<?xml version="1.0" encoding="UTF-8"?>
<!DOCTYPE article PUBLIC "-//NLM//DTD JATS (Z39.96) Journal Publishing DTD v1.4 20241031//EN" "JATS-journalpublishing1-4.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" article-type="research-article" dtd-version="1.4" xml:lang="en">
  <front>
    <journal-meta>
      <journal-id journal-id-type="publisher-id">ojmm</journal-id>
      <journal-title-group>
        <journal-title>Open Journal of Medical Microbiology</journal-title>
      </journal-title-group>
      <issn pub-type="epub">2165-3380</issn>
      <issn pub-type="ppub">2165-3372</issn>
      <publisher>
        <publisher-name>Scientific Research Publishing</publisher-name>
      </publisher>
    </journal-meta>
    <article-meta>
      <article-id pub-id-type="doi">10.4236/ojmm.2025.154021</article-id>
      <article-id pub-id-type="publisher-id">ojmm-147740</article-id>
      <article-categories>
        <subj-group>
          <subject>Article</subject>
        </subj-group>
        <subj-group>
          <subject>Medicine</subject>
          <subject>Healthcare</subject>
        </subj-group>
      </article-categories>
      <title-group>
        <article-title>Occurrence of β-Lactamase Enzyme Genes and Integrons in Antibiotic Resistant Escherichia coli Isolates from Pregnant Women with Asymptomatic Bacteriuria in Nairobi, Kenya</article-title>
      </title-group>
      <contrib-group>
        <contrib contrib-type="author">
          <name name-style="western">
            <surname>Ayoyi</surname>
            <given-names>Adelaide Ogutu</given-names>
          </name>
          <xref ref-type="aff" rid="aff1">1</xref>
        </contrib>
        <contrib contrib-type="author">
          <name name-style="western">
            <surname>Kikuvi</surname>
            <given-names>Gideon</given-names>
          </name>
          <xref ref-type="aff" rid="aff2">2</xref>
        </contrib>
        <contrib contrib-type="author">
          <name name-style="western">
            <surname>Bii</surname>
            <given-names>Christine</given-names>
          </name>
          <xref ref-type="aff" rid="aff3">3</xref>
        </contrib>
        <contrib contrib-type="author">
          <name name-style="western">
            <surname>Kariuki</surname>
            <given-names>Samuel</given-names>
          </name>
          <xref ref-type="aff" rid="aff4">4</xref>
        </contrib>
      </contrib-group>
      <aff id="aff1"><label>1</label> Department of Medical Microbiology, Jomo Kenyatta University of Agriculture and Technology, Thika, Kenya </aff>
      <aff id="aff2"><label>2</label> Department of Public Health, Jomo Kenyatta University of Agriculture and Technology, Thika, Kenya </aff>
      <aff id="aff3"><label>3</label> Department of Microbiology, Centre for Microbiology Research Kenya Medical Research Institute, Nairobi, Kenya </aff>
      <aff id="aff4"><label>4</label> Drugs for Neglected Diseases Initiative (DNDi), Nairobi, Kenya </aff>
      <author-notes>
        <fn fn-type="conflict" id="fn-conflict">
          <p>The authors report no conflicts of interest in this work.</p>
        </fn>
      </author-notes>
      <pub-date pub-type="epub">
        <day>27</day>
        <month>11</month>
        <year>2025</year>
      </pub-date>
      <pub-date pub-type="collection">
        <month>11</month>
        <year>2025</year>
      </pub-date>
      <volume>15</volume>
      <issue>04</issue>
      <fpage>252</fpage>
      <lpage>272</lpage>
      <history>
        <date date-type="received">
          <day>19</day>
          <month>09</month>
          <year>2025</year>
        </date>
        <date date-type="accepted">
          <day>30</day>
          <month>11</month>
          <year>2025</year>
        </date>
        <date date-type="published">
          <day>03</day>
          <month>12</month>
          <year>2025</year>
        </date>
      </history>
      <permissions>
        <copyright-statement>© 2025 by the authors and Scientific Research Publishing Inc.</copyright-statement>
        <copyright-year>2025</copyright-year>
        <license license-type="open-access">
          <license-p> This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license ( <ext-link ext-link-type="uri" xlink:href="https://creativecommons.org/licenses/by/4.0/">https://creativecommons.org/licenses/by/4.0/</ext-link> ). </license-p>
        </license>
      </permissions>
      <self-uri content-type="doi" xlink:href="https://doi.org/10.4236/ojmm.2025.154021">https://doi.org/10.4236/ojmm.2025.154021</self-uri>
      <abstract>
        <p>Asymptomatic bacteriuria (ASB) is the presence of bacteria in urine without apparent symptoms of urinary tract infections. Antibiotic treatment of asymptomatic bacteriuria in pregnant women is recommended to reduce the risks associated with urinary tract infection during pregnancy. However, antibiotic resistance affects the success of treatment leading to failure with adverse outcomes. The study was to investigate the presence of mobile antibiotic resistant factors in multidrug resistance <italic>E. coli</italic> isolates. <bold>Methods</bold><bold>:</bold> This was a cross-sectional study involving 1020 women attending antenatal clinic in Nairobi County. The urine specimens were processed using standard methods for isolation and identification of bacteria in urine. The most common uropathogen, <italic>E. coli</italic> was tested for antimicrobial resistance, using polymerase chain reaction (PCR) to amplify beta-lactamase genes and integrase genes. Plasmid curing using ethidium bromide was performed on plasmid positive multidrug resistant isolates. <bold>Results</bold><bold>:</bold> A total 219 of women tested positive for ASB, resulting to a prevalence of 21.5 % at 95% confidence level. A total of 85 positive samples were caused by <italic>Escherichia coli</italic> which was at 38.8%. <italic>E. coli</italic> isolates from this study had resistance to most antibiotics tested except for imipenem. The resistance ranged from 11.6% for gentamycin to 90.6% for ampicillin. PCR was used for amplification of mobile antibiotic resistant determinants and results indicated 21 isolates had integrons while 26 isolates yielded Beta-lactamase enzyme genes (OXA-1 (8)) and CTX-M (18). <bold>Conclusion</bold><bold>:</bold> There was a significant ASB among pregnant women included in the study from the Nairobi county clinics. There is the presence of ESBLs genes and integrons in community-acquired <italic>E. coli</italic> infections.</p>
      </abstract>
      <kwd-group kwd-group-type="author-generated" xml:lang="en">
        <kwd>Asymptomatic Bacteriuria</kwd>
        <kwd>ESBLs Genes and Integrons</kwd>
      </kwd-group>
    </article-meta>
  </front>
  <body>
    <sec id="sec1">
      <title>1. Introduction</title>
      <p>Asymptomatic bacteriuria is bacterial colonization of the urinary tract without symptoms, common, and potentially a serious medical complication if untreated when it occurs during pregnancy [<xref ref-type="bibr" rid="B1">1</xref>]. Antibiotic treatment of asymptomatic bacteriuria in pregnant women is recommended to reduce the risks associated with urinary tract infection during pregnancy. However, antibiotic resistance affects the success of treatment leading to failure with adverse outcomes. Antibiotic resistance is spread within world’s bacterial populations by acquisition of resistance genes irrespective of the pattern of antimicrobial use in an area [<xref ref-type="bibr" rid="B2">2</xref>]. The gene mobility is achieved through elements like plasmids, integrons and transposons mobile DNA that are acquired through recombination and conjugation. Transposons and integrons transfer genes by recombination into the chromosomes and extra chromosomal DNA [<xref ref-type="bibr" rid="B3">3</xref>]. </p>
      <p>Acquisition of resistance genes by microorganisms is controlled by elements found on chromosomal and extra chromosomal DNA (plasmids). Plasmids often carry antibiotic resistance genes and heavy metal resistance genes [<xref ref-type="bibr" rid="B4">4</xref>]. Plasmids are an important factor in acquisition and dissemination of antibiotic resistance genes through conjugation within bacterial population [<xref ref-type="bibr" rid="B5">5</xref>]. This study investigated the presence of integrons and plasmids in multidrug resistant <italic>E. coli</italic> isolates from pregnant women.</p>
    </sec>
    <sec id="sec2">
      <title>2. Objective</title>
      <p>To screen multidrug resistant <italic>E. coli</italic> isolates for the presence of integrons and plasmids from pregnant women with asymptomatic bacteriuria.</p>
    </sec>
    <sec id="sec3">
      <title>3. Methods</title>
      <sec id="sec3dot1">
        <title>3.1. Study Design and Setting</title>
        <p>Between May 2011 and July 2016, we conducted cross-sectional study to determine the prevalence of Asymptomatic bacteriuria in pregnant women attending antenatal clinics in selected the Nairobi county health centers. A questionnaire was used to obtain information from the study participants. The information obtained consisted of identification number, age, phone number, educational level, marital status, parity, gestational age, and human immune virus status. The inclusion criteria involved the first visits of apparently healthy pregnant women attending clinic for first the visit and those who gave their informed consent to participate in the study. However, the women excluded from the study were those who had features of urinary tract infection, fever, had taken antibiotics within 2 weeks of the study, had medical chronic conditions (HIV) retroviral disease, and those who declined to consent despite adequate counselling. </p>
      </sec>
      <sec id="sec3dot2">
        <title>3.2. Methods for Collecting Samples</title>
        <p>All pregnant women at the antenatal clinic, who met the inclusion criteria, were counselled on how to collect midstream urine. This involved initial instructions by the female attending trained nurses and laboratory technicians. The laboratory technicians supervised the urine-sample collection. A total of 1020 pregnant women who made the inclusion criteria on their first visit at the antenatal clinic provided mid-stream urine for investigation. The samples were collected in a clean, leak-proof container with no visible signs of contamination and were labeled properly with demographic information of patients. The specimens were transported at 4˚C temperature in a cool box from the clinic to the processing laboratory at the KEMRI centre of microbiology. The samples were microscopically examined for pus cells, bacteria and then cultured within two hours after collection. They were cultured on air-dried plates of Cysteine lactose electrolyte deficient agar (CLED) and on blood agar, using a calibrated loop delivering 0.002 ml of urine. Plates were incubated aerobically at 37˚C overnight. Colony counts yielding bacterial growth of 105 organism/ml or more of pure isolates was deemed significant. </p>
      </sec>
      <sec id="sec3dot3">
        <title>3.3. Sample Size</title>
        <p>The formula used for sample size calculation was n = z<sup>2</sup> (p (1 − p))/e<sup>2</sup> [<xref ref-type="bibr" rid="B6">6</xref>]. This study used an estimate of the proportion of population falling into the group of interest at 50%. The prevalence of asymptomatic bacteriuria in pregnancy in low socio-economic population and with specific inclusion criteria is unknown in Kenya. This gave the minimum sample size at 384 however due large patient numbers that are attended at the clinics of interest the sample size was increased 1020 for better representation.</p>
      </sec>
      <sec id="sec3dot4">
        <title>
          3.4. Identification of
          <italic>E.</italic>
          <italic>c</italic>
          <italic>oli</italic>
        </title>
        <p>A colony count yielding bacterial growth of 10<sup>5</sup> organism/ml or more of pure isolates was deemed significant. The isolates were characterised by colonial morphology, gram stain followed by microscopic examination, motility test and biochemical tests. Colonial appearance of yellow (lactose fermenting) with deep centres were suspected to be <italic>E. coli</italic>. Isolates were identified to species level using standard methods according to Clinical and Laboratory Standard Institute Guideline [<xref ref-type="bibr" rid="B7">7</xref>].</p>
      </sec>
      <sec id="sec3dot5">
        <title>3.5. Antimicrobial Susceptibility Testing</title>
        <p>All <italic>E.</italic><italic>coli</italic> isolated from asymptomatic bacteriuria cases were screened for anti-microbial susceptibility test using the disc diffusion method [<xref ref-type="bibr" rid="B8">8</xref>] on Mueller-Hinton (MH) agar (Oxoid). Methods recommended by the Clinical and Laboratory Standard Institute Guidelines [<xref ref-type="bibr" rid="B7">7</xref>] were used. Antibiotic discs from Biomerieux-France and Becton Dickinson-USA were used. Antibiotic concentrations on each disc were as follows, Kanamycin 10 mg, Gentamicin 10 mg, Nalidixic acid 30 mg, Chloramphenicol 30 mg, Ampicillin 10mg, Ceftazidime 30 mg, Tetracycline 30 mg, Cotrimoxazole (23.75/1.25 mg), Ciprofloxacin 5 mg and Cefotaxime 30 mg. Mueller-Hinton agar was used for anti-microbial susceptibility test and the inhibition zones sizes were interpreted according to WHO guidelines (CLSI, 2023). <italic>E. coli</italic> ATCC 25922 (Mast Group Ltd., Merseyside, UK) was used as reference strain for quality control. The class of antibiotics that were tested are: <italic>β</italic>-lactams, cephalosporins, quinolones, aminoglycosides, and macrolides. Some of these classes of antibiotics are known to have their resistant genes conferred by mobile determinants factors.</p>
      </sec>
      <sec id="sec3dot6">
        <title>3.6. Plasmid Mediated Resistant Genes Amplification and Curing</title>
        <p>The detection of gene sequences coding for the TEM, OXA, SHV and CTX-M-type enzymes was performed by using a commercial Plasmid Miniprep kit (GenEluteTM) (Sigma-Aldrich), following the protocol delivered by the manufacturer. PCR was applied using the ready Mix Kit (REDTaq® Ready MixTM PCR reaction Mix with MgCl2), Sigma-Aldrich, and the primers used to amplify the above-mentioned genes are listed in <bold>Table 1</bold><bold>.</bold> Cycling conditions were as follows: TEM- gene initial denaturation at 96˚C for 5 min, followed by 35 cycles of denaturation at [96˚C for 1 min, 1 min at 58˚C 1 min 72˚C] and a final extension step 1 cycle at 72˚C for 10 min. SHV-gene initial denaturation1 cycle at 96˚C for 5 min, followed by 35 cycles of denaturation at [96˚C for 1 min, 1 min at 60˚C 1 min 72˚C] and a final extension step 1 cycle at 72˚C for 10 min. OXA-1 gene initial denaturation at 96˚C for 5 min, followed by 35 cycles of denaturation at [96˚C for 1 min, 1 min at 60˚C 1 min 72˚C] and a final extension step 1 cycle at 72˚C for 10 mins CTX-MU1 gene initial denaturation at 94˚C for 7 min, followed by 35 cycles of denaturation at [94˚C for 50 secs, 50˚C 40 sec 72˚C 1 min] and a final extension step 1 cycle at 72˚C for 10 min and CTX-M1 cycle of 5 min at 72˚C,1 cycle of 10 min at 94˚C, 30 cycles of [1 min at 94˚C, 1min at 48˚C, 1 min at 72˚C], 1 cycle of 7 min at 72˚C I Annealing temperatures differed according to the primer pair used. Amplified PCR products were separated on 0.8% agarose gels, stained with ethidium bromide and visualized under UV illumination. Appropriate positive and negative controls were used in all cases [<xref ref-type="bibr" rid="B9">9</xref>]. PCR amplification of blaCTX-M alleles was carried out with primers CTX-MU1 (5'-ATGTGCAGYACCAGTAARGT) and CTX-MU2 (5'-TGGGTRAARTARGTSACCAGA), designed on conserved regions of blaCTX-M genes. These primers target amplification of a 593-bp internal region of the blaCTX-M genes [<xref ref-type="bibr" rid="B10">10</xref>].</p>
        <p>The curing was done according the method used by Letchumanan [<xref ref-type="bibr" rid="B11">11</xref>]. All plasmid positive isolates were subjected to a curing treatment using Ethidium Bromide (EB). The isolates were grown in fresh Tryptic Soy Broth (TSB) (HiMedia, India) and TSB supplemented with 0.2 mg/mL EB, then incubated at 37˚C for 24 hours under constant agitation. After treatment with the curing agent, the profiles of resistance phenotypes were examined for the antibiotic susceptibility profile. A loopful of growth, cultured on Mueller Hinton Agar (MHA) plates, and then put the antimicrobial disk on (MHA). Absence of inhibition zones on Mueller Hinton agar was indicative of plasmids-mediated resistance (plasmid cured), while presence of zone of inhibition on Mueller Hinton agar was indicative of chromosome-mediated resistance or plasmid not cured.</p>
        <p><bold>Table 1.</bold> The primers used to amplify the genes. </p>
        <table-wrap id="tbl1">
          <label>Table 1</label>
          <table>
            <tbody>
              <tr>
                <td>Primer</td>
                <td>Primer sequences</td>
                <td>PCR cycles</td>
                <td>Reference</td>
                <td>Expected size (bp)</td>
              </tr>
              <tr>
                <td>TEM-1/F TEM-1/R</td>
                <td>ATGAGTATTCAACATTTCCG CTGACAGTTACCAATGCTTA</td>
                <td>1 cycle of 5 minutes (min) at 96˚C; 35 cycles of [1 min at 96˚C, 1 min at 58˚C, 1 min at 72˚C]; 1 cycle of 10min at 72˚C.</td>
                <td>
                  [
                  <xref ref-type="bibr" rid="B53">53</xref>
                  ]
                </td>
                <td>867</td>
              </tr>
              <tr>
                <td>SHV-1/F SHV-1/R</td>
                <td>GGTTATGCGTTATATTCGCC TTAGCGTTGCCAGTGCTC</td>
                <td>1 cycle of 5min at 96˚C; 35 cycles of [1 min at 96˚C, 1 min at 60˚C, 1 min at 72˚C; 1 cycle of 10 min at 7˚C</td>
                <td>
                  [
                  <xref ref-type="bibr" rid="B53">53</xref>
                  ]
                </td>
                <td>867</td>
              </tr>
              <tr>
                <td>OXA-1/F OXA-1/R</td>
                <td>ACACAATACATATCAACTTCGC AGTGTGTTTAGAATGGTGATC</td>
                <td>1 cycle 5 min at 96˚C; 35 cycles of [1 min at 96˚C, 1 min at 60˚C, 2 min at 72˚C]; 1 cycle of 10 min at 72˚C</td>
                <td>
                  [
                  <xref ref-type="bibr" rid="B53">53</xref>
                  ]
                </td>
                <td>814</td>
              </tr>
              <tr>
                <td>CTX-MU1 CTX-MU2</td>
                <td>ATGTGCAGYACCAGTAARGT TGGGTRAARTARGTSACCAGA</td>
                <td>1 cycle of 7 min at 94˚C; 35 cycles of [50 seconds (sec) at 94˚C, 40 sec at 50˚C, 1 min at 72˚C]; 1 cycle of 5 min at 72˚C</td>
                <td>
                  [
                  <xref ref-type="bibr" rid="B54">54</xref>
                  ]
                </td>
                <td>593</td>
              </tr>
              <tr>
                <td>CTX-M1-A2 CTX-M1-B2</td>
                <td>CTT CCA GAA TAA GGA ATC CCG TTT CCG CTA TTA CAA</td>
                <td>1 cycle of 10 min at 94˚C, 30 cycles of [1 min at 94˚C, 1 min at 48˚C, 1 min at 72˚C], 1 cycle of 7 min at 72˚C</td>
                <td>
                  [
                  <xref ref-type="bibr" rid="B38">38</xref>
                  ]
                </td>
                <td>499</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
        <p>Plasmids present in strains <italic>E. coli</italic> PDK-9, R1 andV517 will be used as molecular weight standard.</p>
      </sec>
      <sec id="sec3dot7">
        <title>3.7. PCR Assay for Integrase Genes and Gene Cassettes</title>
        <p>Detection of class 1 and class 2 integrons conserved regions was performed by polymerase chain reaction (PCR). The primers that were used are as shown below in <bold>Table 2</bold>. A colony of each multidrug resistant isolates was suspended in 25 µl of reaction mixer containing 2.5 µl of 10x PCR reaction buffer, 1.5 µl of 50 mMMGCl2, 2 µl of 2.5 mMdNTP (dNTP, dCTP, dTTP, dGTP), 1 µl of primer (forward and reverse) together with 1 unit of TaqDNA polymerase (5 U/µl). The volume of the reaction mixture was adjusted by adding filtered deionized water. The PCR was performed in a PerkinElmer Gene Amp PCR system 9600-R (Roche Diagnostic Gmbh, Mannheim, Germany). Polymerase chain reaction was performed under the following conditions; denaturing at 94˚C for 12 minutes followed by 30 cycles of 1minutes at 94˚C, 30 seconds at Tannealing at 60˚C and Textension (2 min) at 72˚C, where Tannealing is specific annealing temperature and Textension is the specific elongation time for each reaction, with a final extension at 72˚C for 10minutes. The PCR products were separated by horizontal mini electrophoresis on 1% agarose gel at 100 V (50 mA) and stained with 0.5 µg/ml ethidium bromide for 30 minutes and photographed. Escherichia coli ur-31 and <italic>E. coli</italic> ur-60 was used as positive control.</p>
        <p><bold>Table 2</bold><bold>.</bold> Specific oligonucleotide primers and conditions PCR [<xref ref-type="bibr" rid="B12">12</xref>].</p>
        <table-wrap id="tbl2">
          <label>Table 2</label>
          <table>
            <tbody>
              <tr>
                <td>Gene</td>
                <td>Primer sequence</td>
                <td>Size of product (bp)</td>
                <td>Reference</td>
                <td>Condition</td>
              </tr>
              <tr>
                <td>Int 1-F</td>
                <td>GGT CAA GGA TCT GGA TTT CG</td>
                <td>786 - 766 bp</td>
                <td>
                  [
                  <xref ref-type="bibr" rid="B12">12</xref>
                  ]
                </td>
                <td>A</td>
              </tr>
              <tr>
                <td>Int I-R</td>
                <td>ACA TGC GTG TAA ATC ATC GTC</td>
                <td>303 - 324</td>
                <td>
                </td>
                <td>
                </td>
              </tr>
              <tr>
                <td>Int I2-F</td>
                <td>CAC GGA TAT GCG ACA AAA AGG T</td>
                <td>219 - 240 bp</td>
                <td>
                  [
                  <xref ref-type="bibr" rid="B12">12</xref>
                  ]
                </td>
                <td>A</td>
              </tr>
              <tr>
                <td>Int I2-R</td>
                <td>GTA GCA AAC GAG TGA CGA AAT G</td>
                <td>1007 - 986</td>
                <td>
                </td>
                <td>
                </td>
              </tr>
              <tr>
                <td>Int I3-F</td>
                <td>AGT GGG TGG CGA ATG AGT G</td>
                <td>178 - 196 bp</td>
                <td>
                  [
                  <xref ref-type="bibr" rid="B12">12</xref>
                  ]
                </td>
                <td>A</td>
              </tr>
              <tr>
                <td>Int I3-R</td>
                <td>TGT TCT TGT ATC GGC AGG TG</td>
                <td>777 - 758</td>
                <td>
                </td>
                <td>
                </td>
              </tr>
              <tr>
                <td>5’CS</td>
                <td>GGC ATC CAA GCAGCAAG</td>
                <td>1190 - 1206</td>
                <td>
                  [
                  <xref ref-type="bibr" rid="B12">12</xref>
                  ]
                </td>
                <td>B</td>
              </tr>
              <tr>
                <td>3’CS</td>
                <td>AAG CAG ACT TGA CCT GA</td>
                <td>1342 - 1326</td>
                <td>
                </td>
                <td>
                </td>
              </tr>
              <tr>
                <td>Att I2-F</td>
                <td>GAC GGC ATG CAC GAT TTG TA</td>
                <td>1943 - 1962</td>
                <td>
                  [
                  <xref ref-type="bibr" rid="B12">12</xref>
                  ]
                </td>
                <td>B</td>
              </tr>
              <tr>
                <td>orfX-R</td>
                <td>GAT GCC ATC GCA AGT ACG AG</td>
                <td>4848 - 4928</td>
                <td>
                </td>
                <td>
                </td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
        <p>Condition-A: 5 min at 94˚C; 32 cycles of 1 min at 94˚C, 1 min at 60˚C, 2 min at 72˚C; 10 min at 72˚C. Condition-B: 5 min at 94˚C; 35 cycles of 1 min at 94˚C, 1 min at 58˚C, 2 min at 72˚C; 10 min at 72˚C.</p>
        <p>Gene cassettes (variable region) for class 1 was amplified using hep58 (5'-TCATGGCTTGTTATGACTGT-3') and hep59 (5'GTAGGGCTTATTATGCACGC3') as described by Machado [<xref ref-type="bibr" rid="B12">12</xref>]. The gene cassettes for the class 2 integrons were amplified using hep74 (5'-CGGGATCCCGGACGGCA3') and hep51 (5'-GATGCCATCGCAAGTACGAG-3') same-sized amplicons was digested with RsaI and HinfI (Boehringer Mannheim). All the PCR amplification was conducted as for the integrase amplifications but annealing temperature at 50˚C.</p>
      </sec>
      <sec id="sec3dot8">
        <title>3.8. Ethical Clearance</title>
        <p>Ethical clearance for this study was obtained from the KEMRI Ethics Clearance Committee. </p>
      </sec>
      <sec id="sec3dot9">
        <title>3.9. Data Analysis</title>
        <p>Data analysis was descriptive and multinomial logistic regression analysis was done at 95% confidence level using SPSS version 23.0 (IBM SPSS Statistics Inc., Chicago, IL, USA). A P-value of less than or equal to 0.05 was considered statistically significant.</p>
      </sec>
    </sec>
    <sec id="sec4">
      <title>4. Results</title>
      <p>The target group of pregnant women attending antenatal clinic at Health Centres were from a low socio-economic background. The County clinics were stratified into strata and those offering antenatal clinic services then were randomly selected. One thousand and twenty (1020) women visiting the antenatal clinic for first visit who met the inclusion criteria participated in the study. A total 219 of the participants had ASB, giving a prevalence of 21.5% (95 CI range 19.1% - 23.9%).</p>
      <sec id="sec4dot1">
        <title>
          4.1.
          <italic>E.</italic>
          <italic>c</italic>
          <italic>oli</italic>
          Isolated from Positive Bacteria Samples
        </title>
        <p>A total of 85 isolates were identified as <italic>E. coli</italic> from the participants who had ASB <bold>Table 3</bold>. These was the most frequent causative agent. </p>
      </sec>
      <sec id="sec4dot2">
        <title>
          4.2. Antibiotic Sensitivity Profile for
          <italic>E.</italic>
          <italic>c</italic>
          <italic>oli</italic>
          Isolates
        </title>
        <p><italic>E. coli</italic> isolates from this study had resistance to most antibiotics tested except for imipenem. The resistance ranged from 11.6% for gentamycin and to 90.6% for ampicillin see <bold>Table 3</bold>. </p>
        <p><bold>Table 3.</bold> Antibiotic sensitivity pattern of <italic>E. coli</italic><italic>isolates</italic> in asymptomatic bacteriuria.</p>
        <table-wrap id="tbl3">
          <label>Table 3</label>
          <table>
            <tbody>
              <tr>
                <td>Antibiotics</td>
                <td>Susceptibility profile</td>
                <td>
                  <italic>E.</italic>
                  <italic>coli</italic>
                  (n = 85)
                </td>
              </tr>
              <tr>
                <td rowspan="3">Ampicillin</td>
                <td>R</td>
                <td>77 (90.6%)</td>
              </tr>
              <tr>
                <td>I</td>
                <td>6 (7.0%)</td>
              </tr>
              <tr>
                <td>S</td>
                <td>2 (2.4%)</td>
              </tr>
              <tr>
                <td rowspan="3">Tetracycline</td>
                <td>R</td>
                <td>51 (60.0%)</td>
              </tr>
              <tr>
                <td>I</td>
                <td>8 (9.4%)</td>
              </tr>
              <tr>
                <td>S</td>
                <td>26 (30.6%)</td>
              </tr>
              <tr>
                <td rowspan="3">Chloramphenicol</td>
                <td>R</td>
                <td>17 (17.0%)</td>
              </tr>
              <tr>
                <td>I</td>
                <td>8 (9.4%)</td>
              </tr>
              <tr>
                <td>S</td>
                <td>60 (70.6%)</td>
              </tr>
              <tr>
                <td rowspan="3">Cotrimoxazole</td>
                <td>R</td>
                <td>56 (65.9%)</td>
              </tr>
              <tr>
                <td>I</td>
                <td>3 (3.5%)</td>
              </tr>
              <tr>
                <td>S</td>
                <td>26 (30.6%)</td>
              </tr>
              <tr>
                <td rowspan="3">Ciprofloxacin</td>
                <td>R</td>
                <td>16 (18.8%)</td>
              </tr>
              <tr>
                <td>I</td>
                <td>6 (7.1%)</td>
              </tr>
              <tr>
                <td>S</td>
                <td>63 (74.1%)</td>
              </tr>
              <tr>
                <td rowspan="3">Nalidixic acid</td>
                <td>R</td>
                <td>36 (42.3%)</td>
              </tr>
              <tr>
                <td>I</td>
                <td>2 (2.4%)</td>
              </tr>
              <tr>
                <td>S</td>
                <td>47 (55.3%)</td>
              </tr>
              <tr>
                <td rowspan="3">Ceftazidime</td>
                <td>R</td>
                <td>16 (18.8%)</td>
              </tr>
              <tr>
                <td>I</td>
                <td>8 (9.4%)</td>
              </tr>
              <tr>
                <td>S</td>
                <td>61 (71.8%)</td>
              </tr>
              <tr>
                <td rowspan="3">Gentamycin</td>
                <td>R</td>
                <td>10 (11.8%)</td>
              </tr>
              <tr>
                <td>I</td>
                <td>4 (4.7%)</td>
              </tr>
              <tr>
                <td>S</td>
                <td>71 (83.5%)</td>
              </tr>
              <tr>
                <td rowspan="3">Amoxy/clavua</td>
                <td>R</td>
                <td>49 (57.6%)</td>
              </tr>
              <tr>
                <td>I</td>
                <td>17 (20.0%)</td>
              </tr>
              <tr>
                <td>S</td>
                <td>19 (22.4%)</td>
              </tr>
              <tr>
                <td rowspan="3">Cefotaxime</td>
                <td>R</td>
                <td>63 (74.1%)</td>
              </tr>
              <tr>
                <td>I</td>
                <td>20 (23.5%)</td>
              </tr>
              <tr>
                <td>S</td>
                <td>2 (2.4%)</td>
              </tr>
              <tr>
                <td rowspan="3">Imipenem</td>
                <td>R</td>
                <td>0 (0%)</td>
              </tr>
              <tr>
                <td>I</td>
                <td>0 (0%)</td>
              </tr>
              <tr>
                <td>S</td>
                <td>85 (100%)</td>
              </tr>
              <tr>
                <td rowspan="3">Kanamycin</td>
                <td>R</td>
                <td>66 (77.6%)</td>
              </tr>
              <tr>
                <td>I</td>
                <td>5 (5.9%)</td>
              </tr>
              <tr>
                <td>S</td>
                <td>14 (16.5%)</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
      </sec>
      <sec id="sec4dot3">
        <title>
          4.3. PCR Detection of the BlaOXA-1 and Bla CTX-M Gene in
          <italic>E.</italic>
          <italic>c</italic>
          <italic>oli</italic>
          Isolates
        </title>
        <p><xref ref-type="fig" rid="fig1">Figure 1</xref> demonstrated the presence of blaOXA-1 and reported in eight isolates. The gene was reported at 813 bp band on PCR products on 1% agarose gel. Eight of the multidrug resistance isolates reported presence blaOXA-1 genes. </p>
        <fig id="fig1">
          <label>Figure 1</label>
          <graphic xlink:href="https://html.scirp.org/file/2260711-rId13.jpeg?20251203091638" />
        </fig>
        <p>Electrophoresis of PCR products on a 1% agarose gel. Lane M. Ladder 100 bp. Lane 11. Positive control. Lanes 10 negative control Lane 1, 2, 3, 5, 16, 18, 19, and 20 Positive samples that indicated 813 bp PCR product.</p>
        <p><bold>Figure 1</bold><bold>.</bold> PCR detection of the <italic>bla</italic><italic><sub>OXA</sub></italic><sub>-1</sub> gene in <italic>E. coli</italic> isolates.</p>
        <p>PCR detection of the blaCTX-M gene was reported in 17 <italic>E. coli</italic> isolates and indicated in <xref ref-type="fig" rid="fig2">Figure 2</xref>. The amplicons ranged from 600 to 700 pb.</p>
        <fig id="fig2">
          <label>Figure 2</label>
          <graphic xlink:href="https://html.scirp.org/file/2260711-rId14.jpeg?20251203091639" />
        </fig>
        <p>Electrophoresis of PCR products on a 1% agarose gel. Lane1. Ladder 100 bp. Lane 2. Positive control. Lane 3. Positive control. Lanes 4, negative control 5, 6, 7, 8, and 9, 10, 11, 12 to 22 Positive samples that indicated 600 bp to 700 bp PCR product. </p>
        <p><bold>Figure</bold><bold>2.</bold> PCR detection of the <italic>blaCTX</italic>-<italic>M</italic> gene in <italic>E. coli</italic> isolates. </p>
      </sec>
      <sec id="sec4dot4">
        <title>4.4. Plasmid Curing</title>
        <p>In this study it was observed that fifteen isolates became susceptible to antibiotics they had previously shown resistance to as indicated <bold>Table 4</bold>. It was noted that those isolates that demonstrated the presence of the BLACTX-M genes only were fully cured. Five isolates that demonstrated plasmids with a combination of BLAOXA-1 and BLACTX-M genes remained resistant to some antibiotics after curing.</p>
        <p>Table 4. Comparison of the presence of Variable regions positive, plasmids and antibiotic resistance patterns after curing with Ethidium bromide.</p>
        <table-wrap id="tbl4">
          <label>Table 4</label>
          <table>
            <tbody>
              <tr>
                <td rowspan="2">
                </td>
                <td colspan="2" rowspan="2">
                  <italic>
                    <bold>Bla</bold>
                  </italic>
                  <bold>-</bold>
                  <italic>
                    <bold>
                      <sub>OXA</sub>
                    </bold>
                  </italic>
                </td>
                <td colspan="2" rowspan="1">
                  <italic>
                    <bold>bla</bold>
                  </italic>
                  <italic>
                    <bold>
                      <sub>CTX</sub>
                    </bold>
                  </italic>
                  <bold>
                    <sub>-</sub>
                  </bold>
                  <italic>
                    <bold>
                      <sub>M</sub>
                    </bold>
                  </italic>
                </td>
                <td colspan="6">
                  <italic>
                    <bold>Integron</bold>
                  </italic>
                </td>
                <td colspan="2" rowspan="2">
                  <italic>
                    <bold>Antibiotic resistant pattern</bold>
                  </italic>
                </td>
                <td colspan="2" rowspan="1">
                  <italic>
                    <bold>Phylogroups</bold>
                  </italic>
                </td>
                <td colspan="2" rowspan="1">
                  <italic>
                    <bold>Cured isolate antibiotic resistant profile</bold>
                  </italic>
                </td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>Int</bold>
                  </italic>
                  <bold>1</bold>
                </td>
                <td colspan="2">
                  <italic>
                    <bold>Int</bold>
                  </italic>
                  <bold>2</bold>
                </td>
                <td colspan="2">
                  <italic>
                    <bold>int</bold>
                  </italic>
                  <bold>3</bold>
                </td>
              </tr>
              <tr>
                <td>
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>193</bold>
                </td>
                <td colspan="2">+</td>
                <td colspan="2">+</td>
                <td colspan="2">430,800 bp</td>
                <td colspan="2">
                </td>
                <td colspan="2">100 bp</td>
                <td colspan="2">AMP-TET-COT-NAD-AM-CFX-</td>
                <td colspan="2">B2</td>
                <td colspan="2">COT-NAD</td>
              </tr>
              <tr>
                <td>
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>243</bold>
                </td>
                <td colspan="2">+</td>
                <td colspan="2">+</td>
                <td colspan="2">766 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">-</td>
                <td colspan="2">AMP-CHLO-AM</td>
                <td colspan="2">B2</td>
                <td colspan="2">CHLO</td>
              </tr>
              <tr>
                <td>
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>66</bold>
                </td>
                <td colspan="2">+</td>
                <td colspan="2">+</td>
                <td colspan="2">800 bp</td>
                <td colspan="2">1000 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">AMP-TET-COT-NAD-AM-CFX-</td>
                <td colspan="2">B2</td>
                <td colspan="2">AMP-TET-COT-NAD-AM-CFX</td>
              </tr>
              <tr>
                <td>
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>387</bold>
                </td>
                <td colspan="2">+</td>
                <td colspan="2">-</td>
                <td colspan="2">-</td>
                <td colspan="2">-</td>
                <td colspan="2">100 bp</td>
                <td colspan="2">AMP-CFX</td>
                <td colspan="2">B1</td>
                <td colspan="2">-</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>375</bold>
                </td>
                <td colspan="2">+</td>
                <td colspan="2">+</td>
                <td colspan="2">-</td>
                <td colspan="2">280 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">AMP-TET-COT-CFX-</td>
                <td colspan="2">D</td>
                <td>COT</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>351</bold>
                </td>
                <td colspan="2">-</td>
                <td colspan="2">+</td>
                <td colspan="2">-</td>
                <td colspan="2">-</td>
                <td colspan="2">100pb</td>
                <td colspan="2">AMP-TET-COT</td>
                <td colspan="2">D</td>
                <td>COT</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>123</bold>
                </td>
                <td colspan="2">-</td>
                <td colspan="2">+</td>
                <td colspan="2">430 bp</td>
                <td colspan="2">
                </td>
                <td colspan="2">-</td>
                <td colspan="2">AMP-CAZ-AM-CFX</td>
                <td colspan="2">A</td>
                <td>-</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>88</bold>
                </td>
                <td colspan="2">-</td>
                <td colspan="2">+</td>
                <td colspan="2">766 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">-</td>
                <td colspan="2">AMP-TET-COT-NAD-CAZ-AM-CFX-</td>
                <td colspan="2">B2</td>
                <td>AMP-TET-COT-NAD-CAZ-AM-CFX-</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>129</bold>
                </td>
                <td colspan="2">+</td>
                <td colspan="2">+</td>
                <td colspan="2">-</td>
                <td colspan="2">-</td>
                <td colspan="2">700 bp</td>
                <td colspan="2">AMP-TET-COT-NAD-CFX</td>
                <td colspan="2">B2</td>
                <td>COT-NAD</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>348</bold>
                </td>
                <td colspan="2">-</td>
                <td colspan="2">+</td>
                <td colspan="2">800 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">600 bp</td>
                <td colspan="2">AMP-TET-CHLO-COT-CIP-NAD-CAZ-AM-CFX</td>
                <td colspan="2">B2</td>
                <td>CHLO-COT-CIP-NAD</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>94</bold>
                </td>
                <td colspan="2">-</td>
                <td colspan="2">+</td>
                <td colspan="2">430 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">-</td>
                <td colspan="2">AMP-AM</td>
                <td colspan="2">B1</td>
                <td>-</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>202</bold>
                </td>
                <td colspan="2">+</td>
                <td colspan="2">+</td>
                <td colspan="2">800 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">600 bp</td>
                <td colspan="2">AMP-TET-COT-CIP-NAD-CAZ-GEN-AM-CFX-</td>
                <td colspan="2">B2</td>
                <td>
                </td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>597</bold>
                </td>
                <td colspan="2">+</td>
                <td colspan="2">+</td>
                <td colspan="2">766 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">-</td>
                <td colspan="2">AMP-TET-COT-CIP-NAD-CFX-</td>
                <td colspan="2">D</td>
                <td>COT-CIP-NAD</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>656</bold>
                </td>
                <td colspan="2">-</td>
                <td colspan="2">+</td>
                <td colspan="2">788 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">-</td>
                <td colspan="2">AMP-TET-CHLO-COT-NAD-CAZ-CFX-</td>
                <td colspan="2">B1</td>
                <td>-</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>538</bold>
                </td>
                <td colspan="2">-</td>
                <td colspan="2">+</td>
                <td colspan="2">800 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">600 bp</td>
                <td colspan="2">AMP-TET-CHLO-CIP-NAD-CAZ-GEN-AM-CFX</td>
                <td colspan="2">D</td>
                <td>-</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>476</bold>
                </td>
                <td colspan="2">-</td>
                <td colspan="2">+</td>
                <td colspan="2">800 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">600 bp</td>
                <td colspan="2">AMP-TET-COT-CIP-NAD-CAZ-GEN-AM-CFX</td>
                <td colspan="2">B2</td>
                <td>-</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>403</bold>
                </td>
                <td colspan="2">-</td>
                <td colspan="2">+</td>
                <td colspan="2">-</td>
                <td colspan="2">-</td>
                <td colspan="2">100 bp</td>
                <td colspan="2">AMP-TET-CFX</td>
                <td colspan="2">A</td>
                <td>-</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>317</bold>
                </td>
                <td colspan="2">-</td>
                <td colspan="2">+</td>
                <td colspan="2">800 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">-</td>
                <td colspan="2">AMP-TET-CHLO-COT-NAD-CAZ-AM</td>
                <td colspan="2">A</td>
                <td>-</td>
              </tr>
              <tr>
                <td colspan="2">B455</td>
                <td colspan="2">-</td>
                <td colspan="2">+</td>
                <td colspan="2">788 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">-</td>
                <td colspan="2">AMP-TET-COT-CIP-NAD-AM-CFX</td>
                <td colspan="2">B1</td>
                <td>-</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>335</bold>
                </td>
                <td colspan="2">-</td>
                <td colspan="2">+</td>
                <td colspan="2">766 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">-</td>
                <td colspan="2">AMP-TET-CHLO-COT-AM-CFX</td>
                <td colspan="2">B2</td>
                <td>-</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>481</bold>
                </td>
                <td colspan="2">-</td>
                <td colspan="2">+</td>
                <td colspan="2">800 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">600 bp</td>
                <td colspan="2">AMP-TET-COT-CIP-NAD-CAZ-GEN-AM-CFX</td>
                <td colspan="2">B2</td>
                <td>-</td>
              </tr>
              <tr>
                <td colspan="2">
                  <italic>
                    <bold>R</bold>
                  </italic>
                  <bold>519</bold>
                </td>
                <td colspan="2">
                </td>
                <td colspan="2">
                </td>
                <td colspan="2">800 bp</td>
                <td colspan="2">1000 bp</td>
                <td colspan="2">-</td>
                <td colspan="2">AMP-TET-CHLO-CIP-NAD-CAZ-GEN-AM-CFX</td>
                <td colspan="2">B2</td>
                <td>-</td>
              </tr>
            </tbody>
          </table>
        </table-wrap>
      </sec>
      <sec id="sec4dot5">
        <title>4.5. Detection of Integron Variable Region (VR)</title>
        <fig id="fig3">
          <label>Figure 3</label>
          <graphic xlink:href="https://html.scirp.org/file/2260711-rId15.jpeg?20251203091640" />
        </fig>
        <p>Electrophoresis of PCR products on a 1% agarose gel. Lane M. Ladder 100 bp. Lane M ladder. Lane 12 is Positive control. Lanes 11 negative control, Lane 2 and 15 Positive samples that indicated 766bp PCR product. Lane 18 and 19 indicated 788 bp PCR product. Lane 15 and 19 indicated 1000 bp PCR product. Lane 2, 9 and 19 indicated 100 bp PCR product. Lane 12 indicated 700 bp PCR product. Lane 22 indicated 280 bp PCR product. Lane 21 and 23 indicated two bands below 100bp mark this was also observed in lane 2, 3, 6, 8, 21 and 22 positive control lane and lane 16. Lane 2 and 7 demonstrated 491 bp.</p>
        <p><bold>Figure</bold><bold>3.</bold> Detection of integron variable region (VR).</p>
        <p>Amplification of integron variable regions (VR) indicated in <xref ref-type="fig" rid="fig3">Figure 3</xref> and <xref ref-type="fig" rid="fig4">Figure 4</xref> showed that 21 of the isolates produced variable region. One (1) isolate yielded three VR bands (430 bp, 100 bp, &amp; 100 bp), Seven (7) of the isolates demonstrated two VR bands (2 - 1000 bp &amp; 800 bp and 5 - 800 bp &amp; 600 bp) and 13 yielded a single VR band. A total twenty-one isolates yielded integron VR and yielded twenty-three bands. A total of eight 800 pb, five 600 bp, four 100 bp, three 430 bp, two 1000 bp and one 280 bp.</p>
        <fig id="fig4">
          <label>Figure 4</label>
          <graphic xlink:href="https://html.scirp.org/file/2260711-rId16.jpeg?20251203091640" />
        </fig>
        <p>Electrophoresis of PCR products on a 1% agarose gel. Lane M. Ladder 100 bp. Lane M ladder. Lane 3 is Positive control. Lanes 2 negative control, Lane 1, 5, 16, 23 29 and 30 Positive samples that indicated 788bp PCR product. While Lane 5, 16, 23 29 and 30 Positive samples that indicated 600bp PCR product. </p>
        <p><bold>Figure 4</bold>. Class 1 and class 3 integron profile.</p>
      </sec>
    </sec>
    <sec id="sec5">
      <title>5. Discussion</title>
      <p>In this study the Gram-negative bacteria were more prevalent with <italic>E. coli</italic> as the most frequent at 38.8%. This was in agreement with a study done by Agarwal in India which reported Escherichia coli at 39.2% [<xref ref-type="bibr" rid="B13">13</xref>]. <italic>E. coli</italic> was a major pathogen isolated from the urine cultures and accounted for one-third of the positive cultures with significant bacteriuria.<italic>E.</italic><italic>coli</italic> is considered major uropathogen due to a number of virulence factors specific for colonization and invasion of the urinary epithelium [<xref ref-type="bibr" rid="B14">14</xref>]. In overall gram-negative bacteria have a unique structure, which assists in attachment to the uro-epithelium and prevent pathogens from being washed away by urine allowing growth and tissue invasion resulting colonization and infection during pregnancy [<xref ref-type="bibr" rid="B15">15</xref>]. While the range of etiological agents causing asymptomatic and symptomatic UTI in pregnant women is relatively constant, the susceptibility profile is different in different geographical locations. </p>
      <sec id="sec5dot1">
        <title>5.1. The Antibiotic Susceptibility Profile for the Bacterial Isolates</title>
        <p><italic>E.</italic><italic>coli</italic> isolates from this study had resistance to most antibiotics tested except for Imipenem. The resistance ranged from 11.6% for gentamycin to 90.6% for ampicillin. The current study showed high level of resistance to first line antimicrobial drugs such as cotrimoxazole. These findings agreed with a previous study done in Tanzania [<xref ref-type="bibr" rid="B16">16</xref>]. The high resistance to cotrimoxazole observed in the current study call for the need to strengthen surveillance to identify changes in sensitivity pattern among urinary tract isolates. </p>
        <p>The current study reported high level of cefotaxime resistance with the highest resistance reported for <italic>E. coli</italic> at 74.1%. Cefotaxime is a second line antimicrobial agent and is a third generation of cephalosporins. A possible explanation for the resistance found might be the presence of mobile resistant factors in these strains. There were 17 (14.0%) of the gram-negative isolates which were resistant to Cefotaxime, Ceftazidime and amoxicillin-clavulanic acid. An earlier study done in Kenya reported a similar resistance pattern in uropathogen <italic>E.</italic><italic>coli</italic> in Kenya [<xref ref-type="bibr" rid="B17">17</xref>]. This could be an indication of co-selection of the genes conferring resistance to these antibiotics. The emergence of ESBLs in community-acquired infections has been reported in earlier studies [<xref ref-type="bibr" rid="B18">18</xref>]. <italic>E. coli</italic> recorded 18.8% resistance to ceftazidime, which is a third-generation cephalosporin like Cefotaxime. The difference could be attributed to the type of antibiotic resistance mobile determinants in the isolates. The high resistance level recorded for cefotaxime in this study is associated with the presence of plasmid mediated blaCTX-M gene demonstrated in multidrug resistant <italic>E.</italic><italic>coli</italic>. The presence of blaCTX-M enzyme in bacteria is known to hydrolyse cefotazime with limited effect on ceftazidime [<xref ref-type="bibr" rid="B19">19</xref>][<xref ref-type="bibr" rid="B20">20</xref>]. Cephalosporin are safe in pregnancy therefore ceftazidime as per this study could be the antibiotic of choice yet <italic>E. coli</italic> isolates reported high resistant to cephalosporins. This therefore poses a risk to pregnant women and the pregnancy. </p>
        <p>Resistance to ciprofloxacin was at 18.8% for the <italic>E. coli</italic> isolates although relatively low, this trend needs to be watched closely. Since Fluoroquinolones are thought be still the most effective antibiotic agents against <italic>E. coli</italic> infection [<xref ref-type="bibr" rid="B21">21</xref>]. However, this is only true to different localities otherwise resistance to Fluoro-quinolones has been increasing. There is increased resistance to Fluoroquin-olones such as ciprofloxacin and levofloxacin. Kenya has reported development of resistance to Fluoroquinolones and extended-spectrum beta-lactams in uropathogenic <italic>E. coli</italic> [<xref ref-type="bibr" rid="B17">17</xref>]. This study found 18.8% resistance to ciprofloxacin by the <italic>E. coli</italic> isolates. Quinolones have been associated with teratogenicity in the first trimester and risk of auditory and vestibular toxicity in the foetus in last trimesters, and are therefore contraindicated in pregnancy [<xref ref-type="bibr" rid="B21">21</xref>]. However, this study reported low resistance to quinolones; therefore, they could be used with caution in late pregnancy, especially if they are found to be the only sensitive drug in any specific case.</p>
        <p>The multiple antibiotic resistance index (MAR index) value ranged between 0.18 and 0.75. The predominant MAR index for gram negative was 0.33 and 83.5% of the isolates had MAR index equals or more than 0.2. MARI is a tool that reveals the spread of bacteria resistance in a given population [<xref ref-type="bibr" rid="B20">20</xref>]. In this study MARI ≥ 0.2 was expressed by 83.2% of gram-negative isolates. This implies that a very large proportion of the bacterial isolates had been exposed to several antibiotics. A similar report was demonstrated by Prakash and Saxena [<xref ref-type="bibr" rid="B22">22</xref>]. A study done in 2016 demonstrated that urinary tract infection is caused by <italic>E. coli</italic> strains that have a high MARI [<xref ref-type="bibr" rid="B23">23</xref>]. This agreed with current study, which had high MARI for gram-negative isolates.</p>
      </sec>
      <sec id="sec5dot2">
        <title>5.2. Plasmid Mediated Resistant Genes Amplification</title>
        <p>Fifteen isolates demonstrated blaCTX-M gene followed by eight isolates for blaOXA-1 while TEM and SHV genes were not reported from the isolates. The findings agreed with a study done in Palestinian hospital that demonstrated blaOXA-1 gene from seven <italic>E. coli</italic> isolates [<xref ref-type="bibr" rid="B24">24</xref>]. This study reported CTX-M in 15 <italic>E. coli</italic> isolates which was the predominant ESBL gene. In recent years the <italic>E. coli</italic> strains expressing CTX-M have increased and replaced previous predominant types of ESBLs TEM and SHV; Moreover CTX-M type ESBLs have emerged within the community, particularly among <italic>E. coli</italic> and K. pneumonia isolated from urinary tract infections [<xref ref-type="bibr" rid="B25">25</xref>]. This study was done on women attending antenatal clinic who were not hospitalized. Therefore, the isolates were from a community setup. The dissemination of this gene may be associated with mobile factors that control resistance genes movement among microorganisms. This occurrence was demonstrated by Barlow in 2008 when high mobilization of the encoding genes reported an increase of tenfold in movement of blaCTX-M genes via plasmid [<xref ref-type="bibr" rid="B26">26</xref>]. </p>
        <p>Co-occurrence of extended spectrum <italic>β</italic> lactamase genes in isolates was reported in six <italic>E. coli</italic> isolates. Six isolates reported the occurrence of both blaCTX-M and blaOXA-1 in combination. This finding agrees with earlier study done in Kenya that demonstrated majority of blaOXA-1 genes were detected in strains bearing other ESBL genes such as blaCTX-Ms or blaTEM-52 [<xref ref-type="bibr" rid="B27">27</xref>]. In another study done in Kenyan hospital set up Sixteen isolates demonstrated blaCTX-M/TEM, whereas five had blaTEM/CTX-M/SHV [<xref ref-type="bibr" rid="B28">28</xref>]. A study done in USA demonstrated that blaOXA-1 gene was found in combination of blaCTX-M-15 gene in 38 <italic>E. coli</italic> isolates [<xref ref-type="bibr" rid="B29">29</xref>]. Several studies have shown that blaCTX-M genes are found in large plasmids which often carry other genes particularly blaOXA-1, blaTEM-1, tetA and aac conferring resistance to a range of antimicrobial agents. This may explain the high rate of transmission of the blaCTX-M gene among the <italic>E. coli</italic> strains by acquiring R-plasmid. The occurrence of blaCTX-M resistance gene combined with other resistance genes in <italic>E. coli</italic> is therefore a common occurrence [<xref ref-type="bibr" rid="B30">30</xref>]. The demonstration of more than one ESBL gene in the isolates is an indication of presence of resistant plasmids in the isolates in this study.</p>
        <p>The OXA-type enzymes are a growing family of ESBL, which differ from the TEM and SHV enzymes as they belong to molecular class D and functional group 2d [<xref ref-type="bibr" rid="B31">31</xref>]. The OXA-type lactamases confer resistance to ampicillin and cephalothin and are characterized by their high hydrolytic activity against oxacillin and cloxacillin. blaOXA-1 has frequently been isolated from <italic>E. coli</italic> [<xref ref-type="bibr" rid="B32">32</xref>]. <italic>E. coli</italic> isolates were reported to have blaOXA-1 genes from Lebanon [<xref ref-type="bibr" rid="B33">33</xref>]. They predominantly occur in Pseudomonas aeruginosa but have been detected in many other gram-negative bacteria [<xref ref-type="bibr" rid="B30">30</xref>]). This agrees with this study which demonstrated the OXA-1gene from the <italic>E. coli</italic> isolates. However, all isolates in this study that demonstrated OXA-type ESBLs genes also demonstrated CTX-M genes. This result agreed with an earlier study that reported a similar occurrence where all OXA genes were produced alongside with CTX-M-1 [<xref ref-type="bibr" rid="B34">34</xref>]. </p>
        <p>Most of the <italic>E. coli</italic> isolates that demonstrated the presence of OXA-1 and CTX-M genes were resistant to other antibiotics like quinolones, co-trimoxazole, and tetracycline. However, these antibiotics do not possess the beta lactam ring in their structures. Therefore, the ability of the isolates to develop resistance to these antibiotics is an indication of presence of other mobile factors in the isolates. Other studies have reported similar results where ESBL producing organisms have been found to be resistant to ciprofloxacin, co-trimoxazole, and gentamicin [<xref ref-type="bibr" rid="B35">35</xref>]. Studies have found out that genes encoding for <italic>β</italic>-lactamases enzyme are often located on large plasmids that also encode genes for resistance to other antibiotics, including aminoglycosides, tetracycline, sulfonamides, trimethoprim, quinolones, and chloramphenicol [<xref ref-type="bibr" rid="B36">36</xref>]. All the <italic>E. coli</italic> isolates that demonstrated production of ESBL enzymes were sensitive to imipenem. This was similar to earlier studies that had reported high susceptibility of isolates to imipenem [<xref ref-type="bibr" rid="B37">37</xref>].</p>
        <p>Our study involved community-acquired E coli infections. The prevalence of CTX-M-type ESBLs in these isolates followed by OXA genes is a subject of concern for the future of antibiotics. The recognition of CTX-M <italic>β</italic>-lactamases as the predominant type of ESBL among community strains is increasing concern in many countries [<xref ref-type="bibr" rid="B38">38</xref>]. Previously ESBL-producing Enterobacteriaceae have been reported in the hospital setup where there is heavy antimicrobial selection pressure on microorganism [<xref ref-type="bibr" rid="B38">38</xref>]. However, there is now evidence of dissemination of CTX-M ESBL-producing urinary pathogens into the community and the current emergence and spread of these bacteria is disturbing [<xref ref-type="bibr" rid="B39">39</xref>]. The association of CTX-M <italic>β</italic>-lactamase-encoding genes with mobile elements such as ISEcp1, could explain the ease with which these enzymes are spreading among bacteria in the community setting [<xref ref-type="bibr" rid="B38">38</xref>].</p>
        <p>In this study isolates that demonstrated presence of both OXA-1 gene and CTX-M and did not agree with a similar study in a Kenyan hospital environment that demonstrated presence plasmid genes TEM and SHV genes [<xref ref-type="bibr" rid="B40">40</xref>]. In another study carried out in a Kenyan hospital reported presence of Plasmid-mediated CTX-M-15 beta-lactamases and CMY-2 AmpC enzymes [<xref ref-type="bibr" rid="B17">17</xref>]. This study agreed partly with current study in the demonstration of CTX-M genes in multidrug resistance <italic>E. coli</italic> isolated from urine. The difference in the distribution of the genes in the isolates in this study could be due to the fact that the isolates were community based and not hospital based. Eight of the multidrug resistance isolates reported presence of both blaOXA-1 and blaCTM genes. These <italic>β</italic>-lactamases genes can either be chromosomal or plasmids mediated and invalidate <italic>β</italic>-lactams activity by hydrolyzing the <italic>β</italic>-lactam ring. Development of multi-drug resistant uropathogenic <italic>E. coli</italic> strains is a growing concern to practical treatment of urinary tract infections in many countries including Kenya [<xref ref-type="bibr" rid="B41">41</xref>]. This is made worse when it occurs in pregnant women whose range of antibiotic treatment is limited. </p>
      </sec>
      <sec id="sec5dot3">
        <title>5.3. Plasmid Curing</title>
        <p>In this study it was observed that fifteen isolates became susceptible to antibiotics they had previously shown resistance. This agreed with a study bacteria lost ability to produce bactericin after curing [<xref ref-type="bibr" rid="B42">42</xref>][<xref ref-type="bibr" rid="B43">43</xref>]. It was noted that those isolates that demonstrated the presence of the BLACTX-M genes only were fully cured. Five (5) isolates that demonstrated plasmids with a combination of BLAOXA-1 and BLACTX-M genes remained resistant to some antibiotics after curing. The failure of ethidium bromide to cure some antibiotic genes may be related to mechanism of action. Ethidium Bromide inhibits plasmid replication that carry antibiotic resistance by introducing an abnormal insertion or deletion in the plasmid gene which results into frameshift mutation that alters the sequence [<xref ref-type="bibr" rid="B44">44</xref>]. </p>
      </sec>
      <sec id="sec5dot4">
        <title>5.4. Detection of Integron Variable Region (VR)</title>
        <p>Variable regions of integrons were screened in 40 selected multidrug resistant <italic>E. coli</italic> isolates that were resistant to more than three classes of antibiotics. They yielded 27.5% of class 1 integron, 7.5% class 2 integron, and 22.5% class 3 integrons. This result agreed with a study done in Niger that demonstrated prevalence of all three classes of integron, class 1, 2 and 3 integron from <italic>E. coli</italic> isolates [<xref ref-type="bibr" rid="B45">45</xref>] This study reported 2 isolates yielded PCR product of 1000-bp fragment which were classified to be class 2 integron as per the amplification primers sequences as reported by Machado [<xref ref-type="bibr" rid="B12">12</xref>]. A single isolate was found to harbor both 1000bp and 800 bp fragment, and five reported 800 bp and 600 bp which meant the isolate had more than one variable region. Nine (9) of the isolates harbored class 3 integron at 600-bp and 100 bp, while eleven harbored class 1 intergron Eight (8) isolates demonstrated base pairs between 766 bp to 800 bp and three (3) isolates demonstrated 430 bp. Nine of the isolates harbored class 3 integron at 600-bp and 100 bp. However, though class 3 integrons are rarely demonstrated in <italic>E. coli</italic> isolates Kargar reported class 3 integron at 26.09% MDR <italic>E. coli</italic> isolates [<xref ref-type="bibr" rid="B46">46</xref>].</p>
        <p>The prevalence of class 1 integrons, class 2 integrons has also been detected in Kenya while no isolate contained a class 3 integron [<xref ref-type="bibr" rid="B27">27</xref>]. The common types of genes among class 1 and class 2 integron gene cassettes amplified are dfrA1 and aadA1 genes in <italic>E. coli</italic> isolated from urine cultures [<xref ref-type="bibr" rid="B47">47</xref>]. The integrons may contain various numbers, kinds and combinations of gene cassettes within their variable regions. The types, combinations and frequency of the gene cassettes in integrons may reflect the specific selective pressures to which the isolates were exposed [<xref ref-type="bibr" rid="B48">48</xref>]. Integrons have an alarming capacity for the enrolment, spread, and expression of resistance genes, and studies show that they are widespread among gram-negative bacteria [<xref ref-type="bibr" rid="B49">49</xref>]. Studies are increasingly reporting presence of class 3 integron in <italic>E. coli</italic> isolates [<xref ref-type="bibr" rid="B50">50</xref>]. The detection of class 3 integron is increasing and has been reported in strains from patients with urinary tract infections [<xref ref-type="bibr" rid="B50">50</xref>]. Class 3 integrons could be involved in the dissemination of antibiotic resistance in both clinical and the environmental setting [<xref ref-type="bibr" rid="B51">51</xref>]. The presence of class 3 integron in this study is a significant finding that indicates the evolution of bacteria for survival.</p>
      </sec>
    </sec>
    <sec id="sec6">
      <title>6. Limitations</title>
      <p>The limitation of this study was the plasmids genes and integrons demonstrated in the multidrug resistant isolates were not sequenced for specific identification. </p>
    </sec>
    <sec id="sec7">
      <title>7. Conclusion</title>
      <p>There was significant ASB among pregnant women involved in the study from the Nairobi county clinics. The presence of ESBLs genes and intergron was demonstrated in the multidrug resistant <italic>E. coli</italic> isolates from pregnant women with ASB. The MAR index reported in this study indicated the women involved in the study were from antibiotic use high risk environment. </p>
    </sec>
    <sec id="sec8">
      <title>8. Recommendation</title>
      <p>It is recommended that more studies be done to explore the incorporation of plasmid curing agents into antibiotics formulation during the drug development process.</p>
    </sec>
    <sec id="sec9">
      <title>What Is Already Know on This Topic</title>
      <p>ESBL producers with blaCTX-M blaTEM and blaSHV genes have been demonstrated in Kenyan hospital setup [<xref ref-type="bibr" rid="B28">28</xref>].</p>
      <p>Class 1 and class 2 integrons were detected in 3 isolates but no isolate contained a class 3 integron was reported in a study in a hospital setup [<xref ref-type="bibr" rid="B27">27</xref>].</p>
      <p>Studies have reported decrease in number of antibiotic resistance profile of the isolates after plasmid curing [<xref ref-type="bibr" rid="B52">52</xref>].</p>
    </sec>
    <sec id="sec10">
      <title>What This Study Adds</title>
      <p>ESBL producers blaCTX-M and blaOXA-1 genes demonstrated in community setup. </p>
      <p>Class 1 and class 2 integrons including class 3 integrons detected In <italic>E. coli</italic> isolates from this study in a community setup.</p>
      <p>Antibiotic resistance ability of multidrug resistant <italic>E. coli</italic> lost or reduced to some antibiotics after treatment with plasmid curing agent. </p>
    </sec>
    <sec id="sec11">
      <title>Authors’ Contributions</title>
      <p>Adelaide Ayoyi conceived the study, drafted the proposal, carried out data collection, laboratory examination, data analysis, interpretation of the results and ultimately finalized write up of the manuscript. Gideon Kikuvi, Christine Bii and Samuel Kariuki gave technical advice in proposal development, in-process consultation and review of the manuscript. All authors read and approved the final manuscript.</p>
    </sec>
    <sec id="sec12">
      <title>Acknowledgements</title>
      <p>The authors wish to acknowledge the all attending Nurses and laboratory scientists from the participating health centers for the role in evaluation of subjects and collection of samples. The urine microscopy was done at clinics and was done by laboratory scientists. This study was funded by National Commission for Science Technology and Innovation and Professor Samuel Kariuki.</p>
    </sec>
  </body>
  <back>
    <ref-list>
      <title>References</title>
      <ref id="B1">
        <label>1.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Nicolle, L.E., Gupta, K., Bradley, S.F., Colgan, R., DeMuri, G.P., Drekonja, D., <italic>et al.</italic> (2019) Clinical Practice Guideline for the Management of Asymptomatic Bacteriuria: 2019 Update by the Infectious Diseases Society of America. <italic>Clinical</italic><italic>Infectious</italic><italic>Diseases</italic>, 68, e83-e110. https://doi.org/10.1093/cid/ciy1121 <pub-id pub-id-type="doi">10.1093/cid/ciy1121</pub-id><pub-id pub-id-type="pmid">30895288</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/cid/ciy1121">https://doi.org/10.1093/cid/ciy1121</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Nicolle, L.E.</string-name>
              <string-name>Gupta, K.</string-name>
              <string-name>Bradley, S.F.</string-name>
              <string-name>Colgan, R.</string-name>
              <string-name>DeMuri, G.P.</string-name>
              <string-name>Drekonja, D.</string-name>
            </person-group>
            <year>2019</year>
            <article-title>Clinical Practice Guideline for the Management of Asymptomatic Bacteriuria: 2019 Update by the Infectious Diseases Society of America</article-title>
            <source>Clinical Infectious Diseases</source>
            <volume>68</volume>
            <fpage>2019</fpage>
            <pub-id pub-id-type="doi">10.1093/cid/ciy1121</pub-id>
            <pub-id pub-id-type="pmid">30895288</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B2">
        <label>2.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Galgano, M., Pellegrini, F., Catalano, E., Capozzi, L., Del Sambro, L., Sposato, A., <italic>et al.</italic> (2025) Acquired Bacterial Resistance to Antibiotics and Resistance Genes: From Past to Future. <italic>Antibiotics</italic>, 14, Article 222. https://doi.org/10.3390/antibiotics14030222 <pub-id pub-id-type="doi">10.3390/antibiotics14030222</pub-id><pub-id pub-id-type="pmid">40149034</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3390/antibiotics14030222">https://doi.org/10.3390/antibiotics14030222</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Galgano, M.</string-name>
              <string-name>Pellegrini, F.</string-name>
              <string-name>Catalano, E.</string-name>
              <string-name>Capozzi, L.</string-name>
              <string-name>Sambro, L.</string-name>
              <string-name>Sposato, A.</string-name>
            </person-group>
            <year>2025</year>
            <article-title>Acquired Bacterial Resistance to Antibiotics and Resistance Genes: From Past to Future</article-title>
            <source>Antibiotics</source>
            <volume>14</volume>
            <elocation-id>222</elocation-id>
            <pub-id pub-id-type="doi">10.3390/antibiotics14030222</pub-id>
            <pub-id pub-id-type="pmid">40149034</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B3">
        <label>3.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Pouwels, K.B., Freeman, R., Muller-Pebody, B., Rooney, G., Henderson, K.L., Robotham, J.V., <italic>et al.</italic> (2018) Association between Use of Different Antibiotics and Trimethoprim Resistance: Going Beyond the Obvious Crude Association. <italic>Journal</italic><italic>of</italic><italic>Antimicrobial</italic><italic>Chemotherapy</italic>, 73, 1700-1707. https://doi.org/10.1093/jac/dky031 <pub-id pub-id-type="doi">10.1093/jac/dky031</pub-id><pub-id pub-id-type="pmid">29394363</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/jac/dky031">https://doi.org/10.1093/jac/dky031</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Pouwels, K.B.</string-name>
              <string-name>Freeman, R.</string-name>
              <string-name>Muller-Pebody, B.</string-name>
              <string-name>Rooney, G.</string-name>
              <string-name>Henderson, K.L.</string-name>
              <string-name>Robotham, J.V.</string-name>
            </person-group>
            <year>2018</year>
            <article-title>Association between Use of Different Antibiotics and Trimethoprim Resistance: Going Beyond the Obvious Crude Association</article-title>
            <source>Journal of Antimicrobial Chemotherapy</source>
            <volume>73</volume>
            <pub-id pub-id-type="doi">10.1093/jac/dky031</pub-id>
            <pub-id pub-id-type="pmid">29394363</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B4">
        <label>4.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Fang, L., Li, X., Li, L., Li, S., Liao, X., Sun, J., <italic>et al.</italic> (2016) Co-Spread of Metal and Antibiotic Resistance within ST3-IncHI2 Plasmids from <italic>E. coli</italic> Isolates of Food-Producing Animals. <italic>Scientific</italic><italic>Reports</italic>, 6, Article No. 25312. https://doi.org/10.1038/srep25312 <pub-id pub-id-type="doi">10.1038/srep25312</pub-id><pub-id pub-id-type="pmid">27143648</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1038/srep25312">https://doi.org/10.1038/srep25312</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Fang, L.</string-name>
              <string-name>Li, X.</string-name>
              <string-name>Li, L.</string-name>
              <string-name>Li, S.</string-name>
              <string-name>Liao, X.</string-name>
              <string-name>Sun, J.</string-name>
            </person-group>
            <year>2016</year>
            <article-title>Co-Spread of Metal and Antibiotic Resistance within ST3-IncHI2 Plasmids from E</article-title>
            <source>coli Isolates of Food-Producing Animals. Scientific Reports</source>
            <volume>6</volume>
            <elocation-id>No</elocation-id>
            <pub-id pub-id-type="doi">10.1038/srep25312</pub-id>
            <pub-id pub-id-type="pmid">27143648</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B5">
        <label>5.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Tokuda, M. and Shintani, M. (2024) Microbial Evolution through Horizontal Gene Transfer by Mobile Genetic Elements. <italic>Microbial</italic><italic>Biotechnology</italic>, 17, e14408. https://doi.org/10.1111/1751-7915.14408 <pub-id pub-id-type="doi">10.1111/1751-7915.14408</pub-id><pub-id pub-id-type="pmid">38226780</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1111/1751-7915.14408">https://doi.org/10.1111/1751-7915.14408</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Tokuda, M.</string-name>
              <string-name>Shintani, M.</string-name>
            </person-group>
            <year>2024</year>
            <article-title>Microbial Evolution through Horizontal Gene Transfer by Mobile Genetic Elements</article-title>
            <source>Microbial Biotechnology</source>
            <volume>17</volume>
            <pub-id pub-id-type="doi">10.1111/1751-7915.14408</pub-id>
            <pub-id pub-id-type="pmid">38226780</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B6">
        <label>6.</label>
        <citation-alternatives>
          <mixed-citation publication-type="web">Sundar, R.O. (2004) Introduction to Biostatistics and Research Methods Book. 5 TH. http://www.amazon.in/Introduction-Biostatistics-Research-Methods-Rao/dp/8120345207</mixed-citation>
          <element-citation publication-type="web">
            <person-group person-group-type="author">
              <string-name>Sundar, R.O.</string-name>
            </person-group>
            <year>2004</year>
            <article-title>Introduction to Biostatistics and Research Methods Book</article-title>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B7">
        <label>7.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">CLSI (2023) Performance Standards for Antimicrobial Susceptibility Testing.</mixed-citation>
          <element-citation publication-type="other">
            <year>2023</year>
            <article-title>Performance Standards for Antimicrobial Susceptibility Testing</article-title>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B8">
        <label>8.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Bauer, A.W., Kirby, W.M.M., Sherris, J.C. and Turck, M. (1966) Antibiotic Susceptibility Testing by a Standardized Single Disk Method. <italic>American</italic><italic>Journal</italic><italic>of</italic><italic>Clinical</italic><italic>Pathology</italic>, 45, 493-496. https://doi.org/10.1093/ajcp/45.4_ts.493 <pub-id pub-id-type="doi">10.1093/ajcp/45.4_ts.493</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/ajcp/45.4_ts.493">https://doi.org/10.1093/ajcp/45.4_ts.493</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Bauer, A.W.</string-name>
              <string-name>Kirby, W.M.M.</string-name>
              <string-name>Sherris, J.C.</string-name>
              <string-name>Turck, M.</string-name>
            </person-group>
            <year>1966</year>
            <article-title>Antibiotic Susceptibility Testing by a Standardized Single Disk Method</article-title>
            <source>American Journal of Clinical Pathology</source>
            <volume>45</volume>
            <pub-id pub-id-type="doi">10.1093/ajcp/45.4_ts.493</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B9">
        <label>9.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Empel, J., Baraniak, A., Literacka, E., Mrówka, A., Fiett, J., Sadowy, E., <italic>et al.</italic> (2008) Molecular Survey of <italic>β</italic>-Lactamases Conferring Resistance to Newer <italic>β</italic>-Lactams in <italic>Enterobacteriaceae</italic> Isolates from Polish Hospitals. <italic>Antimicrobial</italic><italic>Agents</italic><italic>and</italic><italic>Chemotherapy</italic>, 52, 2449-2454. https://doi.org/10.1128/aac.00043-08 <pub-id pub-id-type="doi">10.1128/aac.00043-08</pub-id><pub-id pub-id-type="pmid">18458126</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1128/aac.00043-08">https://doi.org/10.1128/aac.00043-08</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Empel, J.</string-name>
              <string-name>Baraniak, A.</string-name>
              <string-name>Literacka, E.</string-name>
              <string-name>Fiett, J.</string-name>
              <string-name>Sadowy, E.</string-name>
            </person-group>
            <year>2008</year>
            <article-title>Molecular Survey of β-Lactamases Conferring Resistance to Newer β-Lactams in Enterobacteriaceae Isolates from Polish Hospitals</article-title>
            <source>Antimicrobial Agents and Chemotherapy</source>
            <volume>52</volume>
            <pub-id pub-id-type="doi">10.1128/aac.00043-08</pub-id>
            <pub-id pub-id-type="pmid">18458126</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B10">
        <label>10.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Lim, K., Yasin, R., Yeo, C., Puthucheary, S. and Thong, K. (2009) Characterization of Multidrug Resistant ESBL-Producing <italic>Escherichia coli</italic>Isolates from Hospitals in Malaysia. <italic>BioMed</italic><italic>Research</italic><italic>International</italic>, 2009, Article ID: 165637. https://doi.org/10.1155/2009/165637 <pub-id pub-id-type="doi">10.1155/2009/165637</pub-id><pub-id pub-id-type="pmid">19672454</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1155/2009/165637">https://doi.org/10.1155/2009/165637</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Lim, K.</string-name>
              <string-name>Yasin, R.</string-name>
              <string-name>Yeo, C.</string-name>
              <string-name>Puthucheary, S.</string-name>
              <string-name>Thong, K.</string-name>
            </person-group>
            <year>2009</year>
            <article-title>Characterization of Multidrug Resistant ESBL-Producing Escherichia coli Isolates from Hospitals in Malaysia</article-title>
            <source>BioMed Research International</source>
            <volume>2009</volume>
            <fpage>165637</fpage>
            <elocation-id>ID</elocation-id>
            <pub-id pub-id-type="doi">10.1155/2009/165637</pub-id>
            <pub-id pub-id-type="pmid">19672454</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B11">
        <label>11.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Letchumanan, V., Yin, W., Lee, L. and Chan, K. (2015) Prevalence and Antimicrobial Susceptibility of <italic>Vibrio parahaemolyticus</italic> Isolated from Retail Shrimps in Malaysia. <italic>Frontiers</italic><italic>in</italic><italic>Microbiology</italic>, 6, Article 33. https://doi.org/10.3389/fmicb.2015.00033 <pub-id pub-id-type="doi">10.3389/fmicb.2015.00033</pub-id><pub-id pub-id-type="pmid">25688239</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3389/fmicb.2015.00033">https://doi.org/10.3389/fmicb.2015.00033</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Letchumanan, V.</string-name>
              <string-name>Yin, W.</string-name>
              <string-name>Lee, L.</string-name>
              <string-name>Chan, K.</string-name>
            </person-group>
            <year>2015</year>
            <article-title>Prevalence and Antimicrobial Susceptibility of Vibrio parahaemolyticus Isolated from Retail Shrimps in Malaysia</article-title>
            <source>Frontiers in Microbiology</source>
            <volume>6</volume>
            <elocation-id>33</elocation-id>
            <pub-id pub-id-type="doi">10.3389/fmicb.2015.00033</pub-id>
            <pub-id pub-id-type="pmid">25688239</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B12">
        <label>12.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Machado, E., Cantón, R., Baquero, F., Galán, J., Rollán, A., Peixe, L., <italic>et al.</italic> (2005) Integron Content of Extended-Spectrum- <italic>β</italic>-Lactamase-Producing <italic>Escherichia coli</italic>Strains over 12 Years in a Single Hospital in Madrid, Spain. <italic>Antimicrobial</italic><italic>Agents</italic><italic>and</italic><italic>Chemotherapy</italic>, 49, 1823-1829. https://doi.org/10.1128/aac.49.5.1823-1829.2005 <pub-id pub-id-type="doi">10.1128/aac.49.5.1823-1829.2005</pub-id><pub-id pub-id-type="pmid">15855502</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1128/aac.49.5.1823-1829.2005">https://doi.org/10.1128/aac.49.5.1823-1829.2005</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Machado, E.</string-name>
              <string-name>Baquero, F.</string-name>
              <string-name>Peixe, L.</string-name>
              <string-name>Madrid, S</string-name>
            </person-group>
            <year>2005</year>
            <article-title>Integron Content of Extended-Spectrum-β-Lactamase-Producing Escherichia coli Strains over 12 Years in a Single Hospital in Madrid, Spain</article-title>
            <source>Antimicrobial Agents and Chemotherapy</source>
            <volume>49</volume>
            <pub-id pub-id-type="doi">10.1128/aac.49.5.1823-1829.2005</pub-id>
            <pub-id pub-id-type="pmid">15855502</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B13">
        <label>13.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Agarwal, A., Pandey, S., Maheshwari, U., Singh, M., Srivastava, J. and Bose, S. (2021) Prevalence of Asymptomatic Bacteriuria and Antimicrobial Resistance Profile among Pregnant Females in a Tertiary Care Hospital. <italic>Indian</italic><italic>Journal</italic><italic>of</italic><italic>Community</italic><italic>Medicine</italic>, 46, 469-473. https://doi.org/10.4103/ijcm.ijcm_792_20 <pub-id pub-id-type="doi">10.4103/ijcm.ijcm_792_20</pub-id><pub-id pub-id-type="pmid">34759490</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.4103/ijcm.ijcm_792_20">https://doi.org/10.4103/ijcm.ijcm_792_20</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Agarwal, A.</string-name>
              <string-name>Pandey, S.</string-name>
              <string-name>Maheshwari, U.</string-name>
              <string-name>Singh, M.</string-name>
              <string-name>Srivastava, J.</string-name>
              <string-name>Bose, S.</string-name>
            </person-group>
            <year>2021</year>
            <article-title>Prevalence of Asymptomatic Bacteriuria and Antimicrobial Resistance Profile among Pregnant Females in a Tertiary Care Hospital</article-title>
            <source>Indian Journal of Community Medicine</source>
            <volume>46</volume>
            <pub-id pub-id-type="doi">10.4103/ijcm.ijcm_792_20</pub-id>
            <pub-id pub-id-type="pmid">34759490</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B14">
        <label>14.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Sheffield, J.S. and Cunningham, F.G. (2005) Urinary Tract Infection in Women. <italic>Obstetrics</italic><italic>&amp;</italic><italic>Gynecology</italic>, 106, 1085-1092. https://doi.org/10.1097/01.aog.0000185257.52328.a2 <pub-id pub-id-type="doi">10.1097/01.aog.0000185257.52328.a2</pub-id><pub-id pub-id-type="pmid">16260529</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1097/01.aog.0000185257.52328.a2">https://doi.org/10.1097/01.aog.0000185257.52328.a2</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Sheffield, J.S.</string-name>
              <string-name>Cunningham, F.G.</string-name>
            </person-group>
            <year>2005</year>
            <article-title>Urinary Tract Infection in Women</article-title>
            <source>Obstetrics &amp; Gynecology</source>
            <volume>106</volume>
            <pub-id pub-id-type="doi">10.1097/01.aog.0000185257.52328.a2</pub-id>
            <pub-id pub-id-type="pmid">16260529</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B15">
        <label>15.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Amiri, F.N., Rooshan, M.H., Ahmady, M.H. and Soliamani, M.J. (2009) Hygiene Practices and Sexual Activity Associated with Urinary Tract Infection in Pregnant Women. <italic>Eastern</italic><italic>Mediterranean</italic><italic>Health</italic><italic>Journal</italic>, 15, 104-110. https://doi.org/10.26719/2009.15.1.104 <pub-id pub-id-type="doi">10.26719/2009.15.1.104</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.26719/2009.15.1.104">https://doi.org/10.26719/2009.15.1.104</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Amiri, F.N.</string-name>
              <string-name>Rooshan, M.H.</string-name>
              <string-name>Ahmady, M.H.</string-name>
              <string-name>Soliamani, M.J.</string-name>
            </person-group>
            <year>2009</year>
            <article-title>Hygiene Practices and Sexual Activity Associated with Urinary Tract Infection in Pregnant Women</article-title>
            <source>Eastern Mediterranean Health Journal</source>
            <volume>15</volume>
            <pub-id pub-id-type="doi">10.26719/2009.15.1.104</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B16">
        <label>16.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Moyo, S.J., Aboud, S., Kasubi, M. and Maselle, S.Y. (2010) Bacterial Isolates and Drug Susceptibility Patterns of Urinary Tract Infection among Pregnant Women at Muhimbili National Hospital in Tanzania. <italic>Tanzania Journal of Health Research</italic>, 12, 236-236. https://doi.org/10.4314/thrb.v12i4.52997 <pub-id pub-id-type="doi">10.4314/thrb.v12i4.52997</pub-id><pub-id pub-id-type="pmid">24409630</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.4314/thrb.v12i4.52997">https://doi.org/10.4314/thrb.v12i4.52997</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Moyo, S.J.</string-name>
              <string-name>Aboud, S.</string-name>
              <string-name>Kasubi, M.</string-name>
              <string-name>Maselle, S.Y.</string-name>
            </person-group>
            <year>2010</year>
            <article-title>Bacterial Isolates and Drug Susceptibility Patterns of Urinary Tract Infection among Pregnant Women at Muhimbili National Hospital in Tanzania</article-title>
            <source>Tanzania Journal of Health Research</source>
            <volume>12</volume>
            <pub-id pub-id-type="doi">10.4314/thrb.v12i4.52997</pub-id>
            <pub-id pub-id-type="pmid">24409630</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B17">
        <label>17.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Kariuki, S., Revathi, G., Corkill, J., Kiiru, J., Mwituria, J., Mirza, N., <italic>et al.</italic> (2007) <italic>Escherichia coli</italic>from Community-Acquired Urinary Tract Infections Resistant to Fluoroquinolones and Extended-Spectrum <italic>β</italic>-Lactams. <italic>The</italic><italic>Journal</italic><italic>of</italic><italic>Infection</italic><italic>in</italic><italic>Developing</italic><italic>Countries</italic>, 1, 257-262. https://doi.org/10.3855/jidc.361 <pub-id pub-id-type="doi">10.3855/jidc.361</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3855/jidc.361">https://doi.org/10.3855/jidc.361</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Kariuki, S.</string-name>
              <string-name>Revathi, G.</string-name>
              <string-name>Corkill, J.</string-name>
              <string-name>Kiiru, J.</string-name>
              <string-name>Mwituria, J.</string-name>
              <string-name>Mirza, N.</string-name>
            </person-group>
            <year>2007</year>
            <article-title>Escherichia coli from Community-Acquired Urinary Tract Infections Resistant to Fluoroquinolones and Extended-Spectrum β-Lactams</article-title>
            <source>The Journal of Infection in Developing Countries</source>
            <volume>1</volume>
            <pub-id pub-id-type="doi">10.3855/jidc.361</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B18">
        <label>18.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Amábile-Cuevas, C.F. and Arredondo-García, J.L. (2008) High Resistance Prevalence Towards Ampicillin, Co-Trimoxazole and Ciprofloxacin, among Uropathogenic <italic>Escherichia coli</italic>Isolates in Mexico City. <italic>The</italic><italic>Journal</italic><italic>of</italic><italic>Infection</italic><italic>in</italic><italic>Developing</italic><italic>Countries</italic>, 2, 350-353. https://doi.org/10.3855/jidc.195 <pub-id pub-id-type="doi">10.3855/jidc.195</pub-id><pub-id pub-id-type="pmid">19745501</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3855/jidc.195">https://doi.org/10.3855/jidc.195</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Cuevas, C.F.</string-name>
              <string-name>Ampicillin, C</string-name>
            </person-group>
            <year>2008</year>
            <article-title>High Resistance Prevalence Towards Ampicillin, Co-Trimoxazole and Ciprofloxacin, among Uropathogenic Escherichia coli Isolates in Mexico City</article-title>
            <source>The Journal of Infection in Developing Countries</source>
            <volume>2</volume>
            <pub-id pub-id-type="doi">10.3855/jidc.195</pub-id>
            <pub-id pub-id-type="pmid">19745501</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B19">
        <label>19.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Gazouli, M., Tzelepi, E., Sidorenko, S.V. and Tzouvelekis, L.S. (1998) Sequence of the Gene Encoding a Plasmid-Mediated Cefotaxime-Hydrolyzing Class A <italic>β</italic>-Lactamase (CTX-M-4): Involvement of Serine 237 in Cephalosporin Hydrolysis. <italic>Antimicrobial Agents and Chemotherapy</italic>, 42, 1259-1262. https://doi.org/10.1128/AAC.42.5.1259 <pub-id pub-id-type="doi">10.1128/AAC.42.5.1259</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1128/AAC.42.5.1259">https://doi.org/10.1128/AAC.42.5.1259</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Gazouli, M.</string-name>
              <string-name>Tzelepi, E.</string-name>
              <string-name>Sidorenko, S.V.</string-name>
              <string-name>Tzouvelekis, L.S.</string-name>
            </person-group>
            <year>1998</year>
            <article-title>Sequence of the Gene Encoding a Plasmid-Mediated Cefotaxime-Hydrolyzing Class A β-Lactamase (CTX-M-4): Involvement of Serine 237 in Cephalosporin Hydrolysis</article-title>
            <source>Antimicrobial Agents and Chemotherapy</source>
            <volume>42</volume>
            <pub-id pub-id-type="doi">10.1128/AAC.42.5.1259</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B20">
        <label>20.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Kim, J.O., Yoo, I.Y., Yu, J.K., Kwon, J.A., Kim, S.Y. and Park, Y.-J. (2021) Predominance and Clonal Spread of CTX-M-15 in Cefotaxime-Resistant <italic>Klebsiella pneumoniae</italic> in Korea and Their Association with Plasmid-Mediated Quinolone Resistance Determinants. <italic>Journal of Infection and Chemotherapy</italic>, 27, 1186-1192. https://doi.org/10.1016/j.jiac.2021.03.014 <pub-id pub-id-type="doi">10.1016/j.jiac.2021.03.014</pub-id><pub-id pub-id-type="pmid">33814350</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.jiac.2021.03.014">https://doi.org/10.1016/j.jiac.2021.03.014</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Kim, J.O.</string-name>
              <string-name>Yoo, I.Y.</string-name>
              <string-name>Yu, J.K.</string-name>
              <string-name>Kwon, J.A.</string-name>
              <string-name>Kim, S.Y.</string-name>
              <string-name>Park, Y.</string-name>
            </person-group>
            <year>2021</year>
            <article-title>Predominance and Clonal Spread of CTX-M-15 in Cefotaxime-Resistant Klebsiella pneumoniae in Korea and Their Association with Plasmid-Mediated Quinolone Resistance Determinants</article-title>
            <source>Journal of Infection and Chemotherapy</source>
            <volume>27</volume>
            <pub-id pub-id-type="doi">10.1016/j.jiac.2021.03.014</pub-id>
            <pub-id pub-id-type="pmid">33814350</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B21">
        <label>21.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Ugwu, M.C., Odimegwu, D.C., Ibezim, E.C., Esimone, C.O., <italic>et al.</italic> (2009) Antibiotic Resistance Patterns of <italic>Staphylococcus aureus</italic> Isolated from Nostrils of Healthy Human Subjects in a Southeastern Nigeria Locality. <italic>Macedonian Journal of Medical Sciences</italic>, 2, 294-300.</mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Ugwu, M.C.</string-name>
              <string-name>Odimegwu, D.C.</string-name>
              <string-name>Ibezim, E.C.</string-name>
              <string-name>Esimone, C.O.</string-name>
            </person-group>
            <year>2009</year>
            <article-title>Antibiotic Resistance Patterns of Staphylococcus aureus Isolated from Nostrils of Healthy Human Subjects in a Southeastern Nigeria Locality</article-title>
            <source>Macedonian Journal of Medical Sciences</source>
            <volume>2</volume>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B22">
        <label>22.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Prakash, D. and Saxena, R.S. (2013) Distribution and Antimicrobial Susceptibility Pattern of Bacterial Pathogens Causing Urinary Tract Infection in Urban Community of Meerut City, India. <italic>ISRN</italic><italic>Microbiology</italic>, 2013, Article ID: 749629. https://doi.org/10.1155/2013/749629 <pub-id pub-id-type="doi">10.1155/2013/749629</pub-id><pub-id pub-id-type="pmid">24288649</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1155/2013/749629">https://doi.org/10.1155/2013/749629</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Prakash, D.</string-name>
              <string-name>Saxena, R.S.</string-name>
              <string-name>City, I</string-name>
            </person-group>
            <year>2013</year>
            <article-title>Distribution and Antimicrobial Susceptibility Pattern of Bacterial Pathogens Causing Urinary Tract Infection in Urban Community of Meerut City, India</article-title>
            <source>ISRN Microbiology</source>
            <volume>2013</volume>
            <fpage>749629</fpage>
            <elocation-id>ID</elocation-id>
            <pub-id pub-id-type="doi">10.1155/2013/749629</pub-id>
            <pub-id pub-id-type="pmid">24288649</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B23">
        <label>23.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Gidamudi, S.S. and Salunke, G.V. (2016) Antibiotic Susceptibility of Bacterial Strains, with Special Reference to <italic>Escherichia coli</italic>Isolated from Urinary Tract Infections in Rural Maharashtra. <italic>Asian</italic><italic>Journal</italic><italic>of</italic><italic>Pharmaceutical</italic><italic>and</italic><italic>Clinical</italic><italic>Research</italic>, 10, 202-205. https://doi.org/10.22159/ajpcr.2017.v10i1.14871 <pub-id pub-id-type="doi">10.22159/ajpcr.2017.v10i1.14871</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.22159/ajpcr.2017.v10i1.14871">https://doi.org/10.22159/ajpcr.2017.v10i1.14871</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Gidamudi, S.S.</string-name>
              <string-name>Salunke, G.V.</string-name>
            </person-group>
            <year>2016</year>
            <article-title>Antibiotic Susceptibility of Bacterial Strains, with Special Reference to Escherichia coli Isolated from Urinary Tract Infections in Rural Maharashtra</article-title>
            <source>Asian Journal of Pharmaceutical and Clinical Research</source>
            <volume>10</volume>
            <pub-id pub-id-type="doi">10.22159/ajpcr.2017.v10i1.14871</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B24">
        <label>24.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Hussein, A.I.A., Ahmed, A.M., Sato, M. and Shimamoto, T. (2009) Characterization of Integrons and Antimicrobial Resistance Genes in Clinical Isolates of Gram-Negative Bacteria from Palestinian Hospitals. <italic>Microbiology</italic><italic>and</italic><italic>Immunology</italic>, 53, 595-602. https://doi.org/10.1111/j.1348-0421.2009.00168.x <pub-id pub-id-type="doi">10.1111/j.1348-0421.2009.00168.x</pub-id><pub-id pub-id-type="pmid">19903259</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1111/j.1348-0421.2009.00168.x">https://doi.org/10.1111/j.1348-0421.2009.00168.x</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Hussein, A.I.A.</string-name>
              <string-name>Ahmed, A.M.</string-name>
              <string-name>Sato, M.</string-name>
              <string-name>Shimamoto, T.</string-name>
            </person-group>
            <year>2009</year>
            <article-title>Characterization of Integrons and Antimicrobial Resistance Genes in Clinical Isolates of Gram-Negative Bacteria from Palestinian Hospitals</article-title>
            <source>Microbiology and Immunology</source>
            <volume>53</volume>
            <pub-id pub-id-type="doi">10.1111/j.1348-0421.2009.00168.x</pub-id>
            <pub-id pub-id-type="pmid">19903259</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B25">
        <label>25.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Goudarzi, M., Sabzehali, F., Zahra, T., Azad, M., Boromandi, S., Hashemi, A., <italic>et al.</italic> (2014) Prevalence of blaCTX-M Gene in Multi-Resistant <italic>Escherichia coli</italic>Isolated from Urinary Tract Infections, Tehran, Iran. <italic>Novelty in Biomedicine</italic>, 2, 107-113.</mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Goudarzi, M.</string-name>
              <string-name>Sabzehali, F.</string-name>
              <string-name>Zahra, T.</string-name>
              <string-name>Azad, M.</string-name>
              <string-name>Boromandi, S.</string-name>
              <string-name>Hashemi, A.</string-name>
              <string-name>Infections, T</string-name>
            </person-group>
            <year>2014</year>
            <article-title>Prevalence of blaCTX-M Gene in Multi-Resistant Escherichia coli Isolated from Urinary Tract Infections, Tehran, Iran</article-title>
            <source>Novelty in Biomedicine</source>
            <volume>2</volume>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B26">
        <label>26.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Barlow, M., Reik, R.A., Jacobs, S.D., Medina, M., Meyer, M.P., McGowan, J.E., <italic>et al.</italic> (2008) High Rate of Mobilization for <italic>bla</italic><sub>CTX</sub><sub>-M</sub>s. <italic>Emerging</italic><italic>Infectious</italic><italic>Diseases</italic>, 14, 423-428. https://doi.org/10.3201/eid1403.070405 <pub-id pub-id-type="doi">10.3201/eid1403.070405</pub-id><pub-id pub-id-type="pmid">18325257</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3201/eid1403.070405">https://doi.org/10.3201/eid1403.070405</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Barlow, M.</string-name>
              <string-name>Reik, R.A.</string-name>
              <string-name>Jacobs, S.D.</string-name>
              <string-name>Medina, M.</string-name>
              <string-name>Meyer, M.P.</string-name>
              <string-name>McGowan, J.E.</string-name>
            </person-group>
            <year>2008</year>
            <article-title>High Rate of Mobilization for blaCTX-Ms</article-title>
            <source>Emerging Infectious Diseases</source>
            <volume>14</volume>
            <pub-id pub-id-type="doi">10.3201/eid1403.070405</pub-id>
            <pub-id pub-id-type="pmid">18325257</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B27">
        <label>27.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Kiiru, J., Butaye, P., Goddeeris, B.M. and Kariuki, S. (2013) Analysis for Prevalence and Physical Linkages Amongst Integrons, ISE <italic>cp</italic>1, IS <italic>CR</italic>1, Tn21 and Tn7 Encountered in <italic>Escherichia coli</italic>Strains from Hospitalized and Non-Hospitalized Patients in Kenya during a 19-Year Period (1992-2011). <italic>BMC</italic><italic>Microbiology</italic>, 13, Article No. 109. https://doi.org/10.1186/1471-2180-13-109 <pub-id pub-id-type="doi">10.1186/1471-2180-13-109</pub-id><pub-id pub-id-type="pmid">23682924</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1186/1471-2180-13-109">https://doi.org/10.1186/1471-2180-13-109</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Kiiru, J.</string-name>
              <string-name>Butaye, P.</string-name>
              <string-name>Goddeeris, B.M.</string-name>
              <string-name>Kariuki, S.</string-name>
              <string-name>Integrons, I</string-name>
            </person-group>
            <year>2013</year>
            <article-title>Analysis for Prevalence and Physical Linkages Amongst Integrons, ISEcp1, ISCR1, Tn21 and Tn7 Encountered in Escherichia coli Strains from Hospitalized and Non-Hospitalized Patients in Kenya during a 19-Year Period (1992-2011)</article-title>
            <source>BMC Microbiology</source>
            <volume>13</volume>
            <elocation-id>No</elocation-id>
            <pub-id pub-id-type="doi">10.1186/1471-2180-13-109</pub-id>
            <pub-id pub-id-type="pmid">23682924</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B28">
        <label>28.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Muriuki, C.W., Ogonda, L.A., Kyanya, C., Matano, D., Masakhwe, C., Odoyo, E., <italic>et al.</italic> (2022) Phenotypic and Genotypic Characteristics of Uropathogenic <italic>Escherichia coli</italic>Isolates from Kenya. <italic>Microbial</italic><italic>Drug</italic><italic>Resistance</italic>, 28, 31-38. https://doi.org/10.1089/mdr.2020.0432 <pub-id pub-id-type="doi">10.1089/mdr.2020.0432</pub-id><pub-id pub-id-type="pmid">34297634</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1089/mdr.2020.0432">https://doi.org/10.1089/mdr.2020.0432</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Muriuki, C.W.</string-name>
              <string-name>Ogonda, L.A.</string-name>
              <string-name>Kyanya, C.</string-name>
              <string-name>Matano, D.</string-name>
              <string-name>Masakhwe, C.</string-name>
              <string-name>Odoyo, E.</string-name>
            </person-group>
            <year>2022</year>
            <article-title>Phenotypic and Genotypic Characteristics of Uropathogenic Escherichia coli Isolates from Kenya</article-title>
            <source>Microbial Drug Resistance</source>
            <volume>28</volume>
            <pub-id pub-id-type="doi">10.1089/mdr.2020.0432</pub-id>
            <pub-id pub-id-type="pmid">34297634</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B29">
        <label>29.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Shropshire, W.C., Aitken, S.L., Pifer, R., Kim, J., Bhatti, M.M., Li, X., Kalia, A., Galloway-Peña, J., Sahasrabhojane, P., Arias, C.A., Greenberg, D.E., Hanson, B.M. and Shelburne, S.A. (2021) IS26-Mediated Amplification of bla <sub>OXA-1</sub> and bla <sub>CTX-M-15</sub> with Concurrent Outer Membrane Porin Disruption Associated with <italic>de Novo</italic> Carbapenem Resistance in a Recurrent Bacteraemia Cohort. <italic>Journal of Antimicrobial Chemotherapy</italic>, 76, 385-395. https://doi.org/10.1093/jac/dkaa447 <pub-id pub-id-type="doi">10.1093/jac/dkaa447</pub-id><pub-id pub-id-type="pmid">33164081</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1093/jac/dkaa447">https://doi.org/10.1093/jac/dkaa447</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Shropshire, W.C.</string-name>
              <string-name>Aitken, S.L.</string-name>
              <string-name>Pifer, R.</string-name>
              <string-name>Kim, J.</string-name>
              <string-name>Bhatti, M.M.</string-name>
              <string-name>Li, X.</string-name>
              <string-name>Kalia, A.</string-name>
              <string-name>Sahasrabhojane, P.</string-name>
              <string-name>Arias, C.A.</string-name>
              <string-name>Greenberg, D.E.</string-name>
              <string-name>Hanson, B.M.</string-name>
              <string-name>Shelburne, S.A.</string-name>
            </person-group>
            <year>2021</year>
            <article-title>IS26-Mediated Amplification of blaOXA-1 and blaCTX-M-15 with Concurrent Outer Membrane Porin Disruption Associated with de Novo Carbapenem Resistance in a Recurrent Bacteraemia Cohort</article-title>
            <source>Journal of Antimicrobial Chemotherapy</source>
            <volume>76</volume>
            <pub-id pub-id-type="doi">10.1093/jac/dkaa447</pub-id>
            <pub-id pub-id-type="pmid">33164081</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B30">
        <label>30.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Weldhagen, G.F., Poirel, L. and Nordmann, P. (2003) Ambler Class A Extended-Spectrum <italic>β</italic>-Lactamases in <italic>Pseudomonas</italic><italic>aeruginosa</italic>: Novel Developments and Clinical Impact. <italic>Antimicrobial</italic><italic>Agents</italic><italic>and</italic><italic>Chemotherapy</italic>, 47, 2385-2392. https://doi.org/10.1128/aac.47.8.2385-2392.2003 <pub-id pub-id-type="doi">10.1128/aac.47.8.2385-2392.2003</pub-id><pub-id pub-id-type="pmid">12878494</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1128/aac.47.8.2385-2392.2003">https://doi.org/10.1128/aac.47.8.2385-2392.2003</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Weldhagen, G.F.</string-name>
              <string-name>Poirel, L.</string-name>
              <string-name>Nordmann, P.</string-name>
            </person-group>
            <year>2003</year>
            <article-title>Ambler Class A Extended-Spectrum β-Lactamases in Pseudomonas aeruginosa: Novel Developments and Clinical Impact</article-title>
            <source>Antimicrobial Agents and Chemotherapy</source>
            <volume>47</volume>
            <pub-id pub-id-type="doi">10.1128/aac.47.8.2385-2392.2003</pub-id>
            <pub-id pub-id-type="pmid">12878494</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B31">
        <label>31.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Bush, K., Jacoby, G.A. and Medeiros, A.A. (1995) A Functional Classification Scheme for <italic>β</italic>-Lactamases and Its Correlation with Molecular Structure. <italic>Antimicrobial</italic><italic>Agents</italic><italic>and</italic><italic>Chemotherapy</italic>, 39, 1211-1233. https://doi.org/10.1128/aac.39.6.1211 <pub-id pub-id-type="doi">10.1128/aac.39.6.1211</pub-id><pub-id pub-id-type="pmid">7574506</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1128/aac.39.6.1211">https://doi.org/10.1128/aac.39.6.1211</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Bush, K.</string-name>
              <string-name>Jacoby, G.A.</string-name>
              <string-name>Medeiros, A.A.</string-name>
            </person-group>
            <year>1995</year>
            <article-title>A Functional Classification Scheme for β-Lactamases and Its Correlation with Molecular Structure</article-title>
            <source>Antimicrobial Agents and Chemotherapy</source>
            <volume>39</volume>
            <pub-id pub-id-type="doi">10.1128/aac.39.6.1211</pub-id>
            <pub-id pub-id-type="pmid">7574506</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B32">
        <label>32.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Poirel, L., Walsh, T.R., Cuvillier, V. and Nordmann, P. (2011) Multiplex PCR for Detection of Acquired Carbapenemase Genes. <italic>Diagnostic</italic><italic>Microbiology</italic><italic>and</italic><italic>Infectious</italic><italic>Disease</italic>, 70, 119-123. https://doi.org/10.1016/j.diagmicrobio.2010.12.002 <pub-id pub-id-type="doi">10.1016/j.diagmicrobio.2010.12.002</pub-id><pub-id pub-id-type="pmid">21398074</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.diagmicrobio.2010.12.002">https://doi.org/10.1016/j.diagmicrobio.2010.12.002</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Poirel, L.</string-name>
              <string-name>Walsh, T.R.</string-name>
              <string-name>Cuvillier, V.</string-name>
              <string-name>Nordmann, P.</string-name>
            </person-group>
            <year>2011</year>
            <article-title>Multiplex PCR for Detection of Acquired Carbapenemase Genes</article-title>
            <source>Diagnostic Microbiology and Infectious Disease</source>
            <volume>70</volume>
            <pub-id pub-id-type="doi">10.1016/j.diagmicrobio.2010.12.002</pub-id>
            <pub-id pub-id-type="pmid">21398074</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B33">
        <label>33.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Moubareck, C., Daoud, Z., Hakimé, N.I., Hamzé, M., Mangeney, N., Matta, H., <italic>et al.</italic> (2005) Countrywide Spread of Community-and Hospital-Acquired Extended-Spectrum <italic>β</italic>-Lactamase (CTX-M-15)-Producing <italic>Enterobacteriaceae</italic> in Lebanon. <italic>Journal</italic><italic>of</italic><italic>Clinical</italic><italic>Microbiology</italic>, 43, 3309-3313. https://doi.org/10.1128/jcm.43.7.3309-3313.2005 <pub-id pub-id-type="doi">10.1128/jcm.43.7.3309-3313.2005</pub-id><pub-id pub-id-type="pmid">16000453</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1128/jcm.43.7.3309-3313.2005">https://doi.org/10.1128/jcm.43.7.3309-3313.2005</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Moubareck, C.</string-name>
              <string-name>Daoud, Z.</string-name>
              <string-name>Mangeney, N.</string-name>
              <string-name>Matta, H.</string-name>
            </person-group>
            <year>2005</year>
            <article-title>Countrywide Spread of Community-and Hospital-Acquired Extended-Spectrum β-Lactamase (CTX-M-15)-Producing Enterobacteriaceae in Lebanon</article-title>
            <source>Journal of Clinical Microbiology</source>
            <volume>43</volume>
            <pub-id pub-id-type="doi">10.1128/jcm.43.7.3309-3313.2005</pub-id>
            <pub-id pub-id-type="pmid">16000453</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B34">
        <label>34.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Al-Mayahie, S. and Al Kuriashy, J.J. (2016) Distribution of ESBLs among <italic>Escherichia coli</italic>Isolates from Outpatients with Recurrent UTIs and Their Antimicrobial Resistance. <italic>The</italic><italic>Journal</italic><italic>of</italic><italic>Infection</italic><italic>in</italic><italic>Developing</italic><italic>Countries</italic>, 10, 575-583. https://doi.org/10.3855/jidc.6661 <pub-id pub-id-type="doi">10.3855/jidc.6661</pub-id><pub-id pub-id-type="pmid">27367005</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.3855/jidc.6661">https://doi.org/10.3855/jidc.6661</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Al-Mayahie, S.</string-name>
              <string-name>Kuriashy, J.J.</string-name>
            </person-group>
            <year>2016</year>
            <article-title>Distribution of ESBLs among Escherichia coli Isolates from Outpatients with Recurrent UTIs and Their Antimicrobial Resistance</article-title>
            <source>The Journal of Infection in Developing Countries</source>
            <volume>10</volume>
            <pub-id pub-id-type="doi">10.3855/jidc.6661</pub-id>
            <pub-id pub-id-type="pmid">27367005</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B35">
        <label>35.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Dziri, R., Klibi, N., Alonso, C.A., Jouini, A., Ben Said, L., Chairat, S., <italic>et al.</italic> (2016) Detection of CTX-M-15-Producing <italic>Escherichia</italic><italic>coli</italic> Isolates of Lineages ST131-B2 and ST167-A in Environmental Samples of a Tunisian Hospital. <italic>Microbial</italic><italic>Drug</italic><italic>Resistance</italic>, 22, 399-403. https://doi.org/10.1089/mdr.2015.0354 <pub-id pub-id-type="doi">10.1089/mdr.2015.0354</pub-id><pub-id pub-id-type="pmid">26958744</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1089/mdr.2015.0354">https://doi.org/10.1089/mdr.2015.0354</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Dziri, R.</string-name>
              <string-name>Klibi, N.</string-name>
              <string-name>Alonso, C.A.</string-name>
              <string-name>Jouini, A.</string-name>
              <string-name>Said, L.</string-name>
              <string-name>Chairat, S.</string-name>
            </person-group>
            <year>2016</year>
            <article-title>Detection of CTX-M-15-Producing Escherichia coli Isolates of Lineages ST131-B2 and ST167-A in Environmental Samples of a Tunisian Hospital</article-title>
            <source>Microbial Drug Resistance</source>
            <volume>22</volume>
            <pub-id pub-id-type="doi">10.1089/mdr.2015.0354</pub-id>
            <pub-id pub-id-type="pmid">26958744</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B36">
        <label>36.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Paterson, D.L. (2006) Resistance in Gram-Negative Bacteria: <italic>Enterobacteriaceae</italic>. <italic>The</italic><italic>American</italic><italic>Journal</italic><italic>of</italic><italic>Medicine</italic>, 119, S20-S28. https://doi.org/10.1016/j.amjmed.2006.03.013 <pub-id pub-id-type="doi">10.1016/j.amjmed.2006.03.013</pub-id><pub-id pub-id-type="pmid">16735147</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.amjmed.2006.03.013">https://doi.org/10.1016/j.amjmed.2006.03.013</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Paterson, D.L.</string-name>
            </person-group>
            <year>2006</year>
            <article-title>Resistance in Gram-Negative Bacteria: Enterobacteriaceae</article-title>
            <source>The American Journal of Medicine</source>
            <volume>119</volume>
            <pub-id pub-id-type="doi">10.1016/j.amjmed.2006.03.013</pub-id>
            <pub-id pub-id-type="pmid">16735147</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B37">
        <label>37.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Farzana, R., Shamsuzzaman, S., Mamun, K. and Shears, P. (2013) Antimicrobial Susceptibility Pattern of Extended Spectrum <italic>β</italic>-Lactamase Producing Gram-Negative Bacteria Isolated from Wound and Urine in a Tertiary Care Hospital, Dhaka City, Bangladesh. <italic>T</italic><italic>he Southeast Asian Journal of Tropical Medicine and Public</italic><italic>Health</italic>, 44, 96-103.</mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Farzana, R.</string-name>
              <string-name>Shamsuzzaman, S.</string-name>
              <string-name>Mamun, K.</string-name>
              <string-name>Shears, P.</string-name>
              <string-name>Hospital, D</string-name>
              <string-name>City, B</string-name>
            </person-group>
            <year>2013</year>
            <article-title>Antimicrobial Susceptibility Pattern of Extended Spectrum β-Lactamase Producing Gram-Negative Bacteria Isolated from Wound and Urine in a Tertiary Care Hospital, Dhaka City, Bangladesh</article-title>
            <source>The Southeast Asian Journal of Tropical Medicine and Public Health</source>
            <volume>44</volume>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B38">
        <label>38.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Pitout, J.D.D., Hossain, A. and Hanson, N.D. (2004) Phenotypic and Molecular Detection of CTX-M- <italic>β</italic>-Lactamases Produced by <italic>Escherichia coli</italic>and <italic>Klebsiella</italic> spp. <italic>Journal</italic><italic>of</italic><italic>Clinical</italic><italic>Microbiology</italic>, 42, 5715-5721. https://doi.org/10.1128/jcm.42.12.5715-5721.2004 <pub-id pub-id-type="doi">10.1128/jcm.42.12.5715-5721.2004</pub-id><pub-id pub-id-type="pmid">15583304</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1128/jcm.42.12.5715-5721.2004">https://doi.org/10.1128/jcm.42.12.5715-5721.2004</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Pitout, J.D.D.</string-name>
              <string-name>Hossain, A.</string-name>
              <string-name>Hanson, N.D.</string-name>
            </person-group>
            <year>2004</year>
            <article-title>Phenotypic and Molecular Detection of CTX-M-β-Lactamases Produced by Escherichia coli and Klebsiella spp</article-title>
            <source>Journal of Clinical Microbiology</source>
            <volume>42</volume>
            <pub-id pub-id-type="doi">10.1128/jcm.42.12.5715-5721.2004</pub-id>
            <pub-id pub-id-type="pmid">15583304</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B39">
        <label>39.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Coque, T.M., Baquero, F. and Cantón, R. (2008) Increasing Prevalence of ESBL-Producing <italic>Enterobacteriaceae</italic> in Europe. <italic>Eurosurveillance</italic>, 13, 1-11. https://doi.org/10.2807/ese.13.47.19044-en <pub-id pub-id-type="doi">10.2807/ese.13.47.19044-en</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.2807/ese.13.47.19044-en">https://doi.org/10.2807/ese.13.47.19044-en</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Coque, T.M.</string-name>
              <string-name>Baquero, F.</string-name>
            </person-group>
            <year>2008</year>
            <article-title>Increasing Prevalence of ESBL-Producing Enterobacteriaceae in Europe</article-title>
            <source>Eurosurveillance</source>
            <volume>13</volume>
            <pub-id pub-id-type="doi">10.2807/ese.13.47.19044-en</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B40">
        <label>40.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Chelangat, S., Ngugi, C., Song’oro, E. and Mwaniki, J.N. (2025) Prevalence of Uropathogenic <italic>E. coli</italic>, Antimicrobial Susceptibility Profiles and Carriage of Extended-Spectrum Beta-Lactamases Genes at Mama Lucy Hospital, Kenya. <italic>Global Journal of Health Sciences</italic>, 10, 14-37. https://doi.org/10.47604/gjhs.3153 <pub-id pub-id-type="doi">10.47604/gjhs.3153</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.47604/gjhs.3153">https://doi.org/10.47604/gjhs.3153</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Chelangat, S.</string-name>
              <string-name>Ngugi, C.</string-name>
              <string-name>Mwaniki, J.N.</string-name>
              <string-name>Hospital, K</string-name>
            </person-group>
            <year>2025</year>
            <article-title>Prevalence of Uropathogenic E</article-title>
            <source>coli</source>
            <volume>10</volume>
            <pub-id pub-id-type="doi">10.47604/gjhs.3153</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B41">
        <label>41.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Nairoukh, Y.R., Mahafzah, A.M., Irshaid, A. and Shehabi, A.A. (2018) Molecular Characterization of Multidrug Resistant Uropathogenic <italic>E.</italic><italic>coli</italic> Isolates from Jordanian Patients. <italic>The</italic><italic>Open</italic><italic>Microbiology</italic><italic>Journal</italic>, 12, 1-7. https://doi.org/10.2174/1874285801812010001 <pub-id pub-id-type="doi">10.2174/1874285801812010001</pub-id><pub-id pub-id-type="pmid">29456773</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.2174/1874285801812010001">https://doi.org/10.2174/1874285801812010001</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Nairoukh, Y.R.</string-name>
              <string-name>Mahafzah, A.M.</string-name>
              <string-name>Irshaid, A.</string-name>
              <string-name>Shehabi, A.A.</string-name>
            </person-group>
            <year>2018</year>
            <article-title>Molecular Characterization of Multidrug Resistant Uropathogenic E</article-title>
            <source>coli Isolates from Jordanian Patients. The Open Microbiology Journal</source>
            <volume>12</volume>
            <pub-id pub-id-type="doi">10.2174/1874285801812010001</pub-id>
            <pub-id pub-id-type="pmid">29456773</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B42">
        <label>42.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Mohamed, R., Mohmed, I. and Majeed, H. (2023) Curing of Resistant <italic>Pseudomonas</italic><italic>aeruginosa</italic> by Ethidium Bromide. <italic>Bionatura</italic>, 8, 1-7.</mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Mohamed, R.</string-name>
              <string-name>Mohmed, I.</string-name>
              <string-name>Majeed, H.</string-name>
            </person-group>
            <year>2023</year>
            <article-title>Curing of Resistant Pseudomonas aeruginosa by Ethidium Bromide</article-title>
            <source>Bionatura</source>
            <volume>8</volume>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B43">
        <label>43.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Thabit, A., Abd El-Sabour, E., Nafie, A., El-Mokhtar, M. and Biomy, Y. (2020) Detection of Proteus Species in Diabetic Wounds and Their Antibiotic Resistance Profile Analysis. <italic>Bulletin</italic><italic>of</italic><italic>Pharmaceutical</italic><italic>Sciences.</italic><italic>Assiut</italic>, 43, 1-10. https://doi.org/10.21608/bfsa.2020.93523 <pub-id pub-id-type="doi">10.21608/bfsa.2020.93523</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.21608/bfsa.2020.93523">https://doi.org/10.21608/bfsa.2020.93523</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Thabit, A.</string-name>
              <string-name>El-Sabour, E.</string-name>
              <string-name>Nafie, A.</string-name>
              <string-name>El-Mokhtar, M.</string-name>
              <string-name>Biomy, Y.</string-name>
            </person-group>
            <year>2020</year>
            <article-title>Detection of Proteus Species in Diabetic Wounds and Their Antibiotic Resistance Profile Analysis</article-title>
            <source>Bulletin of Pharmaceutical Sciences. Assiut</source>
            <volume>43</volume>
            <pub-id pub-id-type="doi">10.21608/bfsa.2020.93523</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B44">
        <label>44.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Ozdemir, K. (2019) Curing the Drug Resistance Plasmid in <italic>E. Coli</italic> O157:H7. <italic>Applied</italic><italic>Ecology</italic><italic>and</italic><italic>Environmental</italic><italic>Research</italic>, 17, 14715-14727. https://doi.org/10.15666/aeer/1706_1471514727 <pub-id pub-id-type="doi">10.15666/aeer/1706_1471514727</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.15666/aeer/1706_1471514727">https://doi.org/10.15666/aeer/1706_1471514727</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Ozdemir, K.</string-name>
            </person-group>
            <year>2019</year>
            <article-title>Curing the Drug Resistance Plasmid in E</article-title>
            <source>Coli O157:H7. Applied Ecology and Environmental Research</source>
            <volume>17</volume>
            <pub-id pub-id-type="doi">10.15666/aeer/1706_1471514727</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B45">
        <label>45.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Fody, A.M., Bagre, T.S., Dembele, R., Boubou, L., Moussa, A., Sidikou, R., <italic>et</italic><italic>al.</italic> (2023) Characterization of Class 1, 2 and 3 Integrons in Multidrug-Resistant <italic>Escherichia coli</italic>Isolated from Clinical Samples from Niamey, Niger. <italic>Journal of Microbiology and Antimicrobials</italic>, 15, 23-28.</mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Fody, A.M.</string-name>
              <string-name>Bagre, T.S.</string-name>
              <string-name>Dembele, R.</string-name>
              <string-name>Boubou, L.</string-name>
              <string-name>Moussa, A.</string-name>
              <string-name>Sidikou, R.</string-name>
              <string-name>Niamey, N</string-name>
            </person-group>
            <year>2023</year>
            <article-title>Characterization of Class 1, 2 and 3 Integrons in Multidrug-Resistant Escherichia coli Isolated from Clinical Samples from Niamey, Niger</article-title>
            <source>Journal of Microbiology and Antimicrobials</source>
            <volume>15</volume>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B46">
        <label>46.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Kargar, M., Mohammadalipour, Z., Doosti, A., Lorzadeh, S. and Japoni-Nejad, A. (2014) High Prevalence of Class 1 to 3 Integrons among Multidrug-Resistant Diarrheagenic <italic>Escherichia coli</italic>in Southwest of Iran. <italic>Osong</italic><italic>Public</italic><italic>Health</italic><italic>and</italic><italic>Research</italic><italic>Perspectives</italic>, 5, 193-198. https://doi.org/10.1016/j.phrp.2014.06.003 <pub-id pub-id-type="doi">10.1016/j.phrp.2014.06.003</pub-id><pub-id pub-id-type="pmid">25379369</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/j.phrp.2014.06.003">https://doi.org/10.1016/j.phrp.2014.06.003</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Kargar, M.</string-name>
              <string-name>Mohammadalipour, Z.</string-name>
              <string-name>Doosti, A.</string-name>
              <string-name>Lorzadeh, S.</string-name>
              <string-name>Japoni-Nejad, A.</string-name>
            </person-group>
            <year>2014</year>
            <article-title>High Prevalence of Class 1 to 3 Integrons among Multidrug-Resistant Diarrheagenic Escherichia coli in Southwest of Iran</article-title>
            <source>Osong Public Health and Research Perspectives</source>
            <volume>5</volume>
            <pub-id pub-id-type="doi">10.1016/j.phrp.2014.06.003</pub-id>
            <pub-id pub-id-type="pmid">25379369</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B47">
        <label>47.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Çopur Çiçek, A., Sandalli, C., Budak, E.E., Yağmur, G., Çizmeci, Z., <italic>et al.</italic> (2016) Characterization of Class 1 and Class 2 Integron Gene Cassettes in <italic>Escherichia coli</italic>Strains Isolated from Urine Cultures: A Multicenter Study. <italic>Mikrobiyoloji</italic><italic>Bulteni</italic>, 50, 175-185. https://doi.org/10.5578/mb.24228 <pub-id pub-id-type="doi">10.5578/mb.24228</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.5578/mb.24228">https://doi.org/10.5578/mb.24228</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Sandalli, C.</string-name>
              <string-name>Budak, E.E.</string-name>
            </person-group>
            <year>2016</year>
            <article-title>Characterization of Class 1 and Class 2 Integron Gene Cassettes in Escherichia coli Strains Isolated from Urine Cultures: A Multicenter Study</article-title>
            <source>Mikrobiyoloji Bulteni</source>
            <volume>50</volume>
            <pub-id pub-id-type="doi">10.5578/mb.24228</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B48">
        <label>48.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Chang, C., Chang, Y., Chang, L., Chang, S. and Lee, T. (2000) Characterisation of Drug Resistance Gene Cassettes Associated with Class 1 Integrons in Clinical Isolates of <italic>Escherichia coli</italic>from Taiwan Region. <italic>Journal</italic><italic>of</italic><italic>Medical</italic><italic>Microbiology</italic>, 49, 1097-1102. https://doi.org/10.1099/0022-1317-49-12-1097 <pub-id pub-id-type="doi">10.1099/0022-1317-49-12-1097</pub-id><pub-id pub-id-type="pmid">11129722</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1099/0022-1317-49-12-1097">https://doi.org/10.1099/0022-1317-49-12-1097</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Chang, C.</string-name>
              <string-name>Chang, Y.</string-name>
              <string-name>Chang, L.</string-name>
              <string-name>Chang, S.</string-name>
              <string-name>Lee, T.</string-name>
            </person-group>
            <year>2000</year>
            <article-title>Characterisation of Drug Resistance Gene Cassettes Associated with Class 1 Integrons in Clinical Isolates of Escherichia coli from Taiwan Region</article-title>
            <source>Journal of Medical Microbiology</source>
            <volume>49</volume>
            <pub-id pub-id-type="doi">10.1099/0022-1317-49-12-1097</pub-id>
            <pub-id pub-id-type="pmid">11129722</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B49">
        <label>49.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Walsh, T.R. (2010) Emerging Carbapenemases: A Global Perspective. <italic>International</italic><italic>Journal</italic><italic>of</italic><italic>Antimicrobial</italic><italic>Agents</italic>, 36, S8-S14. https://doi.org/10.1016/s0924-8579(10)70004-2 <pub-id pub-id-type="doi">10.1016/s0924-8579(10)70004-2</pub-id><pub-id pub-id-type="pmid">21129630</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1016/s0924-8579(10)70004-2">https://doi.org/10.1016/s0924-8579(10)70004-2</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Walsh, T.R.</string-name>
            </person-group>
            <year>2010</year>
            <article-title>Emerging Carbapenemases: A Global Perspective</article-title>
            <source>International Journal of Antimicrobial Agents</source>
            <volume>8579</volume>
            <issue>10</issue>
            <pub-id pub-id-type="doi">10.1016/s0924-8579(10)70004-2</pub-id>
            <pub-id pub-id-type="pmid">21129630</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B50">
        <label>50.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Razzaq, R., Sheraz, A., Mohsin, M., Bashir, A. and Haque, A. (2024) Integrons and Multidrug Resistance across Phylogenetic Groups of Clinical Isolates of <italic>Escherichia</italic><italic>coli</italic>. <italic>Pakistan</italic><italic>Journal</italic><italic>of</italic><italic>Medical</italic><italic>Sciences</italic>, 40, 1190-1195. https://doi.org/10.12669/pjms.40.6.8886 <pub-id pub-id-type="doi">10.12669/pjms.40.6.8886</pub-id><pub-id pub-id-type="pmid">38952530</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.12669/pjms.40.6.8886">https://doi.org/10.12669/pjms.40.6.8886</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Razzaq, R.</string-name>
              <string-name>Sheraz, A.</string-name>
              <string-name>Mohsin, M.</string-name>
              <string-name>Bashir, A.</string-name>
              <string-name>Haque, A.</string-name>
            </person-group>
            <year>2024</year>
            <article-title>Integrons and Multidrug Resistance across Phylogenetic Groups of Clinical Isolates of Escherichia coli</article-title>
            <source>Pakistan Journal of Medical Sciences</source>
            <volume>40</volume>
            <pub-id pub-id-type="doi">10.12669/pjms.40.6.8886</pub-id>
            <pub-id pub-id-type="pmid">38952530</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B51">
        <label>51.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Shariat, A. and Fathpoor, F. (2022) Prevalence of Class I, II and III Integrons in Uropathogenic <italic>Escherichia coli</italic>Strains Isolated from Patients with Urinary Tract Infection in Shiraz, Iran. <italic>Jundishapur</italic><italic>Journal</italic><italic>of</italic><italic>Medical</italic><italic>Sciences</italic>, 21, 500-513. https://doi.org/10.32598/jsmj.21.4.2384 <pub-id pub-id-type="doi">10.32598/jsmj.21.4.2384</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.32598/jsmj.21.4.2384">https://doi.org/10.32598/jsmj.21.4.2384</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Shariat, A.</string-name>
              <string-name>Fathpoor, F.</string-name>
              <string-name>Shiraz, I</string-name>
            </person-group>
            <year>2022</year>
            <article-title>Prevalence of Class I, II and III Integrons in Uropathogenic Escherichia coli Strains Isolated from Patients with Urinary Tract Infection in Shiraz, Iran</article-title>
            <source>Jundishapur Journal of Medical Sciences</source>
            <volume>21</volume>
            <pub-id pub-id-type="doi">10.32598/jsmj.21.4.2384</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B52">
        <label>52.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Onyeadi, D. and Agbagwa, O. (2019) Plasmid Curing in Multi-Drug Resistant Hospital and Community Uropathogenic <italic>Escherichia</italic><italic>coli</italic>. <italic>Journal</italic><italic>of</italic><italic>Applied</italic><italic>Sciences</italic><italic>and</italic><italic>Environmental</italic><italic>Management</italic>, 23, 29-34. https://doi.org/10.4314/jasem.v23i1.4 <pub-id pub-id-type="doi">10.4314/jasem.v23i1.4</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.4314/jasem.v23i1.4">https://doi.org/10.4314/jasem.v23i1.4</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Onyeadi, D.</string-name>
              <string-name>Agbagwa, O.</string-name>
            </person-group>
            <year>2019</year>
            <article-title>Plasmid Curing in Multi-Drug Resistant Hospital and Community Uropathogenic Escherichia coli</article-title>
            <source>Journal of Applied Sciences and Environmental Management</source>
            <volume>23</volume>
            <pub-id pub-id-type="doi">10.4314/jasem.v23i1.4</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B53">
        <label>53.</label>
        <citation-alternatives>
          <mixed-citation publication-type="other">Oliver, A., Weigel, L.M., Rasheed, J.K., McGowan, J.E., Raney, P. and Tenover, F.C. (2002) Mechanisms of Decreased Susceptibility to Cefpodoxime in <italic>Escherichia</italic><italic>coli</italic>. <italic>Antimicrobial</italic><italic>Agents</italic><italic>and</italic><italic>Chemotherapy</italic>, 46, 3829-3836. https://doi.org/10.1128/aac.46.12.3829-3836.2002 <pub-id pub-id-type="doi">10.1128/aac.46.12.3829-3836.2002</pub-id><pub-id pub-id-type="pmid">12435684</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1128/aac.46.12.3829-3836.2002">https://doi.org/10.1128/aac.46.12.3829-3836.2002</ext-link></mixed-citation>
          <element-citation publication-type="other">
            <person-group person-group-type="author">
              <string-name>Oliver, A.</string-name>
              <string-name>Weigel, L.M.</string-name>
              <string-name>Rasheed, J.K.</string-name>
              <string-name>McGowan, J.E.</string-name>
              <string-name>Raney, P.</string-name>
              <string-name>Tenover, F.C.</string-name>
            </person-group>
            <year>2002</year>
            <article-title>Mechanisms of Decreased Susceptibility to Cefpodoxime in Escherichia coli</article-title>
            <source>Antimicrobial Agents and Chemotherapy</source>
            <volume>46</volume>
            <pub-id pub-id-type="doi">10.1128/aac.46.12.3829-3836.2002</pub-id>
            <pub-id pub-id-type="pmid">12435684</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
      <ref id="B54">
        <label>54.</label>
        <citation-alternatives>
          <mixed-citation publication-type="journal">Pagani, L., Dell’Amico, E., Migliavacca, R., D’Andrea, M.M., Giacobone, E., Amicosante, G., <italic>et al.</italic> (2003) Multiple CTX-M-Type Extended-Spectrum <italic>β</italic>-Lactamases in Nosocomial Isolates of <italic>Enterobacteriaceae</italic> from a Hospital in Northern Italy. <italic>Journal</italic><italic>of</italic><italic>Clinical</italic><italic>Microbiology</italic>, 41, 4264-4269. https://doi.org/10.1128/jcm.41.9.4264-4269.2003 <pub-id pub-id-type="doi">10.1128/jcm.41.9.4264-4269.2003</pub-id><pub-id pub-id-type="pmid">12958255</pub-id><ext-link ext-link-type="uri" xlink:href="https://doi.org/10.1128/jcm.41.9.4264-4269.2003">https://doi.org/10.1128/jcm.41.9.4264-4269.2003</ext-link></mixed-citation>
          <element-citation publication-type="journal">
            <person-group person-group-type="author">
              <string-name>Pagani, L.</string-name>
              <string-name>Amico, E.</string-name>
              <string-name>Migliavacca, R.</string-name>
              <string-name>Andrea, M.M.</string-name>
              <string-name>Giacobone, E.</string-name>
              <string-name>Amicosante, G.</string-name>
            </person-group>
            <year>2003</year>
            <article-title>Multiple CTX-M-Type Extended-Spectrum β-Lactamases in Nosocomial Isolates of Enterobacteriaceae from a Hospital in Northern Italy</article-title>
            <source>Journal of Clinical Microbiology</source>
            <volume>41</volume>
            <pub-id pub-id-type="doi">10.1128/jcm.41.9.4264-4269.2003</pub-id>
            <pub-id pub-id-type="pmid">12958255</pub-id>
          </element-citation>
        </citation-alternatives>
      </ref>
    </ref-list>
  </back>
</article>