<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article">
 <front>
  <journal-meta>
   <journal-id journal-id-type="publisher-id">
    jbm
   </journal-id>
   <journal-title-group>
    <journal-title>
     Journal of Biosciences and Medicines
    </journal-title>
   </journal-title-group>
   <issn pub-type="epub">
    2327-5081
   </issn>
   <issn publication-format="print">
    2327-509X
   </issn>
   <publisher>
    <publisher-name>
     Scientific Research Publishing
    </publisher-name>
   </publisher>
  </journal-meta>
  <article-meta>
   <article-id pub-id-type="doi">
    10.4236/jbm.2025.1311012
   </article-id>
   <article-id pub-id-type="publisher-id">
    jbm-147091
   </article-id>
   <article-categories>
    <subj-group subj-group-type="heading">
     <subject>
      Articles
     </subject>
    </subj-group>
    <subj-group subj-group-type="Discipline-v2">
     <subject>
      Biomedical 
     </subject>
     <subject>
       Life Sciences
     </subject>
    </subj-group>
   </article-categories>
   <title-group>
    LDHC as a Novel Tumor-Suppressive Biomarker in Cervical Cancer: Multi-Omics Analysis Reveals Diagnostic and Prognostic Significance
   </title-group>
   <contrib-group>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Shanshan
      </surname>
      <given-names>
       Xiao
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Yuhong
      </surname>
      <given-names>
       Hu
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Yawen
      </surname>
      <given-names>
       Li
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Xin
      </surname>
      <given-names>
       Zhang
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Zijun
      </surname>
      <given-names>
       Xiao
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Mingyou
      </surname>
      <given-names>
       Dong
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref> 
     <xref ref-type="aff" rid="aff3"> 
      <sup>3</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Lusheng
      </surname>
      <given-names>
       Liao
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref> 
     <xref ref-type="aff" rid="aff4"> 
      <sup>4</sup>
     </xref>
    </contrib>
   </contrib-group> 
   <aff id="aff1">
    <addr-line>
     aDepartment of Obstetrics and Gynecology, The Affiliated Hospital of Youjiang Medical University for Nationalities, Baise, China
    </addr-line> 
   </aff> 
   <aff id="aff2">
    <addr-line>
     aModern Industrial College of Biomedicine and Great Health, Youjiang Medical University for Nationalities, Baise, China
    </addr-line> 
   </aff> 
   <aff id="aff3">
    <addr-line>
     aGuangxi Engineering Research Center for Precise Genetic Testing of Long-Dwelling Nationalities, Baise, China
    </addr-line> 
   </aff> 
   <aff id="aff4">
    <addr-line>
     aKey Laboratory of Research on Environment and Population Health in Aluminium Mining Areas, Education Department of Guangxi Zhuang Autonomous Region, Baise, China
    </addr-line> 
   </aff> 
   <pub-date pub-type="epub">
    <day>
     30
    </day> 
    <month>
     10
    </month>
    <year>
     2025
    </year>
   </pub-date> 
   <volume>
    13
   </volume> 
   <issue>
    11
   </issue>
   <fpage>
    161
   </fpage>
   <lpage>
    187
   </lpage>
   <history>
    <date date-type="received">
     <day>
      18,
     </day>
     <month>
      September
     </month>
     <year>
      2025
     </year>
    </date>
    <date date-type="published">
     <day>
      7,
     </day>
     <month>
      September
     </month>
     <year>
      2025
     </year> 
    </date> 
    <date date-type="accepted">
     <day>
      7,
     </day>
     <month>
      November
     </month>
     <year>
      2025
     </year> 
    </date>
   </history>
   <permissions>
    <copyright-statement>
     © Copyright 2014 by authors and Scientific Research Publishing Inc. 
    </copyright-statement>
    <copyright-year>
     2014
    </copyright-year>
    <license>
     <license-p>
      This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/
     </license-p>
    </license>
   </permissions>
   <abstract>
    This study presents a comprehensive molecular characterization of lactate dehydrogenase (LDH) family members in cervical squamous cell carcinoma (CESC). Through integrated multi-omics analysis of TCGA and GEO datasets, we identified distinct tissue-specific expression patterns, with LDHA and LDHB showing ubiquitous expression while LDHAL6B and LDHC exhibited testis-specific restriction. Pan-cancer analysis revealed significant overexpression of multiple LDH isoforms in CESC and other malignancies, with LDHC demonstrating exceptional diagnostic performance (AUC = 0.950 in TCGA, AUC = 0.884 in GSE63514). Survival analysis established LDHC as a favorable prognostic marker, contrasting with the poor outcomes associated with other LDH isoforms. Functional network analysis revealed LDH family involvement in key metabolic pathways including pyruvate metabolism and glycolysis. Epigenetic regulation was implicated through differential methylation patterns, particularly LDHB hypermethylation and LDHC hypomethylation in tumor tissues. Immune correlation analysis demonstrated significant associations between LDH expression and immune cell infiltration/checkpoint markers. Crucially, functional validation in Hela cells showed that LDHC knockdown enhanced proliferation (CCK-8 assay), colony formation, migration (wound healing), and invasion (Transwell), suggesting a tumor-suppressive role. These findings establish LDHC as a promising diagnostic biomarker and potential therapeutic target in CESC, while highlighting the complex, isoform-specific roles of LDH family members in cervical cancer pathogenesis. Our results provide new insights into metabolic reprogramming in CESC and suggest LDHC may represent a novel protective factor in cervical carcinogenesis.
   </abstract>
   <kwd-group> 
    <kwd>
     LDH Family
    </kwd> 
    <kwd>
      Cervical Squamous Cell Carcinoma (CESC)
    </kwd> 
    <kwd>
      Biomarker
    </kwd> 
    <kwd>
      DNA Methylation
    </kwd> 
    <kwd>
      Immune Infiltration
    </kwd> 
    <kwd>
      LDHC
    </kwd>
   </kwd-group>
  </article-meta>
 </front>
 <body>
  <sec id="s1">
   <title>1. Introduction</title>
   <p>Cervical Squamous Cell Carcinoma (CESC), alongside breast, colorectal, and lung cancers, ranks among the four most prevalent malignancies in women <xref ref-type="bibr" rid="scirp.147091-1">
     [1]
    </xref>. CESC primarily manifests as two histological subtypes—squamous cell carcinoma and adenocarcinoma, with squamous cell carcinoma being more predominant, largely due to its association with human papillomavirus (HPV) infection <xref ref-type="bibr" rid="scirp.147091-2">
     [2]
    </xref>. Pathogens such as HPV <xref ref-type="bibr" rid="scirp.147091-3">
     [3]
    </xref>, Helicobacter pylori, hepatitis B virus, and Epstein-Barr virus (EBV) contribute significantly to the rising morbidity and mortality of CESC. Clinical management strategies depend on tumor stage <xref ref-type="bibr" rid="scirp.147091-4">
     [4]
    </xref> and grade, with common interventions including radical hysterectomy <xref ref-type="bibr" rid="scirp.147091-5">
     [5]
    </xref> <xref ref-type="bibr" rid="scirp.147091-6">
     [6]
    </xref>, brachytherapy <xref ref-type="bibr" rid="scirp.147091-7">
     [7]
    </xref>, chemotherapy, immunotherapy <xref ref-type="bibr" rid="scirp.147091-8">
     [8]
    </xref>, and combination therapies. Recent clinical trials have demonstrated that checkpoint inhibitors like ipilimumab and nivolumab synergistically modulate cervical tumor microenvironments, enhancing therapeutic efficacy <xref ref-type="bibr" rid="scirp.147091-9">
     [9]
    </xref>. However, due to the limited research on specific immune biomarkers for CESC and its persistently high mortality rate, identifying novel, highly sensitive, and specific tumor markers remains a critical research focus.</p>
   <p>Tumor cells predominantly rely on glycolysis for energy supply, and excessive glycolytic activity has been established as a key driver of tumor progression <xref ref-type="bibr" rid="scirp.147091-10">
     [10]
    </xref>. Lactate dehydrogenase (LDH), a family of NAD+-dependent isoenzymes, catalyzes the interconversion of pyruvate and lactate while mediating the redox exchange between NADH and NAD+ <xref ref-type="bibr" rid="scirp.147091-11">
     [11]
    </xref>. This enzymatic activity underscores its pivotal role in the Warburg effect <xref ref-type="bibr" rid="scirp.147091-12">
     [12]
    </xref>. Notably, inhibition of lactate dehydrogenase A (LDHA) disrupts serine and aspartate biosynthesis, indirectly activating the GCN2-ATF4 signaling axis. This upregulates SLC1A5 expression and enhances glutamine/essential amino acid uptake, ultimately promoting mTORC1 activation and prolonging tumor cell survival <xref ref-type="bibr" rid="scirp.147091-13">
     [13]
    </xref>. Recently discovered LDH family members, lactate dehydrogenase A-like 6A (LDHAL6A) and 6B (LDHAL6B), are reportedly expressed exclusively in testicular tissue <xref ref-type="bibr" rid="scirp.147091-14">
     [14]
    </xref>. Additionally, antimetabolic agents have been shown to suppress CESC cell proliferation by targeting glycolysis-related proteins, such as lactate dehydrogenase B (LDHB) <xref ref-type="bibr" rid="scirp.147091-15">
     [15]
    </xref>. Lactate dehydrogenase C (LDHC), located on chromosome 7, was the first testis-specific isozyme identified in male germ cells <xref ref-type="bibr" rid="scirp.147091-16">
     [16]
    </xref>. Conversely, alterations in lactate dehydrogenase D (LDHD) expression influence lactate metabolism via glycolysis, with elevated LDHD levels observed in renal cell carcinoma <xref ref-type="bibr" rid="scirp.147091-17">
     [17]
    </xref> and esophageal squamous cell carcinoma <xref ref-type="bibr" rid="scirp.147091-18">
     [18]
    </xref> compared to normal tissues. Despite these findings, the roles of LDHC and LDHD in CESC pathogenesis remain poorly understood.</p>
   <p>In this study, we comprehensively analyzed the expression profiles of LDH family members across human tissues and their differential expression patterns in pan-cancer. Utilizing multi-omics approaches, we investigated the LDH gene family’s involvement in CESC and evaluated its diagnostic and prognostic potential through GEO dataset validation. Receiver operating characteristic (ROC) curve analysis further confirmed the robust diagnostic efficacy of most LDH members in CESC prognosis. Kaplan-Meier (KM) survival analysis revealed significant associations between LDH family expression and patient survival, supporting their utility as prognostic biomarkers. Additionally, we conducted mutation interaction, methylation correlation, and immune infiltration analyses, complemented by cellular validation experiments focusing on LDHC. This systematic exploration elucidates the functional relevance of LDHC and other LDH members in CESC progression, diagnosis, and clinical outcomes, providing a theoretical foundation for future diagnostic and therapeutic strategies targeting the LDH family in CESC.</p>
  </sec><sec id="s2">
   <title>2. Materials and Methods</title>
   <sec id="s2_1">
    <title>2.1. Data Source and Processing</title>
    <p>The expression profiles, prognostic significance, and immune cell infiltration patterns of LDH gene family members were analyzed using data from the TCGA database (<xref ref-type="bibr" rid="scirp.147091-https://portal.gdc.cancer.gov">
      https://portal.gdc.cancer.gov
     </xref>) <xref ref-type="bibr" rid="scirp.147091-19">
      [19]
     </xref>, accessed via the Xiantao Academic platform (<xref ref-type="bibr" rid="scirp.147091-https://www.xiantaozi.com/login">
      https://www.xiantaozi.com/login
     </xref>). Transcripts per million (TPM) normalized expression matrices were downloaded and log2-transformed (log2[value + 1]) for downstream analyses. To externally validate the diagnostic and prognostic relevance of LDH genes in CESC, we obtained the GSE63514 and GSE44001 datasets from the GEO database (<xref ref-type="bibr" rid="scirp.147091-https://www.ncbi.nlm.nih.gov/geo">
      https://www.ncbi.nlm.nih.gov/geo
     </xref>) and plotted receiver operating characteristic (ROC) curves. The area under the ROC curve (AUC) was calculated, and the closer the value was to 1, the higher the diagnostic efficiency. In the analysis, normal controls were pathologically confirmed normal tissues (paired adjacent or healthy donor), with cases being histologically diagnosed CESC samples. The diagnostic value of these genes is significant for P &lt; 0.05.</p>
   </sec>
   <sec id="s2_2">
    <title>2.2. mRNA Expression Analysis of the LDH Family</title>
    <p>The Human Protein Atlas (HPA) database (<xref ref-type="bibr" rid="scirp.147091-https://www.proteinatlas.org">
      https://www.proteinatlas.org
     </xref>) <xref ref-type="bibr" rid="scirp.147091-20">
      [20]
     </xref> was employed to evaluate LDH family expression across human tissues. Using the “TISSUE” module and GTEx dataset, we queried the official gene symbols of LDH members (e.g., LDHA, LDHB) to generate tissue-specific expression profiles. Using the Xiantao Academic database, we selected three matched pairs of cervical cancer tumor tissues and adjacent normal tissues to compare LDH family gene expression profiles. The GSE63514 dataset was analyzed to confirm differential LDH expression in CESC versus normal cervical tissues. Diagnostic performance was assessed via receiver operating characteristic (ROC) curves using the “pROC” R package.</p>
   </sec>
   <sec id="s2_3">
    <title>2.3. Protein Expression Levels of LDH Family Members</title>
    <p>Immunohistochemical (IHC) staining results for LDH proteins in CESC and normal cervical tissues were retrieved from the HPA database using the “PATHOLOGY” and “TISSUE” modules. Clinical metadata for these samples were systematically curated to ensure relevance.</p>
   </sec>
   <sec id="s2_4">
    <title>2.4. Prognostic Analysis of LDH Family Members</title>
    <p>The Xiantao Academic database analyzed the association between LDH gene expression and three survival endpoints: Overall Survival (OS), Disease-Specific Survival (DSS) and Progress-Free Interval (PFI). Clinical and expression data from GSE44001 were processed via the Sangerbox platform (<xref ref-type="bibr" rid="scirp.147091-http://sangerbox.com/">
      http://sangerbox.com/
     </xref>) as follows: Dataset and clinical metadata were retrieved using the “GSE44001” identifier. Probe annotation and data normalization were performed in the “Data Tabulation and Interactive Analysis” module. Survival analysis was conducted using the survival R package (v3.3.1), correlating LDH expression with CESC prognosis. Univariate and multivariate Cox regression models were applied to evaluate LDH genes as independent prognostic factors, implemented through the Xiantao Academic database.</p>
   </sec>
   <sec id="s2_5">
    <title>2.5. Genetic Variation and Protein Interaction Networks of LDH Family Members</title>
    <p>To investigate the mutational landscape of LDH family members in CESC, we utilized the cBioPortal database (<xref ref-type="bibr" rid="scirp.147091-https://www.cbioportal.org/">
      https://www.cbioportal.org/
     </xref>) <xref ref-type="bibr" rid="scirp.147091-21">
      [21]
     </xref>. Protein-protein interaction (PPI) networks for LDH family members were constructed using the GeneMANIA database (<xref ref-type="bibr" rid="scirp.147091-http://genemania.org">
      http://genemania.org
     </xref>) <xref ref-type="bibr" rid="scirp.147091-22">
      [22]
     </xref> and STRING database (<xref ref-type="bibr" rid="scirp.147091-https://cn.string-db.org/">
      https://cn.string-db.org/
     </xref>) <xref ref-type="bibr" rid="scirp.147091-23">
      [23]
     </xref>. Subsequently, interacting genes were subjected to Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) enrichment analyses via the “ClusterProfiler” R package, with results visualized using ggplot2.</p>
   </sec>
   <sec id="s2_6">
    <title>2.6. DNA Methylation Analysis of LDH Family</title>
    <p>DNA methylation levels of LDH family members were analyzed using the UALCAN online database (<xref ref-type="bibr" rid="scirp.147091-https://ualcan.path.uab.edu/">
      https://ualcan.path.uab.edu/
     </xref>) <xref ref-type="bibr" rid="scirp.147091-24">
      [24]
     </xref> <xref ref-type="bibr" rid="scirp.147091-25">
      [25]
     </xref>. The GSCALite database (<xref ref-type="bibr" rid="scirp.147091-http://bioinfo.life.hust.edu.cn/web/GSCALite/">
      http://bioinfo.life.hust.edu.cn/web/GSCALite/
     </xref>) <xref ref-type="bibr" rid="scirp.147091-26">
      [26]
     </xref> was employed to assess correlations between mRNA expression and DNA methylation, with results presented as scatter plots.</p>
   </sec>
   <sec id="s2_7">
    <title>2.7. Correlation with Immune Cell Infiltration and Checkpoints</title>
    <p>The Xiantao Academic Database (<xref ref-type="bibr" rid="scirp.147091-https://www.xiantaozi.com/login">
      https://www.xiantaozi.com/login
     </xref>) was used to evaluate: Associations between LDH family gene expression and immune cell infiltration in CESC. Correlations between LDH members and immune checkpoint genes, including PDCD1, CD274, PDCD1LG2, CTLA4, LMTK3, LAG3, TIGIT, HAVCR2 and SIGLEC15.2.</p>
   </sec>
   <sec id="s2_8">
    <title>2.8. Single-Gene Enrichment Analysis of LDHC</title>
    <p>Using the Researcher’s Home database (<xref ref-type="bibr" rid="scirp.147091-https://www.home-for-researchers.com/%23/">
      https://www.home-for-researchers.com/#/
     </xref>), we explored LDHC-regulated signaling pathways in cervical cancer progression. CESC patients were stratified into high- and low-LDHC expression groups based on median expression values. Differentially expressed genes (DEGs) were identified using the “DESeq2” R package (|log2FC| ≥ 1.5, *p* &lt; 0.05), followed by GO/KEGG enrichment analyses (“ClusterProfiler”) and visualization.2.</p>
   </sec>
   <sec id="s2_9">
    <title>2.9. Cell Culture</title>
    <p>HeLa cells (ATCC) were cultured in DMEM high-glucose medium (Gibco, C11995500BT) supplemented with 10% FBS (Sigma, F8318) and 1% penicillin/streptomycin (Gibco, 15140122) at 37˚C with 5% CO<sub>2</sub>. Cells in the logarithmic growth phase were harvested using trypsin (Gibco, 25200056) for experiments, with triplicate wells for all assays.</p>
   </sec>
   <sec id="s2_10">
    <title>2.10. CCK-8 Assay</title>
    <p>Cells (3,000/well) were seeded in 96-well plates (Corning, 3599) with 100 µL medium. Five plates were prepared to measure OD450 values at 0 h (post-attachment), 24 h, 48 h, 72 h, and 96 h. Before measurement, CCK-8 reagent (UElandy, C6005M) was diluted (10% medium: CCK-8 = 1:9), and 10 µL was added to each well. After 1-hour incubation, absorbance was measured using a VICTOR Nivo plate reader, and proliferation curves were plotted.</p>
   </sec>
   <sec id="s2_11">
    <title>2.11. Colony Formation Assay</title>
    <p>Log-phase cells (3,000/well) were seeded in 6-well plates (Corning, 3516) and cultured for 14 days (medium replaced every 2 - 3 days). When clusters reached 30 - 50 cells/field, cultures were terminated. Cells were: 1) Washed with PBS (Gibco, C10010500). 2) Fixed with 4% paraformaldehyde (biosharp, BL539A) for 30 min. 3) Stained with crystal violet (Solarbio, G1063) for 40 min. 4) Imaged, and colonies (&gt;50 cells) were counted.</p>
   </sec>
   <sec id="s2_12">
    <title>2.12. Wound Healing Assay</title>
    <p>Cells were seeded in 6-well plates at a density of 2 × 10<sup>5</sup> cells/mL and incubated until reaching approximately 90% confluence. A uniform scratch was created using a sterile pipette tip perpendicular to the plate bottom. Initial wound area (0 h) was measured using an inverted microscope (Axio Vert A1, 07060200) by capturing multiple fields. After 48 h incubation, the same fields were re-imaged to measure remaining wound area. The migration rate was calculated as: Scratch healing rate (%) = [(0 h area − 48 h area)/0 h area] × 100ys.</p>
   </sec>
   <sec id="s2_13">
    <title>2.13. Cell Invasion and Migration Assays</title>
    <p>Transwell chambers (JET, TCS003024) were used for both assays. For invasion experiments, 100 μL Matrigel (Corning, 356234) was evenly coated and polymerized in the upper chamber. Cells (2 × 10<sup>5</sup> cells/mL in serum-free medium) were seeded in the upper chamber, while 10% FBS medium served as chemoattractant in the lower chamber. After 24 h incubation, non-migrated cells were removed with PBS. Migrated/invaded cells were fixed with 4% paraformaldehyde (50 min), stained with 0.1% crystal violet (50 min), and counted from four random microscope fields per chamber.</p>
   </sec>
   <sec id="s2_14">
    <title>2.14. Western Blotting</title>
    <p>Total protein was extracted using RIPA lysis buffer (Aase, PC103) supplemented with 1% PMSF (Aase, GRF101). Protein concentration was determined (Aase, ZJ102) and normalized. Samples were separated on 7.5% SDS-PAGE gels (Aase, PG211) at 80 V (40 min) then 120 V (35 min), followed by transfer to methanol-activated PVDF membranes (Millipore, IPVH00010) at 200 mA for 60 min. Membranes were blocked (Yase, PS108P, 40 min), incubated with primary antibodies (Proteintech LDHC: 19989-1-AP, 4˚C overnight) and HRP-conjugated secondary antibodies (Invitrogen 31460/31430, 2 h RT). Protein bands were visualized using ECL reagent (Accelerase, SQ201) and quantified with ImageJ.</p>
   </sec>
   <sec id="s2_15">
    <title>2.15. Quantitative RT-PCR</title>
    <p>Total RNA was extracted using TRIzol (Yingjie Life, 15596026) and reverse transcribed (Tolobio, 22107). qPCR was performed with SYBR Green (Tolobio, 22204-1) under conditions: 94˚C (3 min); 35 cycles of 94˚C (15 s), 64˚C (2 min), 72˚C (2 min); final extension at 72˚C (10 min). Relative expression was calculated via 2<sup>(</sup><sup>−</sup><sup>ΔΔCt)</sup> method. Primer sequences are listed in <xref ref-type="table" rid="table1">
      Table 1
     </xref>.</p>
    <table-wrap id="table1">
     <label>
      <xref ref-type="table" rid="table1">
       Table 1
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.147091-"></xref>Table 1. Primer sequences used as target and reference genes used in qPCR reactions.</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td custom-top-td acenter" width="23.52%"><p style="text-align:center">Gene name</p></td> 
       <td class="custom-bottom-td custom-top-td acenter" width="23.08%"><p style="text-align:center">Primers</p></td> 
       <td class="custom-bottom-td custom-top-td acenter" width="53.41%"><p style="text-align:center">Sequence</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="custom-top-td aleft" width="23.52%"><p style="text-align:left">LDHA</p></td> 
       <td class="custom-top-td aleft" width="23.08%"><p style="text-align:left">forward primer</p></td> 
       <td class="custom-top-td aleft" width="53.41%"><p style="text-align:left">CGGATCTCATTGCCACGC</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="23.08%"><p style="text-align:left">reverse primer</p></td> 
       <td class="aleft" width="53.41%"><p style="text-align:left">CACCAACCCCAACAACTGTA</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="aleft" width="23.52%"><p style="text-align:left">LDHAL6A</p></td> 
       <td class="aleft" width="23.08%"><p style="text-align:left">forward primer</p></td> 
       <td class="aleft" width="53.41%"><p style="text-align:left">CTTGTCCTTGTGGATGTTGATG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="23.08%"><p style="text-align:left">reverse primer</p></td> 
       <td class="aleft" width="53.41%"><p style="text-align:left">TCTCCTTTTTTCTGGCGTGC</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="aleft" width="23.52%"><p style="text-align:left">LDHAL6B</p></td> 
       <td class="aleft" width="23.08%"><p style="text-align:left">forward primer</p></td> 
       <td class="aleft" width="53.41%"><p style="text-align:left">GAGTTGGACTGTGCCTGTTG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="23.08%"><p style="text-align:left">reverse primer</p></td> 
       <td class="aleft" width="53.41%"><p style="text-align:left">ATCTTGCTCACGGGGGT</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="aleft" width="23.52%"><p style="text-align:left">LDHB</p></td> 
       <td class="aleft" width="23.08%"><p style="text-align:left">forward primer</p></td> 
       <td class="aleft" width="53.41%"><p style="text-align:left">GACTTTGTCTTCTCCGCACGA</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="23.08%"><p style="text-align:left">reverse primer</p></td> 
       <td class="aleft" width="53.41%"><p style="text-align:left">GCTGATAGCACACGCCATACC</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="aleft" width="23.52%"><p style="text-align:left">LDHC</p></td> 
       <td class="aleft" width="23.08%"><p style="text-align:left">forward primer</p></td> 
       <td class="aleft" width="53.41%"><p style="text-align:left">GCCATAACGACGCATACTAAAAG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="23.08%"><p style="text-align:left">reverse primer</p></td> 
       <td class="aleft" width="53.41%"><p style="text-align:left">GCCATAACGACGCATACTAAAAG</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="aleft" width="23.52%"><p style="text-align:left">LDHD</p></td> 
       <td class="aleft" width="23.08%"><p style="text-align:left">forward primer</p></td> 
       <td class="aleft" width="53.41%"><p style="text-align:left">CAACCTCACGGGGCTCTTCG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="23.08%"><p style="text-align:left">reverse primer</p></td> 
       <td class="aleft" width="53.41%"><p style="text-align:left">AACTCAATGCGGGCTACGGG</p></td> 
      </tr> 
      <tr> 
       <td rowspan="2" class="aleft" width="23.52%"><p style="text-align:left">GAPDH</p></td> 
       <td class="aleft" width="23.08%"><p style="text-align:left">forward primer</p></td> 
       <td class="aleft" width="53.41%"><p style="text-align:left">CCTGGGAAACCTGCCAAGTATG</p></td> 
      </tr> 
      <tr> 
       <td class="custom-bottom-td aleft" width="23.08%"><p style="text-align:left">reverse primer</p></td> 
       <td class="custom-bottom-td aleft" width="53.41%"><p style="text-align:left">GGTCCTCAGTGTAGCCCAAGATG</p></td> 
      </tr> 
     </table>
    </table-wrap>
   </sec>
   <sec id="s2_16">
    <title>2.16. Statistical Analysis</title>
    <p>The Mann-Whitney U test was used to analyze the expression levels of unpaired samples of LDH family in pan-cancer, and the Wilcoxon singed rank test was used to process the paired samples. The prognostic survival analysis of LDH family in pan-cancer was performed by one-way and multifactorial Cox regression test as the statistical analysis of variance. Immunocorrelation analysis using Spearman correlation coefficient was used to determine the relationship between two variables. Experimental data were taken as mean ± standard deviation after three independent experiments, and paired samples were statistically analyzed using the paired t-test, with p ≤ 0.05 considered statistically significant.</p>
   </sec>
  </sec><sec id="s3">
   <title>3. Results</title>
   <sec id="s3_1">
    <title>3.1. Tissue-Specific Expression of LDH Family Members</title>
    <p>The study design is illustrated in <xref ref-type="fig" rid="fig1">
      Figure 1
     </xref>. Analysis of the Human Protein Atlas (HPA) database revealed distinct tissue distribution patterns for LDH family members (<xref ref-type="fig" rid="fig1">
      Figure 1
     </xref>). LDHA demonstrated predominant expression in retina, liver, and skeletal muscle, while LDHB showed significantly higher expression in midbrain, kidney, and cardiac muscle—tissues with high aerobic metabolic activity. Consistent with previous reports, both LDHAL6B and LDHC exhibited exclusive testicular distribution. LDHD was primarily expressed in liver, cardiac muscle, and skeletal muscle. These findings collectively demonstrate that LDH family members display tissue-specific expression patterns, with particular enrichment in organs exhibiting high oxygen consumption.</p>
   </sec>
   <sec id="s3_2">
    <title>3.2. Pan-Cancer mRNA Expression Profiling</title>
    <p>Our comprehensive analysis revealed cancer-type specific expression patterns for each LDH family member (<xref ref-type="fig" rid="fig2">
      Figure 2
     </xref>). LDHA was significantly upregulated in 14 cancer types including BRCA, CESC, and GBM, while being downregulated in KICH (<xref ref-type="fig" rid="fig2(A)">
      Figure 2(A)
     </xref>). LDHAL6A showed elevated expression in CHOL, LIHC and STAD tumors compared to 11 other cancer types where its expression was reduced (<xref ref-type="fig" rid="fig2(B)">
      Figure 2(B)
     </xref>). LDHAL6B expression was increased in GBM, HNSC, KIRC and STAD tumor tissues relative to their normal counterparts (<xref ref-type="fig" rid="fig2(C)">
      Figure 2(C)
     </xref>). LDHB exhibited upregulation in 8 cancer types including CHOL and LIHC, but downregulation in 6 others (<xref ref-type="fig" rid="fig2(D)">
      Figure 2(D)
     </xref>). LDHC was overexpressed in CESC, ESCA and HNSC tumors while being underexpressed in 5 cancer types (<xref ref-type="fig" rid="fig2(E)">
      Figure 2(E)
     </xref>). Notably, LDHD showed tumor-specific expression limited to KICH and LUAD, despite being widely expressed in normal tissues (<xref ref-type="fig" rid="fig2(F)">
      Figure 2(F)
     </xref>).</p>
    <fig id="fig1" position="float">
     <label>Figure 1</label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.147091-"></xref>Figure 1. General flow chart of the article.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2153483-rId27.jpeg?20251110014439" />
    </fig>
    <fig id="fig2" position="float">
     <label>Figure 2</label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.147091-"></xref>Figure 2. Expression analysis of LDH family in pan-cancer. (A) LDHA; (B) LDHAL6A; (C) LDHAL6B; (D) LDHB; (E) LDHC; (F) LDHD.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2153483-rId28.jpeg?20251110014439" />
    </fig>
   </sec>
   <sec id="s3_3">
    <title>3.3. Differential Expression in Cervical Cancer</title>
    <p>Comparative analysis between CESC and adjacent normal tissues yielded important findings (<xref ref-type="fig" rid="fig3">
      Figure 3
     </xref>). TCGA data revealed significant upregulation of LDHA and LDHC in tumor tissues, while LDHAL6B showed higher expression in normal tissue (<xref ref-type="fig" rid="fig3(A)-(F)">
      Figure 3(A)-(F)
     </xref>). External validation using GSE63514 dataset confirmed increased expression of LDHAL6A, LDHB and LDHC in tumors, with LDHD being more highly expressed in normal cervical tissue (<xref ref-type="fig" rid="fig3(G)-(L)">
      Figure 3(G)-(L)
     </xref>). PCR validation of clinical samples largely corroborated these findings, showing predominant tumor overexpression of most LDH members except for LDHAL6B and LDHD (<xref ref-type="fig" rid="fig3(A)-(F)">
      Figure 3(A)-(F)
     </xref>).</p>
    <fig id="fig3" position="float">
     <label>Figure 3</label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.147091-"></xref>Figure 3. Expression analysis of LDH gene family in cervical cancer. (A) - (F) Differential expression of LDH gene family members in the TCGA database. (G) - (L) Differential expression of LDH family members in the external validation GES63514.3.4. Some Common Mistakes.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2153483-rId29.jpeg?20251110014441" />
    </fig>
   </sec>
   <sec id="s3_4">
    <title>3.4. Diagnostic Potential in CESC</title>
    <p>ROC curve analysis demonstrated the diagnostic value of LDH family members in CESC. TCGA data revealed exceptional diagnostic performance for LDHC (AUC = 0.950, 95% CI: 0.921 - 0.980) and LDHA (AUC = 0.915, 95% CI: 0.766 - 1.000), with other members showing moderate diagnostic value (<xref ref-type="fig" rid="fig4(A)-(F)">
      Figure 4(A)-(F)
     </xref>). The GSE63514 validation cohort confirmed LDHC’s strong diagnostic potential (AUC = 0.884) (<xref ref-type="fig" rid="fig4(G)-(L)">
      Figure 4(G)-(L)
     </xref>). These consistent results across independent datasets highlight LDHC as the most promising diagnostic biomarker among LDH family members for cervical cancer.</p>
    <fig id="fig4" position="float">
     <label>Figure 4</label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.147091-"></xref>Figure 4. Diagnostic efficacy of LDH gene family in cervical cancer. (A) - (F) Diagnostic efficacy of LDH gene families in the TCGA database. (G) - (L) Diagnostic efficacy of LDH gene family members in the external validation dataset GES63514.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2153483-rId30.jpeg?20251110014443" />
    </fig>
   </sec>
   <sec id="s3_5">
    <title>3.5. Protein Expression Validation</title>
    <p>Immunohistochemical analysis from the HPA database provided protein-level confirmation of our findings. LDHA, LDHB and LDHD all showed significantly higher protein expression in CESC compared to normal cervical tissues (<xref ref-type="fig" rid="fig5(A)-(F)">
      Figure 5(A)-(F)
     </xref>). The remaining three LDH family members were not detectable in the database, suggesting potential tissue-specific expression limitations.</p>
    <fig id="fig5" position="float">
     <label>Figure 5</label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.147091-"></xref>Figure 5. Protein levels of LDH family in cervical cancer. (A) - (B) Protein expression levels of LDHA in normal cervical tissues and cervical cancer tissues, respectively; (C) - (D) Protein expression of LDHB in normal cervical tissues and cervical cancer, respectively.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2153483-rId31.jpeg?20251110014445" />
    </fig>
   </sec>
   <sec id="s3_6">
    <title>3.6. Prognostic Significance in CESC</title>
    <p>Survival analysis revealed important clinical correlations (<xref ref-type="fig" rid="fig6">
      Figure 6
     </xref>). High expression of LDHA and LDHAL6B was associated with worse overall survival (OS), while elevated LDHB, LDHC and LDHD correlated with better outcomes (<xref ref-type="fig" rid="fig6(A)-(F)">
      Figure 6(A)-(F)
     </xref>). Similar trends were observed for disease-specific survival (DSS) and progression-free interval (PFI), with LDHC-high patients showing particularly favorable prognosis (<xref ref-type="fig" rid="fig6(G)-(L)">
      Figure 6(G)-(L)
     </xref>, Supplementary <xref ref-type="fig" rid="fig4(A)-(F)">
      Figure 4(A)-(F)
     </xref>). External validation using GSE44001 dataset confirmed the adverse prognostic association of LDHA, LDHAL6A and LDHAL6B high expression (Supplementary<xref ref-type="fig" rid="fig4(G)-(L)">
      Figure 4(G)-(L)
     </xref>).</p>
    <fig id="fig6" position="float">
     <label>Figure 6</label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.147091-"></xref>Figure 6. Effect of LDH gene family on survival of cervical cancer patients. (A) - (F) Effect of LDH gene family members in the TCGA database on overall survival (OS) of cervical cancer patients. (G) - (L) Effect of LDH gene family members in the TCGA database on disease-specific survival (DSS) in cervical cancer patients.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2153483-rId32.jpeg?20251110014447" />
    </fig>
    <p>Cox regression analysis identified four genes (LDHA, LDHAL6B, LDHC, LDHD) as significant prognostic factors in univariate analysis. Multivariate analysis further established LDHAL6B as an independent prognostic marker for CESC patients.</p>
   </sec>
   <sec id="s3_7">
    <title>3.7. Mutation and Protein Interaction Networks of LDH Family Members</title>
    <p>Comprehensive analysis of mutation patterns in CESC using the cBioPortal database revealed distinct mutation frequencies among LDH family members: LDHA (0.9%), LDHAL6A (0.8%), LDHAL6B (1%), LDHB (2.2%), LDHC (1.1%), and LDHD (1.5%), with gene amplification being the predominant mutation type (<xref ref-type="fig" rid="fig7(A)-(B)">
      Figure 7(A)-(B)
     </xref>). Protein-protein interaction (PPI) networks constructed through GeneMANIA and STRING databases demonstrated extensive functional associations between LDH members and other proteins (<xref ref-type="fig" rid="fig7(C)-(D)">
      Figure 7(C)-(D)
     </xref>). Subsequent functional enrichment analysis revealed that interacting proteins were primarily involved in critical metabolic processes including dicarboxylic acid metabolism, lactate metabolism, pyruvate metabolism, and energy production (<xref ref-type="fig" rid="fig7(E)">
      Figure 7(E)
     </xref>). KEGG pathway analysis further identified significant enrichment in pyruvate metabolism, cysteine and methionine metabolism, carbon metabolism, glycolysis/gluconeogenesis, and propanoate metabolism (<xref ref-type="fig" rid="fig7(F)">
      Figure 7(F)
     </xref>), highlighting the central role of LDH family members in cellular metabolic regulation.</p>
   </sec>
   <sec id="s3_8">
    <title>3.8. DNA Methylation Patterns of LDH Family Members</title>
    <p>Methylation analysis using UALCAN database demonstrated significant epigenetic differences between CESC and normal cervical tissues (<xref ref-type="fig" rid="fig8(A)-(F)">
      Figure 8(A)-(F)
     </xref>). Notably, LDHB exhibited significantly higher methylation levels in tumor tissues, while LDHC showed marked hypomethylation. Correlation analysis between mRNA expression and methylation status revealed a significant negative association for LDHAL6A, LDHAL6B, LDHB, LDHC, and LDHD (<xref ref-type="fig" rid="fig8(G)-(L)">
      Figure 8(G)-(L)
     </xref>), suggesting potential epigenetic regulation of these genes in cervical carcinogenesis. No significant correlation was observed between LDHA expression and methylation status.</p>
   </sec>
   <sec id="s3_9">
    <title>3.9. Immune Microenvironment Associations of LDH Family Members</title>
    <p>Comprehensive immune correlation analysis revealed distinct patterns of association between LDH family expression and immune cell infiltration (<xref ref-type="fig" rid="fig9">
      Figure 9
     </xref>). LDHA expression showed positive correlation with Th2 cells and neutrophils, while demonstrating negative associations with multiple immune cell types including eosinophils, Tregs, and dendritic cells. LDHAL6A exhibited positive correlations with Thelper cells and Tcm, while LDHAL6B showed associations with Thelper cells and neutrophils. Particularly noteworthy was LDHC’s exclusive positive correlation with NK CD56bright cells and negative association with TFH cells and macrophages. Immune checkpoint analysis demonstrated significant correlations between LDH members and key checkpoint molecules (Supplementary<xref ref-type="fig" rid="fig2(A)-(F)">
      Figure 2(A)-(F)
     </xref>), with LDHD showing the most extensive interaction profile, including positive correlation with LMTK3 and negative associations with multiple checkpoints (CD274, PDCD1LG2, CTLA4, LAG3, and HAVCR2).</p>
    <fig id="fig7" position="float">
     <label>Figure 7</label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.147091-"></xref>Figure 7. Mutational features of LDH gene family members and protein interactions network. (A) - (B) Mutational features of LDH family member genes in cervical cancer were described using the cBioPortal database; (C) construction of LDH gene family member interactions networks based on the Gene MANIA database; (D) analysis of protein interactions networks of LDH family members based on the STRING database; (E) - (F) GO and KEGG enrichment analysis.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2153483-rId33.jpeg?20251110014451" />
    </fig>
    <fig id="fig8" position="float">
     <label>Figure 8</label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.147091-"></xref>Figure 8. Methylation analysis of LDH gene family members. (A) - (F) Analysis of methylation level differences between LDH gene family members in cervical cancer tissues and paracellular carcinomas based on the UALCAN database; (G) - (L) Correlation between gene expression and methylation levels of LDH gene family members analyzed using MethSurv database.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2153483-rId34.jpeg?20251110014452" />
    </fig>
    <fig id="fig9" position="float">
     <label>Figure 9</label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.147091-"></xref>Figure 9. Correlation analysis of LDH gene family members with the level of immune cell infiltration in cervical cancer patients. (A) LDHA; (B) LDHAL6A; (C) LDHAL6B; (D) LDHB; (E) LDHC; (F) LDHD.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2153483-rId35.jpeg?20251110014452" />
    </fig>
   </sec>
   <sec id="s3_10">
    <title>
     <xref ref-type="bibr" rid="scirp.147091-"></xref>3.10. Functional Enrichment Analysis of LDHC in CESC</title>
    <p>To elucidate LDHC’s functional role in CESC progression, we performed single-gene enrichment analysis after stratifying patients into high-(G1) and low-expression (G2) groups based on median LDHC expression. Differential expression analysis identified 264 significantly altered genes (226 upregulated, 38 downregulated) between the groups (<xref ref-type="fig" rid="fig10(A)-(B)">
      Figure 10(A)-(B)
     </xref>). KEGG pathway analysis of upregulated genes revealed enrichment in tyrosine metabolism, transcriptional misregulation in cancer, and sulfur metabolism pathways (<xref ref-type="fig" rid="fig10(C)">
      Figure 10(C)
     </xref>), while GO analysis highlighted involvement in developmental processes including ureteric bud development and sensory organ morphogenesis (<xref ref-type="fig" rid="fig10(D)">
      Figure 10(D)
     </xref>). Downregulated genes were significantly enriched in pathways including α-linolenic acid metabolism and small cell lung cancer (<xref ref-type="fig" rid="fig10(E)">
      Figure 10(E)
     </xref>), with GO terms related to immune regulation such as neutrophil migration and degranulation. These findings suggest LDHC may play multifaceted roles in both metabolic reprogramming and immune modulation during cervical cancer progression.</p>
   </sec>
   <sec id="s3_11">
    <title>3.11. Validation of LDH Gene Family Expression and Functional Characterization of LDHC in CESC</title>
    <p>To validate the expression patterns of LDH family members in cervical cancer, we analyzed clinical CESC specimens and adjacent normal tissues. Our results demonstrated significant upregulation of LDHA, LDHAL6A, LDHB and LDHC in tumor tissues, while LDHAL6B and LDHD showed marked downregulation (<xref ref-type="fig" rid="fig3">
      Figure 3
     </xref>). Given LDHC’s prominent diagnostic and prognostic value in CESC revealed by our preliminary analyses, coupled with the absence of prior functional studies, we selected this gene for further investigation using the Hela cell line. Successful knockdown of LDHC was confirmed at both transcriptional (qPCR) and translational (Western blot) levels (<xref ref-type="fig" rid="fig11(A)-(C)">
      Figure 11(A)-(C)
     </xref>). Functional assays revealed that LDHC depletion significantly enhanced the malignant phenotype of CESC cells. CCK-8 proliferation assays showed accelerated growth kinetics in LDHC-knockdown cells (<xref ref-type="fig" rid="fig11(D)">
      Figure 11(D)
     </xref>). This pro-tumorigenic effect was further supported by colony formation assays demonstrating increased proliferative capacity (<xref ref-type="fig" rid="fig12(A)">
      Figure 12(A)
     </xref>), wound healing assays revealing enhanced migratory potential (<xref ref-type="fig" rid="fig12(B)">
      Figure 12(B)
     </xref>), and Transwell experiments confirming greater invasive capability (<xref ref-type="fig" rid="fig13(A)-(B)">
      Figure 13(A)-(B)
     </xref>). Collectively, these findings position LDHC as a potential tumor suppressor in cervical carcinogenesis.</p>
   </sec>
  </sec><sec id="s4">
   <title>4. Discussion</title>
   <p>Our study provides the first comprehensive characterization of LDH family members in CESC, addressing a critical knowledge gap in the field. Through systematic analysis of expression patterns across normal and malignant tissues, we have identified distinct tissue-specific distributions: while LDHA, LDHB and LDHD exhibit ubiquitous expression, LDHAL6B and LDHC demonstrate testis-specific localization, consistent with their classification as testicular lactate dehydrogenase isoforms <xref ref-type="bibr" rid="scirp.147091-27">
     [27]
    </xref> <xref ref-type="bibr" rid="scirp.147091-28">
     [28]
    </xref>. Notably, pan-cancer analysis revealed consistent overexpression of multiple LDH members in CESC and other malignancies, suggesting their potential as diagnostic biomarkers.</p>
   <fig id="fig10" position="float">
    <label>Figure 10</label>
    <caption>
     <title>
      <xref ref-type="bibr" rid="scirp.147091-"></xref>Figure 10. Single-gene pathway enrichment analysis of LDHC. (A) Differentially expressed genes (DEGs) in the LDHC high and low expression groups demonstrated by volcano plots; (B) Expression levels of LDHC high and low groups demonstrated by heatmaps; (C) KEGG pathway enrichment analysis of up-regulated genes; (D) GO pathway enrichment analysis of up-regulated genes; (E) KEGG pathway enrichment analysis of down-regulated genes; (F) GO pathway enrichment analysis of down-regulated genes.</title>
    </caption>
    <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2153483-rId36.jpeg?20251110014456" />
   </fig>
   <fig id="fig11" position="float">
    <label>Figure 11</label>
    <caption>
     <title>
      <xref ref-type="bibr" rid="scirp.147091-"></xref>Figure 11. Construction of LDHC knockdown cell lines and the effect of LDHC knockdown on the proliferative ability of cervical cancer cells. (A) Verification of protein expression level differences between LDHC knockdown cell groups and wild cell lines by WB assay; (B) Quantitative analysis of protein levels after LDHC knockdown; (C) Verification of mRNA expression level changes after LDHC knockdown by RT-qPCR assay; (D) CCK8 proliferation assay of Cell.</title>
    </caption>
    <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2153483-rId37.jpeg?20251110014456" />
   </fig>
   <fig id="fig12" position="float">
    <label>Figure 12</label>
    <caption>
     <title>
      <xref ref-type="bibr" rid="scirp.147091-"></xref>Figure 12. Effect of LDHC knockdown on proliferation and healing ability of cervical cancer cells. (A) cell clone formation experiment; (B) cell scratch healing experiment.</title>
    </caption>
    <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2153483-rId38.jpeg?20251110014455" />
   </fig>
   <fig id="fig13" position="float">
    <label>Figure 13</label>
    <caption>
     <title>
      <xref ref-type="bibr" rid="scirp.147091-"></xref>Figure 13. Effect of LDH knockdown on the migration and invasion ability of cervical cancer cells. (A) cell migration assay; (B) cell invasion assay.</title>
    </caption>
    <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/2153483-rId39.jpeg?20251110014455" />
   </fig>
   <p>The prognostic significance of LDH family members in CESC appears complex. While most members (LDHA, LDHB) correlate with poor outcomes when overexpressed, potentially through mechanisms like JNK-mediated apoptosis <xref ref-type="bibr" rid="scirp.147091-29">
     [29]
    </xref> or cis-platin resistance <xref ref-type="bibr" rid="scirp.147091-15">
     [15]
    </xref>, LDHC presents a striking exception. LDHC demonstrates marked tissue-specific expression, suggesting its potential involvement in cervical carcinogenesis through distinct molecular regulatory mechanisms. Our clinical da-ta associate high LDHC expression with improved survival, a finding corroborated by functional studies showing that LDHC knockdown enhances proliferation, migration and invasion in Hela cells. Furthermore, our immune infiltration analysis revealed specific correlations between LDHC and antitumor immune cells, particularly NK CD56bright cells. This tumor-suppressive role contrasts with the onco-genic functions reported for other LDH isoforms and warrants further investigation to elucidate the underlying molecular mechanisms.</p>
   <p>These findings have important implications for understanding cervical cancer pathogenesis and developing targeted therapies. The differential effects of LDH family members suggest that therapeutic strategies may need to be isoform-specific, particularly given LDHC’s unique protective role. Future studies should explore whether LDHC’s antitumor effects involve metabolic reprogramming or interactions with specific signaling pathways in cervical epithelial cells.</p>
   <p>Our comprehensive mutation analysis revealed that LDH family members exhibit high mutation frequencies across various cancers, with amplification being the predominant mutation type. Notably, in Group 3 medulloblastoma, LDHA expression positively correlates with MYC amplification, suggesting LDHA inhibition as a potential therapeutic strategy <xref ref-type="bibr" rid="scirp.147091-30">
     [30]
    </xref>. Similarly, LDHB overexpression associates with KRAS copy number increases and mutations in lung cancer <xref ref-type="bibr" rid="scirp.147091-31">
     [31]
    </xref>. These findings collectively indicate that amplification-driven overexpression of LDH isoforms may serve as important oncogenic drivers and potential therapeutic targets.</p>
   <p>Protein interaction network analysis demonstrated significant functional connections among LDH family members, with GO and KEGG enrichment analyses highlighting their involvement in key metabolic processes including lactate metabolism, pyruvate metabolism, and glycolysis/gluconeogenesis. These pathways play crucial roles in tumor biology, where pyruvate metabolism fuels cellular energy demands while lactate accumulation in the tumor microenvironment promotes immune evasion and supports malignant progression <xref ref-type="bibr" rid="scirp.147091-32">
     [32]
    </xref>. Our results suggest that LDH-mediated metabolic reprogramming may significantly contribute to CESC pathogenesis.</p>
   <p>DNA methylation analysis revealed distinct epigenetic patterns among LDH isoforms in CESC. We observed hypermethylation of LDHB contrasting with hypomethylation of LDHC, both showing significant negative correlations with their respective expression levels. This finding aligns with existing literature demonstrating that LDHA promotes HPV16 expression through H3K79 methylation <xref ref-type="bibr" rid="scirp.147091-33">
     [33]
    </xref>, while LDHB promoter methylation suppresses its tumor-suppressive function in breast and liver cancers <xref ref-type="bibr" rid="scirp.147091-31">
     [31]
    </xref> <xref ref-type="bibr" rid="scirp.147091-34">
     [34]
    </xref>. Interestingly, LDHC’s demethylation pattern mirrors its testis-specific expression profile <xref ref-type="bibr" rid="scirp.147091-35">
     [35]
    </xref>, supporting our hypothesis that methylation status regulates LDH isoform expression in tissue-specific manners. While direct evidence linking all LDH members to CESC remains limited, our findings strongly suggest that differential methylation contributes to tumorigenesis through metabolic pathway modulation.</p>
   <p>Our immune correlation analysis uncovered complex relationships between LDH family members and tumor immunology. High LDHA expression correlated with poor patient survival, consistent with reports that LDHA-derived lactate accumulation impairs T cell and NK cell function in melanoma <xref ref-type="bibr" rid="scirp.147091-36">
     [36]
    </xref>. Similarly, LDH-related genes may promote CESC progression by activating M2 macrophages and inhibiting dendritic cell activation <xref ref-type="bibr" rid="scirp.147091-37">
     [37]
    </xref>. Immune checkpoint analysis revealed significant associations between LDH isoforms and key regulators including CTLA-4, PD-1, and PD-L1, which are critical targets for cancer immunotherapy <xref ref-type="bibr" rid="scirp.147091-38">
     [38]
    </xref> <xref ref-type="bibr" rid="scirp.147091-39">
     [39]
    </xref>. Notably, dual blockade of PD-L1 and LAG3 demonstrates enhanced anti-tumor efficacy <xref ref-type="bibr" rid="scirp.147091-40">
     [40]
    </xref>, suggesting potential combination strategies for CESC treatment.</p>
   <p>Single-gene enrichment analysis implicated LDHC in the IL-17 signaling pathway, which plays established roles in inflammation and tumorigenesis <xref ref-type="bibr" rid="scirp.147091-41">
     [41]
    </xref>. While glycolytic genes typically promote tumor progression through IL-17 pathway activation <xref ref-type="bibr" rid="scirp.147091-42">
     [42]
    </xref>, our functional studies revealed LDHC's unexpected protective role in CESC. Knockout experiments demonstrated that LDHC depletion enhances tumor cell proliferation, migration, and invasion—a novel finding that challenges conventional understanding of LDH family functions. Although limited by the absence of in vivo validation and clinical sample constraints, these results position LDHC as a potential tumor suppressor in cervical carcinogenesis.</p>
   <p>Our findings regarding the tumor-suppressive role of LDHC in CESC underscore the significant impact of the LDH family in the pathogenesis of gynecologic malignancies. This observation aligns with recent studies emphasizing the critical and distinct functions of LDH isoforms. For instance, LDHB has been demonstrated to contribute to immune evasion in ovarian cancer cells <xref ref-type="bibr" rid="scirp.147091-37">
     [37]
    </xref>, whereas LDHA plays a contrasting role in promoting the survival and proliferation of cervical cancer cells under energy stress conditions <xref ref-type="bibr" rid="scirp.147091-43">
     [43]
    </xref>. These collective findings indicate that the functional roles of the LDH family warrant further investigation. Future work should aim to elucidate whether the protective effect of LDHC is specific to the pathogenesis of CESC or represents a broader, previously unrecognized tumor-suppressive pathway in other gynecologic malignancies.</p>
  </sec><sec id="s5">
   <title>5. Conclusion</title>
   <p>Our study establishes LDHC as a clinically significant biomarker in CESC, with high expression correlating with favorable outcomes. Functional characterization revealed its unique tumor-suppressive properties, as evidenced by enhanced malignant phenotypes following gene knockout. These findings provide novel insights into LDH family biology and suggest LDHC as a potential therapeutic target for cervical cancer management.</p>
  </sec><sec id="s6">
   <title>Acknowledgements</title>
   <p>We appreciate the valuable suggestions from our colleagues on manuscript revision.</p>
  </sec><sec id="s7">
   <title>Author Contributions</title>
   <p>
    <xref ref-type="bibr" rid="scirp.147091-"></xref>Professor Dong and Professor Liao are responsible for the research design and writing guidance, while SX mainly participates in the experiment. SX and XZ are mainly involved in cell culture and statistical analysis. YH participated in the initial draft drafting and bioinformatics analysis. YL and ZX provide guidance for the experiment. All authors have made significant contributions to this article and have approved its submission.</p>
  </sec><sec id="s8">
   <title>Ethics Statement</title>
   <p>The research pertaining to human tissues underwent a thorough examination and received approval from the Institutional Research Ethics Committee of Affiliated Hospital of Youjiang Medical University for Nationalities (Ethical review number: YYFY-LL-2023-145).</p>
  </sec><sec id="s9">
   <title>Funding</title>
   <p>
    <xref ref-type="bibr" rid="scirp.147091-"></xref>Funded by the Youth Fund Program of the Guangxi Natural Science Foundation (2023JJB140064) and the Project of Baise Scientific Research and Technology Development Plan in 2024 (Grant No. 20250321, 20250315).</p>
  </sec><sec id="s10">
   <title>Data Availability Statement</title>
   <p>The data underlying in this study are freely available from the TCGA, GEO, GTEx, GeneMANIA, STRING, Xiantao Academic, Home for Researchers, and HPA databases. All the original findings shown within the investigation are involved in the article/Supplementary Material. Regarding clinical trial number: Not applicable.</p>
  </sec>
 </body><back>
  <ref-list>
   <title>References</title>
   <ref id="scirp.147091-ref1">
    <label>1</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Buskwofie, A., David-West, G. and Clare, C.A. (2020) A Review of Cervical Cancer: Incidence and Disparities. Journal of the National Medical Association, 112, 229-232. &gt;https://doi.org/10.1016/j.jnma.2020.03.002 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref2">
    <label>2</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Bosch, F.X., Lorincz, A., Munoz, N., Meijer, C.J.L.M. and Shah, K.V. (2002) The Causal Relation between Human Papillomavirus and Cervical Cancer. Journal of Clinical Pathology, 55, 244-265. &gt;https://doi.org/10.1136/jcp.55.4.244 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref3">
    <label>3</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Pujade-Lauraine, E. (2014) Editorial. International Journal of Gynecological Cancer, 24, S1. &gt;https://doi.org/10.1097/igc.0000000000000266 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref4">
    <label>4</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Cibula, D., Pötter, R., Planchamp, F., Avall-Lundqvist, E., Fischerova, D., Haie Meder, C., et al. (2018) The European Society of Gynaecological Oncology/European Society for Radiotherapy and Oncology/European Society of Pathology Guidelines for the Management of Patients with Cervical Cancer. Radiotherapy and Oncology, 127, 404-416. &gt;https://doi.org/10.1016/j.radonc.2018.03.003 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref5">
    <label>5</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Chargari, C., Peignaux, K., Escande, A., Renard, S., Lafond, C., Petit, A., et al. (2022) Radiotherapy of Cervical Cancer. Cancer/Radiothérapie, 26, 298-308. &gt;https://doi.org/10.1016/j.canrad.2021.11.009 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref6">
    <label>6</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Chiva, L., Zanagnolo, V., Querleu, D., Martin-Calvo, N., Arévalo-Serrano, J., Căpîlna, M.E., et al. (2020) SUCCOR Study: An International European Cohort Observational Study Comparing Minimally Invasive Surgery versus Open Abdominal Radical Hysterectomy in Patients with Stage IB1 Cervical Cancer. International Journal of Gynecological Cancer, 30, 1269-1277. &gt;https://doi.org/10.1136/ijgc-2020-001506 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref7">
    <label>7</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Small, W., Bacon, M.A., Bajaj, A., Chuang, L.T., Fisher, B.J., Harkenrider, M.M., et al. (2017) Cervical Cancer: A Global Health Crisis. Cancer, 123, 2404-2412. &gt;https://doi.org/10.1002/cncr.30667 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref8">
    <label>8</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Ferrall, L., Lin, K.Y., Roden, R.B.S., et al. (2021) Cervical Cancer Immunotherapy: Facts and Hopes. Clinical Cancer Research, 27, 4953-4973. &gt;https://doi.org/10.1158/1078-0432.ccr-20-2833 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref9">
    <label>9</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Sharma, S., Deep, A. and Sharma, A.K. (2020) Current Treatment for Cervical Cancer: An Update. Anti-Cancer Agents in Medicinal Chemistry, 20, 1768-1779. &gt;https://doi.org/10.2174/1871520620666200224093301 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref10">
    <label>10</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Akram, M. (2013) Mini-Review on Glycolysis and Cancer. Journal of Cancer Education, 28, 454-457. &gt;https://doi.org/10.1007/s13187-013-0486-9
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref11">
    <label>11</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Krieg, A.F., Rosenblum, L.J. and Henry, J.B. (1967) Lactate Dehydrogenase Isoenzymes—A Comparison of Pyruvate-to-Lactate and Lactate-to-Pyruvate Assays. Clinical Chemistry, 13, 196-203.
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref12">
    <label>12</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Kim, J.W., Tchernyshyov, I., Semenza, G.L., et al. (2006) HIF-1-Mediated Expression of Pyruvate Dehydrogenase Kinase: A Metabolic Switch Required for Cellular Adaptation to Hypoxia. Cell Metabolism, 3, 177-185. &gt;https://doi.org/10.1016/j.cmet.2006.02.002
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref13">
    <label>13</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Pathria, G., Scott, D.A., Feng, Y., Sang Lee, J., Fujita, Y., Zhang, G., et al. (2018) Targeting the Warburg Effect via LDHA Inhibition Engages ATF 4 Signaling for Cancer Cell Survival. The EMBO Journal, 37, e99735. &gt;https://doi.org/10.15252/embj.201899735 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref14">
    <label>14</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Oyama, Y., Miyata, H., Shimada, K., Fujihara, Y., Tokuhiro, K., Garcia, T.X., et al. (2022) CRISPR/Cas9-Mediated Genome Editing Reveals 12 Testis-Enriched Genes Dispensable for Male Fertility in Mice. Asian Journal of Andrology, 24, 266-272. &gt;https://doi.org/10.4103/aja.aja_63_21 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref15">
    <label>15</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Wang, S., Xie, J., Li, J., et al. (2016) Cisplatin Suppresses the Growth and Proliferation of Breast and Cervical Squamous Cell Carcinoma Cell Lines by Inhibiting Integrin β5-Mediated Glycolysis. American Journal of Cancer Research, 6, 1108-1117.
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref16">
    <label>16</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Omolaoye, T.S., Omolaoye, V.A., Kandasamy, R.K., Hachim, M.Y. and Du Plessis, S.S. (2022) Omics and Male Infertility: Highlighting the Application of Transcriptomic Data. Life, 12, Article 280. &gt;https://doi.org/10.3390/life12020280 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref17">
    <label>17</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Wang, Y., Li, G., Wan, F., Dai, B. and Ye, D. (2018) Prognostic Value of D‑lactate Dehydrogenase in Patients with Clear Cell Renal Cell Carcinoma. Oncology Letters, 16, 866-874. &gt;https://doi.org/10.3892/ol.2018.8782 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref18">
    <label>18</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Lyu, M., Gong, Y., Liu, X., Wang, Y., Wu, Q., Chen, J., et al. (2023) CDK7-YAP-LDHD Axis Promotes D-Lactate Elimination and Ferroptosis Defense to Support Cancer Stem Cell-Like Properties. Signal Transduction and Targeted Therapy, 8, Article No. 302. &gt;https://doi.org/10.1038/s41392-023-01555-9 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref19">
    <label>19</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Tomczak, K., Czerwińska, P. and Wiznerowicz, M. (2015) Review the Cancer Genome Atlas (TCGA): An Immeasurable Source of Knowledge. Współczesna Onkologia, 1, 68-77. &gt;https://doi.org/10.5114/wo.2014.47136 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref20">
    <label>20</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Saluja, R., Cheng, S., delos Santos, K.A. and Chan, K.K.W. (2019) Estimating Hazard Ratios from Published Kaplan-Meier Survival Curves: A Methods Validation Study. Research Synthesis Methods, 10, 465-475. &gt;https://doi.org/10.1002/jrsm.1362 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref21">
    <label>21</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Gao, J., Aksoy, B.A., Dogrusoz, U., Dresdner, G., Gross, B., Sumer, S.O., et al. (2013) Integrative Analysis of Complex Cancer Genomics and Clinical Profiles Using the Cbioportal. Science Signaling, 6, 11. &gt;https://doi.org/10.1126/scisignal.2004088 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref22">
    <label>22</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Warde-Farley, D., Donaldson, S.L., Comes, O., Zuberi, K., Badrawi, R., Chao, P., et al. (2010) The Gene MANIA Prediction Server: Biological Network Integration for Gene Prioritization and Predicting Gene Function. Nucleic Acids Research, 38, W214-W220. &gt;https://doi.org/10.1093/nar/gkq537 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref23">
    <label>23</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Rath, S., Sharma, R., Gupta, R., Ast, T., Chan, C., Durham, T.J., et al. (2021) Mitocarta3.0: An Updated Mitochondrial Proteome Now with Sub-Organelle Localization and Pathway Annotations. Nucleic Acids Research, 49, D1541-D1547. &gt;https://doi.org/10.1093/nar/gkaa1011 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref24">
    <label>24</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Chandrashekar, D.S., Karthikeyan, S.K., Korla, P.K., Patel, H., Shovon, A.R., Athar, M., et al. (2022) UALCAN: An Update to the Integrated Cancer Data Analysis Platform. Neoplasia, 25, 18-27. &gt;https://doi.org/10.1016/j.neo.2022.01.001 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref25">
    <label>25</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Chandrashekar, D.S., Bashel, B., Balasubramanya, S.A.H., Creighton, C.J., Ponce-Rodriguez, I., Chakravarthi, B.V.S.K., et al. (2017) UALCAN: A Portal for Facilitating Tumor Subgroup Gene Expression and Survival Analyses. Neoplasia, 19, 649-658. &gt;https://doi.org/10.1016/j.neo.2017.05.002 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref26">
    <label>26</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Liu, C.J., Hu, F.F., Xia, M.X., et al. (2018) GSCA Lite: A Web Server for Gene Set Cancer Analysis. Bioinformatics, 34, 3771-3772.
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref27">
    <label>27</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Goldberg, E., Eddy, E.M., Duan, C. and Odet, F. (2010) LDHC: The Ultimate Testis-Specific Gene. Journal of Andrology, 31, 86-94. &gt;https://doi.org/10.2164/jandrol.109.008367 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref28">
    <label>28</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Kong, L., Du, W., Cui, Z., Wang, L., Yang, Z., Zhang, H., et al. (2016) Expression of Lactate Dehydrogenase C in MDA-MB-231 Cells and Its Role in Tumor Invasion and Migration. Molecular Medicine Reports, 13, 3533-3538. &gt;https://doi.org/10.3892/mmr.2016.4963 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref29">
    <label>29</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zhang, W., Wang, C., Hu, X., Lian, Y., Ding, C. and Ming, L. (2022) Inhibition of LDHA Suppresses Cell Proliferation and Increases Mitochondrial Apoptosis via the JNK Signaling Pathway in Cervical Cancer Cells. Oncology Reports, 47, Article No. 77. &gt;https://doi.org/10.3892/or.2022.8288 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref30">
    <label>30</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Tao, R., Murad, N., Xu, Z., Zhang, P., Okonechnikov, K., Kool, M., et al. (2019) MYC Drives Group 3 Medulloblastoma through Transformation of Sox2+ Astrocyte Progenitor Cells. Cancer Research, 79, 1967-1980. &gt;https://doi.org/10.1158/0008-5472.can-18-1787 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref31">
    <label>31</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     McCleland, M.L., Adler, A.S., Deming, L., Cosino, E., Lee, L., Blackwood, E.M., et al. (2013) Lactate Dehydrogenase B Is Required for the Growth of Kras-Dependent Lung Adenocarcinomas. Clinical Cancer Research, 19, 773-784. &gt;https://doi.org/10.1158/1078-0432.ccr-12-2638 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref32">
    <label>32</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Liberti, M.V. and Locasale, J.W. (2016) The Warburg Effect: How Does It Benefit Cancer Cells? Trends in Biochemical Sciences, 41, 211-218. &gt;https://doi.org/10.1016/j.tibs.2015.12.001 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref33">
    <label>33</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Liu, Y., Guo, J., Liu, Y., Wang, K., Ding, W., Wang, H., et al. (2018) Nuclear Lactate Dehydrogenase a Senses ROS to Produce α-Hydroxybutyrate for HPV-Induced Cervical Tumor Growth. Nature Communications, 9, Article No. 4429. &gt;https://doi.org/10.1038/s41467-018-06841-7 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref34">
    <label>34</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Revill, K., Wang, T., Lachenmayer, A., Kojima, K., Harrington, A., Li, J., et al. (2013) Genome-wide Methylation Analysis and Epigenetic Unmasking Identify Tumor Suppressor Genes in Hepatocellular Carcinoma. Gastroenterology, 145, 1424-1435.e25. &gt;https://doi.org/10.1053/j.gastro.2013.08.055 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref35">
    <label>35</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zhou, C., Zhang, L., Xu, D., Ding, H., Zheng, S. and Liu, M. (2022) MeDIP-Seq and RNA-Seq Analysis during Porcine Testis Development Reveals Functional DMR at the Promoter of LDHC. Genomics, 114, Article 110467. &gt;https://doi.org/10.1016/j.ygeno.2022.110467 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref36">
    <label>36</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Brand, A., Singer, K., Koehl, G.E., Kolitzus, M., Schoenhammer, G., Thiel, A., et al. (2016) LDHA-Associated Lactic Acid Production Blunts Tumor Immunosurveillance by T and NK Cells. Cell Metabolism, 24, 657-671. &gt;https://doi.org/10.1016/j.cmet.2016.08.011 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref37">
    <label>37</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Yang, X., Zhang, W. and Zhu, W. (2023) Profiling of Immune Responses by Lactate Modulation in Cervical Cancer Reveals Key Features Driving Clinical Outcome. Heliyon, 9, e14896. &gt;https://doi.org/10.1016/j.heliyon.2023.e14896 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref38">
    <label>38</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zou, W., Wolchok, J.D. and Chen, L. (2016) PD-L1 (B7-H1) and PD-1 Pathway Blockade for Cancer Therapy: Mechanisms, Response Biomarkers, and Combinations. Science Translational Medicine, 8, 328rv4. &gt;https://doi.org/10.1126/scitranslmed.aad7118 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref39">
    <label>39</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Howitt, B.E., Sun, H.H., Roemer, M.G.M., Kelley, A., Chapuy, B., Aviki, E., et al. (2016) Genetic Basis for PD-L1 Expression in Squamous Cell Carcinomas of the Cervix and Vulva. JAMA Oncology, 2, 518-522. &gt;https://doi.org/10.1001/jamaoncol.2015.6326
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref40">
    <label>40</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Shi, A., Tang, X., Xiong, Y., Zheng, K., Liu, Y., Shi, X., et al. (2021) Immune Checkpoint LAG3 and Its Ligand FGL1 in Cancer. Frontiers in Immunology, 12, Article 785091. &gt;https://doi.org/10.3389/fimmu.2021.785091
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref41">
    <label>41</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Li, X., Bechara, R., Zhao, J., McGeachy, M.J. and Gaffen, S.L. (2019) IL-17 Receptor–based Signaling and Implications for Disease. Nature Immunology, 20, 1594-1602. &gt;https://doi.org/10.1038/s41590-019-0514-y 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref42">
    <label>42</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Li, W., Xu, M., Li, Y., Huang, Z., Zhou, J., Zhao, Q., et al. (2020) Comprehensive Analysis of the Association between Tumor Glycolysis and Immune/Inflammation Function in Breast Cancer. Journal of Translational Medicine, 18, Article No. 92. &gt;https://doi.org/10.1186/s12967-020-02267-2 
    </mixed-citation>
   </ref>
   <ref id="scirp.147091-ref43">
    <label>43</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Jia, C., Wu, Y., Gao, F., Liu, W., Li, N., Chen, Y., et al. (2024) The Opposite Role of Lactate Dehydrogenase a (LDHA) in Cervical Cancer under Energy Stress Conditions. Free Radical Biology and Medicine, 214, 2-18. &gt;https://doi.org/10.1016/j.freeradbiomed.2024.01.043
    </mixed-citation>
   </ref>
  </ref-list>
 </back>
</article>