d) above bars indicate statistically significant differences between groups (p < 0.05, one-way ANOVA with Tukey’s post hoc test).

The hypertensive group had a significant elevation in urea levels compared to the control group, indicating renal impairment associated with hypertension induced by a high-salt diet. Treatment with captopril (30 mg/kg) and A. aculeatusextract at 200 mg/kg significantly reduced urea level compared to hypertensive group. The 100 mg/kg dose of the extract reduced urea levels, but lesser extent than the higher dosage (Figure 2(b)).

The hypertensive control group demonstrated a significant elevation in serum creatinine levels relative to the normal control group, signifying renal dysfunction linked to hypertension. Captopril treatment (30 mg/kg) decreased serum creatinine, indicating a notable enhancement in renal function. Likewise, treatment of A. aculeatusextract at dosages of 100 mg/kg and 200 mg/kg reduced creatinine levels, exhibiting significant effects compared to hypertensive group (Figure 2(c)).

There was no inhibition of renin or ACE activity in the control group with hypertension. The treatment with captopril (30 mg/kg) inhibited renin (80.65%) and ACE (71.43%), thus demonstrating its potent effect on the RAS system. The extract of A. aculeatushad dose-dependent inhibitory activity. It inhibited renin (70.97%) and ACE (65.58%) at a dose of 100 mg/kg. Elevating the dosage to 200 mg/kg increased inhibition to 76.34% for renin and 70.78% for ACE, as shown in Table 1.

Table 1. Inhibition of renin and angiotensin converting enzyme by A.aculeatus extract.

Note: Different letters (a, b, c, d) indicate statistically significant differences between groups (p < 0.05, one-way ANOVA with Tukey’s post hoc test). (n = 6 per group).

In the nephrohistological analysis the control group (a) showed a normal kidney structure, glomerulus, bowman’s capsules and regular renal tubules without inflammation. The Hypertensive group (b) displayed pronounced pathological alterations, including glomerular atrophy, tubular dilation, necrosis, interstitial edema, and inflammatory cell infiltration. Captopril-treated group (c) Exhibited partial recovery of renal morphology, with well-defined glomeruli and decreased inflammatory infiltration, showed the renoprotective action of captopril. A. aculeatus100 mg/kg group (d) Demonstrated mild recovery of renal histology, with less inflammatory infiltration and partial restitution of glomerular and tubular integrity. (e) A. aculeatus200 mg/kg shown a nearby normal kidney morphology with improved glomeruli and minimal tubular or interstitial modifications, signifying a protective potential of fungal extract (Figure 3).

Figure 3. Effect of A. aculeatusand captopril on the histology of kidneys. (a) Control group; (b) Hypertensive group; (c) The Captopril-treated group (30 mg/kg); (d) The A. aculeatus treated group (100 mg/kg); (e) The A. aculeatus treated group (200 mg/kg). The arrows denote Glomerulus.

Table 2.Compounds identified in the ethyl acetate extract of A. aculeatus.

Note: RT: Retention time, MF: Molecular formula.

GC-MS analysis of ethyl acetate extract of endophytic fungal isolate ZS1 revealed a range of bioactive compounds as shown in Table 2 and Figure 4. The peaks of fatty acid and their derivative such as oleic acid, n-hexadecanoic acid, and octadecanoic acid were observed in the chromatogram and were responsible for the major peak area together.

Figure 4.GC-MS chromatogram of A. aculeatus contained different compounds with different retention times and peak areas.