<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article">
 <front>
  <journal-meta>
   <journal-id journal-id-type="publisher-id">
    jbise
   </journal-id>
   <journal-title-group>
    <journal-title>
     Journal of Biomedical Science and Engineering
    </journal-title>
   </journal-title-group>
   <issn pub-type="epub">
    1937-6871
   </issn>
   <issn publication-format="print">
    1937-688X
   </issn>
   <publisher>
    <publisher-name>
     Scientific Research Publishing
    </publisher-name>
   </publisher>
  </journal-meta>
  <article-meta>
   <article-id pub-id-type="doi">
    10.4236/jbise.2025.1810032
   </article-id>
   <article-id pub-id-type="publisher-id">
    jbise-146846
   </article-id>
   <article-categories>
    <subj-group subj-group-type="heading">
     <subject>
      Articles
     </subject>
    </subj-group>
    <subj-group subj-group-type="Discipline-v2">
     <subject>
      Biomedical 
     </subject>
     <subject>
       Life Sciences
     </subject>
    </subj-group>
   </article-categories>
   <title-group>
    Study of the Relationship between the Presence of the Pfcrt 76T Mutation and the Therapeutic Efficacy of the Artesunate-Amodiaquine Combination in the Treatment of Uncomplicated Plasmodium falciparum Malaria in Burkina Faso 
   </title-group>
   <contrib-group>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Mahamat Hassan
      </surname>
      <given-names>
       Abdel-Aziz
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref> 
     <xref ref-type="aff" rid="aff2"> 
      <sup>2</sup>
     </xref> 
     <xref ref-type="aff" rid="aff3"> 
      <sup>3</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Ali Barka
      </surname>
      <given-names>
       Mahamat
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Abdoulaye
      </surname>
      <given-names>
       Brahim
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref> 
     <xref ref-type="aff" rid="aff4"> 
      <sup>4</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Mahamat Ibet
      </surname>
      <given-names>
       Chaib
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff1"> 
      <sup>1</sup>
     </xref>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Djamaladine Mahamat
      </surname>
      <given-names>
       Doungous
      </given-names>
     </name> 
     <xref ref-type="aff" rid="aff4"> 
      <sup>4</sup>
     </xref>
    </contrib>
   </contrib-group> 
   <aff id="aff1">
    <addr-line>
     aDepartment of Biomedical and Pharmaceutical Sciences, National Higher Institute of Science and Technology of Abeche, Abeche, Chad
    </addr-line> 
   </aff> 
   <aff id="aff2">
    <addr-line>
     aDepartment of Parasitology and Ecology, University of Yaoundé, Yaoundé, Cameroon
    </addr-line> 
   </aff> 
   <aff id="aff3">
    <addr-line>
     aDepartment of Medical Parasitology and Mycology of the Health and Human Sciences, University of N’Djamena, N’Djamena, Chad
    </addr-line> 
   </aff> 
   <aff id="aff4">
    <addr-line>
     aDepartment of Biological Sciences, Faculty of Science, University of Ngaoundéré, Ngaoundéré, Cameroon
    </addr-line> 
   </aff> 
   <pub-date pub-type="epub">
    <day>
     29
    </day> 
    <month>
     10
    </month>
    <year>
     2025
    </year>
   </pub-date> 
   <volume>
    18
   </volume> 
   <issue>
    10
   </issue>
   <fpage>
    447
   </fpage>
   <lpage>
    461
   </lpage>
   <permissions>
    <copyright-statement>
     © Copyright 2014 by authors and Scientific Research Publishing Inc. 
    </copyright-statement>
    <copyright-year>
     2014
    </copyright-year>
    <license>
     <license-p>
      This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/
     </license-p>
    </license>
   </permissions>
   <abstract>
    The emergence and development of resistance of Plasmodium falciparum to antimalariques commonly used (chloroquine, sulfadoxine-pyrimethamine) led to the adoption of combinations based on artemisinin including artesunate amodiaquine, which has shown a good therapeutic efficacy in areas where amodiaquine monotherapy remains effective. The genetic mutation Pfcrt 76T has been validated as a marker that confers resistance to chloroquine. So far, there is no known marker associated with resistance to artesunate. Because of the structural similarity of amodiaquine with chloroquine, it is interesting to investigate the existence of an association between the presence of point mutation Pfcrt 76T and effectiveness of the association for artesunate amodiaquine, better monitoring of the development of resistance to ACT (Artemisinin-based Combination Therapies). We conducted a randomized clinical trial opened in two rural sites in Burkina Faso (Dande and Gourcy) during which we assessed the therapeutic efficacy of artesunate-amodiaquine and artemether-lumefantrine in patients with uncomplicated malaria and monitored them for 28 days. The study of polymorphism parasitic PCR has helped distinguish new infections from recrudescences (Real failures). In total, 47 patients were treated with artesunate and amodiaquine and included in this study. The cumulative treatment failure (clinical and parasitological) was 14.89% (7/47). The study of parasitic polymorphism showed 12.77% (6/47) cases of recrudescence (real failure). A total 48.94% of patients were carriers of the mutation Pfcrt 76T before treatment and 66.67% among recrudescences. In Burkina Faso, artesunate-amodiaquine is still effective; there was no association of the point mutation Pfcrt 76T with clinical outcomes of the patients treated with artesunate-amodiaquine. Other point mutations may be investigated to help with these drugs’ failure prediction.
   </abstract>
   <kwd-group> 
    <kwd>
     Parasitic
    </kwd> 
    <kwd>
      Resistance
    </kwd> 
    <kwd>
      Recrudescences
    </kwd> 
    <kwd>
      Polymorphism
    </kwd> 
    <kwd>
      Chloroquine
    </kwd> 
    <kwd>
      Mutation
    </kwd>
   </kwd-group>
  </article-meta>
 </front>
 <body>
  <sec id="s1">
   <title>1. Introduction</title>
   <p>Malaria is a parasitic disease caused by protozoa of the genus Plasmodium, transmitted to humans by the bite of infected female mosquitoes of the genus Anopheles. Despite major advances in prevention and treatment, malaria continues to be, alongside AIDS and tuberculosis, one of the deadliest infectious diseases worldwide. According to the World Health Organization [<xref ref-type="bibr" rid="scirp.146846-1">
     1
    </xref>], Plasmodium falciparum alone is responsible for an estimated 2.7 million deaths annually, of which 80% - 90% occur in sub-Saharan Africa. The most vulnerable populations are children under five years of age and pregnant women.</p>
   <p>In Burkina Faso, malaria remains the leading cause of morbidity and mortality. In 2005, it accounted for 35.12% of medical consultations, 40.83% of hospitalisations, and 37.5% of deaths. The burden is especially heavy among children under five, who represented 44.86% of consultations, 54.94% of hospitalisations, and 57.29% of deaths related to malaria [<xref ref-type="bibr" rid="scirp.146846-2">
     2
    </xref>].</p>
   <p>A major factor contributing to the persistence of high malaria mortality is the emergence and spread of drug resistance. Since the late 1950s, P. falciparum has developed resistance to several first-line antimalarial drugs, notably chloroquine and sulfadoxine-pyrimethamine [<xref ref-type="bibr" rid="scirp.146846-3">
     3
    </xref>-<xref ref-type="bibr" rid="scirp.146846-5">
     5
    </xref>]. Molecular studies have shown that mutations in specific parasite genes are associated with resistance. For example, mutations in the Pfcrt gene are linked to chloroquine resistance [<xref ref-type="bibr" rid="scirp.146846-6">
     6
    </xref>], while those in Pfdhfr confer resistance to sulfadoxine-pyrimethamine [<xref ref-type="bibr" rid="scirp.146846-7">
     7
    </xref>]. The Pfcrt-K76T and Pfmdr1-N86Y polymorphisms, in particular, are considered reliable markers of chloroquine resistance.</p>
   <p>Amodiaquine, although chemically related to chloroquine, does not share the same resistance mechanisms. The presence of the Pfcrt-K76T and Pfmdr1-N86Y mutations is not an absolute requirement for the development of resistance to amodiaquine [<xref ref-type="bibr" rid="scirp.146846-8">
     8
    </xref>]. As a result, amodiaquine remains effective in many endemic regions and is widely used because of its affordability, good tolerability, and efficacy against some chloroquine-resistant strains [<xref ref-type="bibr" rid="scirp.146846-9">
     9
    </xref>-<xref ref-type="bibr" rid="scirp.146846-12">
     12
    </xref>]. For these reasons, it has been combined with artemisinin derivatives as part of Artemisinin-based Combination Therapies (ACTs).</p>
   <p>Despite its widespread use, no validated molecular markers have yet been identified that predict P. falciparum resistance to the artesunate-amodiaquine combination. Understanding the genetic basis of therapeutic failures is therefore a critical priority for malaria control programs.</p>
   <p>Problem Statement</p>
   <p>Malaria continues to be a major public health challenge in Burkina Faso, particularly among children under five years of age. The widespread emergence of drug-resistant P. falciparum strains has significantly limited the effectiveness of many conventional antimalarial treatments. Although the artesunate–amodiaquine combination remains an important component of national treatment strategies, the lack of reliable molecular markers to predict treatment failure hampers efforts to monitor and control resistance. The Pfcrt 76T mutation has been strongly associated with chloroquine resistance, but its role in amodiaquine and artesunate-amodiaquine resistance remains unclear. Investigating the relationship between this genetic marker and in vivo therapeutic outcomes may provide valuable insights into the mechanisms of resistance and contribute to improved malaria management in Burkina Faso.</p>
   <sec id="s1_1">
    <title>Objectives</title>
    <p>The present study aims to evaluate the relationship between the Pfcrt 76T mutation and treatment outcomes in patients receiving the artesunate-amodiaquine combination. Specifically, the objectives are to:</p>
    <sec id="s1">
     <title>2. MATERIAL AND METHODS</title>
     <p>Study site and population</p>
     <p>The study was conducted in Dandé and Gourcy, two rural areas located in the west and north of the country, respectively. Gourcy serves as a sentinel site for malaria surveillance, while Dandé is an agricultural area characterized by higher water availability. The study took place between October and December 2006, which corresponds to the peak malaria transmission season.</p>
     <p>Study Design and Participants</p>
     <p>We conducted a randomized clinical trial comparing Artesunate-Amodiaquine (AS-AQ) with Artemether-Lumefantrine (AL). During the study period, the research team was based in health centres located in the participating localities. All patients of both sexes who were residents of these areas met the inclusion criteria and provided informed consent, which made them eligible for enrollment.</p>
     <p>Patients presenting with clinical features suggestive of uncomplicated malaria underwent a physical examination and parasitological confirmation using thick and thin blood smears for detection of asexual forms of Plasmodium falciparum. Individuals with positive test results were further assessed for eligibility based on the World Health Organization [<xref ref-type="bibr" rid="scirp.146846-13">
       13
      </xref>] criteria for uncomplicated P. falciparum malaria and subsequently enrolled into the study.</p>
     <p>Inclusion criteria</p>
     <p>Subjects with a confirmed parasitological diagnosis were then selected according to the following inclusion criteria:</p>
     <p>Data Collection and Patient Follow-up</p>
     <p>Study Procedures</p>
     <p>Patients were followed at the clinic on days 1, 2, 3, 7, 14, 21, and 28, as well as on any additional day if they reported illness. At each visit, a complete clinical examination was performed to assess new symptoms or the progression of existing symptoms. Thick and thin blood smears were prepared to detect asexual forms of Plasmodium falciparum and gametocytes. For molecular analysis, two to three drops of blood were collected on Whatman filter paper at each visit, except on day 1. Haemoglobin concentration was measured at inclusion and at the final follow-up visit <xref ref-type="table" rid="table1">
       Table 1
      </xref>.</p>
     <p>Criteria for assessing treatment efficacy</p>
     <p>Treatment efficacy was assessed according to the criteria contained in the [<xref ref-type="bibr" rid="scirp.146846-1">
       1
      </xref>] protocol as follows:</p>
     <p>Early Treatment Failure (ETF)</p>
     <table-wrap id="table1">
      <label>
       <xref ref-type="table" rid="table1">
        Table 1
       </xref></label>
      <caption>
       <title>
        <xref ref-type="bibr" rid="scirp.146846-"></xref>Table 1. Patient follow-up and collection of biological samples.</title>
      </caption>
      <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
       <tr> 
        <td class="custom-bottom-td acenter" width="30.87%"><p style="text-align:center">Day</p></td> 
        <td class="custom-bottom-td acenter" width="6.47%"><p style="text-align:center">J0</p></td> 
        <td class="custom-bottom-td acenter" width="6.47%"><p style="text-align:center">J1</p></td> 
        <td class="custom-bottom-td acenter" width="6.47%"><p style="text-align:center">J2</p></td> 
        <td class="custom-bottom-td acenter" width="6.48%"><p style="text-align:center">J3</p></td> 
        <td class="custom-bottom-td acenter" width="6.47%"><p style="text-align:center">J7</p></td> 
        <td class="custom-bottom-td acenter" width="6.47%"><p style="text-align:center">J14</p></td> 
        <td class="custom-bottom-td acenter" width="6.47%"><p style="text-align:center">J21</p></td> 
        <td class="custom-bottom-td acenter" width="6.48%"><p style="text-align:center">J28</p></td> 
        <td class="custom-bottom-td acenter" width="15.09%"><p style="text-align:center">Other days</p></td> 
       </tr> 
       <tr> 
        <td class="custom-top-td acenter" width="30.87%"><p style="text-align:center">Thick drops and thin smears</p></td> 
        <td class="custom-top-td acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="custom-top-td acenter" width="6.47%"><p style="text-align:center"></p></td> 
        <td class="custom-top-td acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="custom-top-td acenter" width="6.48%"><p style="text-align:center">X</p></td> 
        <td class="custom-top-td acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="custom-top-td acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="custom-top-td acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="custom-top-td acenter" width="6.48%"><p style="text-align:center">X</p></td> 
        <td class="custom-top-td acenter" width="15.09%"><p style="text-align:center">X</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="30.87%"><p style="text-align:center">Confetti for PCR</p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center"></p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="6.48%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="6.48%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="15.09%"><p style="text-align:center">X</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="30.87%"><p style="text-align:center">Haemoglobin level</p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center"></p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center"></p></td> 
        <td class="acenter" width="6.48%"><p style="text-align:center"></p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center"></p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center"></p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center"></p></td> 
        <td class="acenter" width="6.48%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="15.09%"><p style="text-align:center">X</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="30.87%"><p style="text-align:center">Clinical examination</p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="6.48%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="6.47%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="6.48%"><p style="text-align:center">X</p></td> 
        <td class="acenter" width="15.09%"><p style="text-align:center">X</p></td> 
       </tr> 
      </table>
     </table-wrap>
     <p>PCR = Polymerase Chain Reaction; J0 = the first visit, before the first dose is given; J1 = first day; J2 = second day; J3= third day; J7 = seventh day; J14 = fourteenth day; J21 = twenty-first day; J28 = twenty-eight days.</p>
     <p>Late Therapeutic Failure (LTF) is divided into two categories:</p>
     <p>Late Clinical Failure (LCF):</p>
     <p>Late Parasitological Failure (LPF)</p>
     <p>Presence of parasitaemia on day 28 with an axillary temperature &lt; 37.5˚C, in the absence of any criteria for LCF or LPF.</p>
     <p>Adequate Clinical and Parasitological Response (ACPR)</p>
     <p>Absence of parasitaemia on day 28 regardless of temperature without meeting the criteria for ETF, LCF or LPF.</p>
     <p>Molecular Studies</p>
     <p>The molecular study consisted of two major analyses:</p>
     <p>1) Genetic polymorphism of msp1 and msp2 genes in Plasmodium falciparum</p>
     <p>2) Genotyping of the Pfcrt K76T allele</p>
     <p>Both were performed using Polymerase Chain Reaction (PCR), which involves four steps:</p>
     <p><u>Extraction of Parasitic DNA</u></p>
     <p>(Method adapted from Plowe et al., 1995, using Chelex-100)</p>
     <p>Procedure:</p>
     <p><u>DNA Amplification (Nested PCR)</u></p>
     <p>Nested PCR Principle:</p>
     <p><u>PCR Components</u></p>
     <table-wrap id="table2">
      <label>
       <xref ref-type="table" rid="table2">
        Table 2
       </xref></label>
      <caption>
       <title>
        <xref ref-type="bibr" rid="scirp.146846-"></xref>Table 2. Reaction mixture for the first and second series of PCRs of Pfcrt 76T.</title>
      </caption>
      <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
       <tr> 
        <td class="custom-bottom-td acenter" width="31.07%"><p style="text-align:center">Reagents</p></td> 
        <td class="custom-bottom-td acenter" width="29.59%"><p style="text-align:center">Concentration</p></td> 
        <td class="custom-bottom-td acenter" width="39.34%"><p style="text-align:center">Volume to be withdrawn (µl)</p></td> 
       </tr> 
       <tr> 
        <td class="custom-top-td acenter" width="31.07%"><p style="text-align:center">H20</p></td> 
        <td class="custom-top-td acenter" width="29.59%"><p style="text-align:center">-</p></td> 
        <td class="custom-top-td acenter" width="39.34%"><p style="text-align:center">15.3</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="31.07%"><p style="text-align:center">Primer sens</p></td> 
        <td class="acenter" width="29.59%"><p style="text-align:center">10 µM</p></td> 
        <td class="acenter" width="39.34%"><p style="text-align:center">0.5</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="31.07%"><p style="text-align:center">Primer antisens</p></td> 
        <td class="acenter" width="29.59%"><p style="text-align:center">10 µM</p></td> 
        <td class="acenter" width="39.34%"><p style="text-align:center">0.5</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="31.07%"><p style="text-align:center">Buffer</p></td> 
        <td class="acenter" width="29.59%"><p style="text-align:center">10X</p></td> 
        <td class="acenter" width="39.34%"><p style="text-align:center">2.5</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="31.07%"><p style="text-align:center">dNTP</p></td> 
        <td class="acenter" width="29.59%"><p style="text-align:center">2 mM</p></td> 
        <td class="acenter" width="39.34%"><p style="text-align:center">2.5</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="31.07%"><p style="text-align:center">MgCl<sub>2</sub></p></td> 
        <td class="acenter" width="29.59%"><p style="text-align:center">25 mM</p></td> 
        <td class="acenter" width="39.34%"><p style="text-align:center">1.5</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="31.07%"><p style="text-align:center">Tag polymerase</p></td> 
        <td class="acenter" width="29.59%"><p style="text-align:center">5 U/µl</p></td> 
        <td class="acenter" width="39.34%"><p style="text-align:center">0.2</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="31.07%"><p style="text-align:center">DNA solution</p></td> 
        <td class="acenter" width="29.59%"><p style="text-align:center">Unknown</p></td> 
        <td class="acenter" width="39.34%"><p style="text-align:center">2</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="31.07%"><p style="text-align:center">Final volume</p></td> 
        <td class="acenter" width="29.59%"><p style="text-align:center">-</p></td> 
        <td class="acenter" width="39.34%"><p style="text-align:center">25</p></td> 
       </tr> 
      </table>
     </table-wrap>
     <p>The reaction mixture was incubated in a thermocycler according to the program shown in <xref ref-type="table" rid="table3">
       Table 3
      </xref>. For the second PCR series, the mixture was prepared with the CQR-A and CQR-B primers, to which 2 µl of the product from the first amplification was added. This mixture was then incubated in a thermocycler under the program specified in <xref ref-type="table" rid="table3">
       Table 3
      </xref> below.</p>
     <table-wrap id="table3">
      <label>
       <xref ref-type="table" rid="table3">
        Table 3
       </xref></label>
      <caption>
       <title>
        <xref ref-type="bibr" rid="scirp.146846-"></xref>Table 3. Amplification programmes and primer sequences for Pfcrt-K76T analysis.</title>
      </caption>
      <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
       <tr> 
        <td class="custom-bottom-td acenter" width="13.32%"><p style="text-align:center">Gene and PCR stage</p></td> 
        <td class="custom-bottom-td acenter" width="36.99%"><p style="text-align:center">Primes (5' → 3')</p></td> 
        <td class="custom-bottom-td acenter" width="49.70%"><p style="text-align:center">Amplification programme</p></td> 
       </tr> 
       <tr> 
        <td class="custom-top-td acenter" width="13.32%"><p style="text-align:center">Pfcrt T76</p></td> 
        <td class="custom-top-td acenter" width="36.99%"><p style="text-align:center">CRT-1: (21bp)</p></td> 
        <td class="custom-top-td acenter" width="49.70%"><p style="text-align:center">94˚C × 3min</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="13.32%"><p style="text-align:center">PCR1</p></td> 
        <td class="acenter" width="36.99%"><p style="text-align:center">GACG AGCG TTAT AGAGAATTA</p></td> 
        <td class="acenter" width="49.70%"><p style="text-align:center">(94˚C × 305 47˚C × 1 min 72˚C × 1.5) × 40 cycles</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="13.32%"><p style="text-align:center"></p></td> 
        <td class="acenter" width="36.99%"><p style="text-align:center">CRT-2: (20bp)</p></td> 
        <td class="acenter" width="49.70%"><p style="text-align:center">72˚C × 3 min</p></td> 
       </tr> 
       <tr> 
        <td class="custom-bottom-td acenter" width="13.32%"><p style="text-align:center"></p></td> 
        <td class="custom-bottom-td acenter" width="36.99%"><p style="text-align:center">C CAGTAGTTCTTGTAAGACC</p></td> 
        <td class="custom-bottom-td acenter" width="49.70%"><p style="text-align:center">Concertation at 4˚C</p></td> 
       </tr> 
       <tr> 
        <td class="custom-top-td acenter" width="13.32%"><p style="text-align:center">Pfcrt T76</p></td> 
        <td class="custom-top-td acenter" width="36.99%"><p style="text-align:center">CQR-A: (21bp)</p></td> 
        <td class="custom-top-td acenter" width="49.70%"><p style="text-align:center">94˚ C × 5 min</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="13.32%"><p style="text-align:center">PCR2</p></td> 
        <td class="acenter" width="36.99%"><p style="text-align:center">TGTGC TCATGTG TTTAAACTT</p></td> 
        <td class="acenter" width="49.70%"><p style="text-align:center">(94˚ C × 30 s 52˚C × 4 min 72˚C × 1 min) × 30 cycls</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="13.32%"><p style="text-align:center"></p></td> 
        <td class="acenter" width="36.99%"><p style="text-align:center">CQR-B: (23bp)</p></td> 
        <td class="acenter" width="49.70%"><p style="text-align:center">72˚ × 3 m</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="13.32%"><p style="text-align:center"></p></td> 
        <td class="acenter" width="36.99%"><p style="text-align:center">CAAAACTATAGTTACCAATTTTG</p></td> 
        <td class="acenter" width="49.70%"><p style="text-align:center">Concertation at 4˚C</p></td> 
       </tr> 
      </table>
     </table-wrap>
     <p>Pfcrt = Plasmodium falciparum chloroquine resistance transporter.</p>
     <p>Digestion of DNA by the restriction enzyme ApoI (NEB)</p>
     <p>Digestion is carried out at a temperature of 50˚C for 2 hours in a thermocycler or incubator. The Apo1 enzyme (NEB) will only cut the wild-type strain (HB3), leaving the mutant strain (Dde2) intact.</p>
     <p>In order to digest the nested PCR product, 10 µL of a reaction solution with APO1 (NEB) was prepared <xref ref-type="table" rid="table4">
       Table 4
      </xref>. To this reaction solution, we added 10 µL of the nested PCR amplification product. The entire mixture (20 µL) was placed in an Eppendorf microtube and incubated at 50˚C in a water bath. APO1 has optimal activity at 50˚C.</p>
     <table-wrap id="table4">
      <label>
       <xref ref-type="table" rid="table4">
        Table 4
       </xref></label>
      <caption>
       <title>
        <xref ref-type="bibr" rid="scirp.146846-"></xref>Table 4. Composition of the reaction medium for digestion with APO1.</title>
      </caption>
      <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
       <tr> 
        <td class="custom-bottom-td acenter" width="32.04%"><p style="text-align:center"></p></td> 
        <td class="custom-bottom-td acenter" width="32.05%"><p style="text-align:center">Concentration</p></td> 
        <td class="custom-bottom-td acenter" width="32.05%"><p style="text-align:center">Volume to be withdrawn</p></td> 
       </tr> 
       <tr> 
        <td class="custom-top-td acenter" width="32.04%"><p style="text-align:center">H20</p></td> 
        <td class="custom-top-td acenter" width="32.05%"><p style="text-align:center">-</p></td> 
        <td class="custom-top-td acenter" width="32.05%"><p style="text-align:center">6.8</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="32.04%"><p style="text-align:center">Neb3</p></td> 
        <td class="acenter" width="32.05%"><p style="text-align:center">10 X</p></td> 
        <td class="acenter" width="32.05%"><p style="text-align:center">2.0</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="32.04%"><p style="text-align:center">BSA</p></td> 
        <td class="acenter" width="32.05%"><p style="text-align:center">100 X</p></td> 
        <td class="acenter" width="32.05%"><p style="text-align:center">0.2</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="32.04%"><p style="text-align:center">APOI (NEB)</p></td> 
        <td class="acenter" width="32.05%"><p style="text-align:center">10 U/µl</p></td> 
        <td class="acenter" width="32.05%"><p style="text-align:center">1.0</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="32.04%"><p style="text-align:center">Nested PCR product</p></td> 
        <td class="acenter" width="32.05%"><p style="text-align:center">Unknown</p></td> 
        <td class="acenter" width="32.05%"><p style="text-align:center">10</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="32.04%"><p style="text-align:center">Final volume</p></td> 
        <td class="acenter" width="32.05%"><p style="text-align:center"></p></td> 
        <td class="acenter" width="32.05%"><p style="text-align:center">20.0</p></td> 
       </tr> 
      </table>
     </table-wrap>
     <p>Amplification product disclosure</p>
     <p>Electrophoresis:</p>
     <p>Migration is performed on 2.5% agarose gel:</p>
     <p>Interpretation of the photograph:</p>
     <p>A good reaction is indicated by the presence of bands consistent with those expected. The size of the expected product and that of the positive controls must be checked for consistency. The Apo I enzyme (NEB) only cuts wild-type strains. Bands of the same size as the wild-type control (100 bp) correspond to strains sensitive to chloroquine.</p>
     <p>On the other hand, those of the same size as the resistant control (134 bp) correspond to strains resistant to chloroquine. Bands that appear at both controls correspond to mixed strains.</p>
     <p>The expected size for the amplification products is 537 bp for the first amplification and 134 bp for the second.</p>
     <p>Determination of genetic polymorphism of msp1 and msp2</p>
     <p>Reaction mixture and amplification programme for msp1 and msp2</p>
     <p>For msp1 and msp2, the constituents (volume and concentration of reagents) are identical except for the sequences of the primer pairs.</p>
     <p>The components of the reaction mixtures for the first and second PCRs of msp1 and msp2 are shown in <xref ref-type="table" rid="table5">
       Table 5
      </xref>. The product of the first amplification serves as the DNA source for the second amplification.</p>
     <table-wrap id="table5">
      <label>
       <xref ref-type="table" rid="table5">
        Table 5
       </xref></label>
      <caption>
       <title>
        <xref ref-type="bibr" rid="scirp.146846-"></xref>Table 5. Composition of reaction mixtures for the first and second PCRs.</title>
      </caption>
      <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
       <tr> 
        <td rowspan="2" class="acenter" width="19.23%"><p style="text-align:center">Reactive</p></td> 
        <td class="custom-bottom-td acenter" width="41.42%" colspan="2"><p style="text-align:center">PCR 1</p></td> 
        <td class="custom-bottom-td acenter" width="39.34%" colspan="2"><p style="text-align:center">PCR 2</p></td> 
       </tr> 
       <tr> 
        <td class="custom-bottom-td custom-top-td acenter" width="20.72%"><p style="text-align:center">Concentration</p></td> 
        <td class="custom-bottom-td custom-top-td acenter" width="20.71%"><p style="text-align:center">Volume (µl) to be collected</p></td> 
        <td class="custom-bottom-td custom-top-td acenter" width="20.72%"><p style="text-align:center">Concentration</p></td> 
        <td class="custom-bottom-td custom-top-td acenter" width="18.63%"><p style="text-align:center">Volume (µl) to be collected</p></td> 
       </tr> 
       <tr> 
        <td class="custom-top-td acenter" width="19.23%"><p style="text-align:center">H<sub>2</sub>O ultra pure</p></td> 
        <td class="custom-top-td acenter" width="20.72%"><p style="text-align:center"></p></td> 
        <td class="custom-top-td acenter" width="20.71%"><p style="text-align:center">19,525</p></td> 
        <td class="custom-top-td acenter" width="20.72%"><p style="text-align:center"></p></td> 
        <td class="custom-top-td acenter" width="18.63%"><p style="text-align:center">20,025</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="19.23%"><p style="text-align:center">Primer sens</p></td> 
        <td class="acenter" width="20.72%"><p style="text-align:center">50 µM</p></td> 
        <td class="acenter" width="20.71%"><p style="text-align:center">0.05</p></td> 
        <td class="acenter" width="20.72%"><p style="text-align:center">50 µM</p></td> 
        <td class="acenter" width="18.63%"><p style="text-align:center">0.05</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="19.23%"><p style="text-align:center">Primer antisens</p></td> 
        <td class="acenter" width="20.72%"><p style="text-align:center">50 µM</p></td> 
        <td class="acenter" width="20.71%"><p style="text-align:center">0.05</p></td> 
        <td class="acenter" width="20.72%"><p style="text-align:center">50 µM</p></td> 
        <td class="acenter" width="18.63%"><p style="text-align:center">0.05</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="19.23%"><p style="text-align:center">Buffer</p></td> 
        <td class="acenter" width="20.72%"><p style="text-align:center">10X</p></td> 
        <td class="acenter" width="20.71%"><p style="text-align:center">2.5</p></td> 
        <td class="acenter" width="20.72%"><p style="text-align:center">10X</p></td> 
        <td class="acenter" width="18.63%"><p style="text-align:center">2.5</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="19.23%"><p style="text-align:center">dNTPs</p></td> 
        <td class="acenter" width="20.72%"><p style="text-align:center">20 mM</p></td> 
        <td class="acenter" width="20.71%"><p style="text-align:center">0.25</p></td> 
        <td class="acenter" width="20.72%"><p style="text-align:center">20 mM</p></td> 
        <td class="acenter" width="18.63%"><p style="text-align:center">0.25</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="19.23%"><p style="text-align:center">MgCl<sub>2</sub></p></td> 
        <td class="acenter" width="20.72%"><p style="text-align:center">25 mM</p></td> 
        <td class="acenter" width="20.71%"><p style="text-align:center">1.5</p></td> 
        <td class="acenter" width="20.72%"><p style="text-align:center">25 mM</p></td> 
        <td class="acenter" width="18.63%"><p style="text-align:center">1.5</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="19.23%"><p style="text-align:center">Taq polymerase</p></td> 
        <td class="acenter" width="20.72%"><p style="text-align:center">5 U/µl</p></td> 
        <td class="acenter" width="20.71%"><p style="text-align:center">0.125</p></td> 
        <td class="acenter" width="20.72%"><p style="text-align:center">5 U/µl</p></td> 
        <td class="acenter" width="18.63%"><p style="text-align:center">0.125</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="19.23%"><p style="text-align:center">DNA extract</p></td> 
        <td class="acenter" width="20.72%"><p style="text-align:center">unknown</p></td> 
        <td class="acenter" width="20.71%"><p style="text-align:center">1</p></td> 
        <td class="acenter" width="20.72%"><p style="text-align:center">unknown</p></td> 
        <td class="acenter" width="18.63%"><p style="text-align:center">0.5</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="100.00%" colspan="5"><p style="text-align:center">Final volume = 25 µl</p></td> 
       </tr> 
      </table>
     </table-wrap>
     <p>dNTPs = Deoxyribonucleoside triphosphates.</p>
     <p>During the first PCR, the primer pairs used were: 01/02 for msp1 and S3/S2 for msp2; during the second PCR, primers N1/N2 and S1/S4 were used for msp1 and msp2, respectively. The 25 µl, contained in a sterile microtube, are incubated in a thermocycler (Master cycler gradient) under a program specific to each gene <xref ref-type="table" rid="table6">
       Table 6
      </xref>.</p>
     <p>Interpretation of results</p>
     <p>1) Experimental Setup Recap</p>
     <table-wrap id="table6">
      <label>
       <xref ref-type="table" rid="table6">
        Table 6
       </xref></label>
      <caption>
       <title>
        <xref ref-type="bibr" rid="scirp.146846-"></xref>Table 6. Summary table of amplification programs for each gene.</title>
      </caption>
      <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
       <tr> 
        <td rowspan="2" class="acenter" width="5.92%"><p style="text-align:center">MSP1</p></td> 
        <td class="acenter" width="14.80%"><p style="text-align:center">1<sup>st</sup> amplification.</p></td> 
        <td class="aleft" width="48.82%"><p style="text-align:left">O1: 5'CACATGAAAGTTATCAAGAACTTGTC-3'</p><p style="text-align:left">O2: 5'-GTACGTCTAATTCATTTGCACG-3'</p></td> 
        <td class="acenter" width="30.46%"><p style="text-align:center">94˚C × 3 min; (94˚C × 25 s; 50˚C × 35 s; 68˚C × 2 min 30 s) × 30; 72˚C × 3 min</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="14.80%"><p style="text-align:center">2<sup>nd</sup> amplification.</p></td> 
        <td class="aleft" width="48.82%"><p style="text-align:left">N1: 5'-GCAGTATTGACAGGTTATGG-3'</p><p style="text-align:left">N2: 5'-GATTGAAAGGTATTTGAC-3'</p></td> 
        <td class="acenter" width="30.46%"><p style="text-align:center">94˚C × 3 min; (94˚C × 25 s; 50˚C × 35 s; 68˚C × 2 min 30 s) × 30; 72˚C × 3 min</p></td> 
       </tr> 
       <tr> 
        <td rowspan="2" class="custom-top-td acenter" width="5.92%"><p style="text-align:center">MSP2</p></td> 
        <td class="custom-top-td acenter" width="14.80%"><p style="text-align:center">1<sup>st</sup> amplification.</p></td> 
        <td class="custom-top-td aleft" width="48.82%"><p style="text-align:left">S3: 5'-GAAGGTAATTAAAACATTGTC-3'</p><p style="text-align:left">S2: 5'-GAGGGATGTTGCTGCTCCACAG-3'</p></td> 
        <td class="custom-top-td acenter" width="30.46%"><p style="text-align:center">94˚C × 3 min; (94˚C × 25 s; 42˚C × 1 min; 65˚C × 2 min) × 30; 72˚C × 3 min</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="14.80%"><p style="text-align:center">2<sup>nd</sup> amplification.</p></td> 
        <td class="aleft" width="48.82%"><p style="text-align:left">S1: 5'-GAGTATAAGGAGAAGTATG-3'</p><p style="text-align:left">S4: 5'-CTAGAACCATGCATATGTCC-3'</p></td> 
        <td class="acenter" width="30.46%"><p style="text-align:center">94˚C × 3 min; (94˚C × 25 s; 50˚C × 1 min; 70˚C × 2 min) × 30; 72˚C × 3 min</p></td> 
       </tr> 
      </table>
     </table-wrap>
     <p>MSP1, 2 = Merozoite Surface Protein 1, 2.</p>
     <p>2) Gel Visualization</p>
     <p>3) Interpretation of Banding Patterns</p>
     <p>This method is commonly used in malaria genotyping (e.g., to distinguish recrudescence from reinfection).</p>
     <p>Non-exhaustive example of gel interpretation</p>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td acenter" width="25.39%"><p style="text-align:center">Status</p></td> 
       <td class="custom-bottom-td acenter" width="71.64%"><p style="text-align:center">Features</p></td> 
      </tr> 
      <tr> 
       <td class="custom-top-td acenter" width="25.39%"><p style="text-align:center">New infection</p></td> 
       <td class="custom-top-td acenter" width="71.64%"><p style="text-align:center">The number and size of bands on Day 0 and Failure Day are different.</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="25.39%"><p style="text-align:center">Resurgence</p></td> 
       <td class="acenter" width="71.64%"><p style="text-align:center">The sizes of the bands on Day 0 and Failure Day are identical.</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="25.39%"><p style="text-align:center">Undetermined</p></td> 
       <td class="acenter" width="71.64%"><p style="text-align:center">Negative PCR for D0 or Day of failure</p></td> 
      </tr> 
     </table>
     <p>For a given patient, the status is determined based on the polymorphism of msp1 and msp2.</p>
     <p>Data analysis</p>
     <p>We used EXCEL 2003 software to enter the data. Statistical analysis was performed using Epi Info 6.04 and SPSS 11.0 software.</p>
     <p>The chi-square test and Fisher’s exact test were used to compare proportions and measure the association between certain variables. A p-value of &lt;0.05 was considered statistically significant.</p>
     <p>Ethical considerations</p>
     <p>Prior to the start of the study, this protocol was submitted to and approved by the institutional ethics committee of the MURAZ/IRSS center.</p>
     <p>Patients were informed that their participation in the study was entirely voluntary and that the information collected by the team was strictly confidential. They were also allowed to withdraw from the study at any time if they wished.</p>
    </sec>
   </sec>
   <sec id="s3">
    <title>3. RESULTS</title>
    <sec id="s3_1">
     <title>Characteristics of the Study Population</title>
     <p>Between October and December 2006, a total of 497 patients were examined at two sites. Of these, 286 tested positive for thick blood smears under microscopic examination, corresponding to a plasmodial index of 57.54%. A total of 167 patients were enrolled in the study and treated either with Artesunate-Amodiaquine (AQ/AS, n = 67) or artemether-lumefantrine (AL, n = 100). During follow-up, 60 patients were excluded for various reasons (including repeated vomiting, withdrawal of consent, and loss to follow-up): 20 from the AQ/AS group and 40 from the AL group <xref ref-type="fig" rid="fig1">
       Figure 1
      </xref>.</p>
     <fig id="fig1" position="float">
      <label>Figure 1</label>
      <caption>
       <title>
        <xref ref-type="bibr" rid="scirp.146846-"></xref>Figure 1. Study profile.</title>
      </caption>
      <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/9103059-rId11.jpeg?20251030031118" />
     </fig>
     <p>During the follow-up, 60 patients were excluded for various reasons (repeated vomiting, withdrawal of consent, lost to follow-up…) including 20 for AQ/AS and 40 for AL (<xref ref-type="fig" rid="fig1">
       Figure 1
      </xref>). In the Amodiaquine-Artesunate (AQ-AS) arm, 20 students were excluded for various reasons:</p>
     <p>In the Artemether-Lumefantrine (AL) arm, 40 students were excluded for various reasons:</p>
     <p>Characteristics of the study population</p>
     <p>Among the 47 patients included, the majority (78.72%, 37/47) were aged between 6 and 59 months. The overall age range was 6 months to 30 years, with a mean age of 3.85 ± 5.21 years.</p>
     <p>Female patients represented 55.32% (26/47) of the study population.</p>
     <p>Temperature</p>
     <p>At inclusion, patient temperatures ranged from 36.1˚C to 40.2˚C, with an overall mean of 38.2˚C ± 1.03˚C. Among children under 5 years of age, the mean temperature was 38.4˚C, compared to 37.7˚C in those over 5 years. The average temperature showed minimal variation between genders.</p>
     <p>Parasite Density</p>
     <p>The geometric mean parasite density at inclusion was 12,751.12 trophozoites/µL, ranging from 2000 to 110,068 trophozoites/µL. The mean parasite density was 12,617.3 trophozoites/µL in children over 5 years of age, compared with 12,086.8 trophozoites/µL in children under 5 years of age.</p>
     <p>Hemoglobin level</p>
     <p>The mean hemoglobin level was 9.10 ± 2.27 g/dL, ranging from 5 to 14.8 g/dL. In patients older than 5 years, the mean value was 11.38 g/dL, whereas in those younger than 5 years, it was 8.10 g/dL. Overall, 55.3% (26/47) of patients were anemic at inclusion.</p>
     <p>Gametocyte density</p>
     <p>Among the 47 patients who completed follow-up, only one presented with gametocytes on the day of inclusion, corresponding to a prevalence of 2.13% (1/47).</p>
     <p>Clinical and Parasitological Results</p>
     <p>
      <xref ref-type="table" rid="table7">
       Table 7
      </xref> below presents the prevalence rates obtained after treatment with AQ/AS. Across all study sites, the average prevalence of treatment failure was 14.89% (95% CI: 6.2 - 28.3). No significant variation in treatment failure prevalence was observed between sites (p = 0.45).</p>
     <table-wrap id="table7">
      <label>
       <xref ref-type="table" rid="table7">
        Table 7
       </xref></label>
      <caption>
       <title>
        <xref ref-type="bibr" rid="scirp.146846-"></xref>Table 7. Analysis of treatment efficacy by site.</title>
      </caption>
      <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
       <tr> 
        <td class="custom-bottom-td acenter" width="23.52%"><p style="text-align:center">Location</p></td> 
        <td class="custom-bottom-td acenter" width="23.55%"><p style="text-align:center">Gourcy (n = 41)</p></td> 
        <td class="custom-bottom-td acenter" width="23.55%"><p style="text-align:center">Dande (n = 6)</p></td> 
        <td class="custom-bottom-td acenter" width="23.57%"><p style="text-align:center">Total (N = 47)</p></td> 
       </tr> 
       <tr> 
        <td class="custom-top-td acenter" width="23.52%"><p style="text-align:center">ETF</p></td> 
        <td class="custom-top-td acenter" width="23.55%"><p style="text-align:center">0</p></td> 
        <td class="custom-top-td acenter" width="23.55%"><p style="text-align:center">0</p></td> 
        <td class="custom-top-td acenter" width="23.57%"><p style="text-align:center">0</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="23.52%"><p style="text-align:center">LCF</p></td> 
        <td class="acenter" width="23.55%"><p style="text-align:center">0</p></td> 
        <td class="acenter" width="23.55%"><p style="text-align:center">0</p></td> 
        <td class="acenter" width="23.57%"><p style="text-align:center">0</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="23.52%"><p style="text-align:center">LPF</p></td> 
        <td class="acenter" width="23.55%"><p style="text-align:center">6 (14.63%)</p></td> 
        <td class="acenter" width="23.55%"><p style="text-align:center">1 (16.67%)</p></td> 
        <td class="acenter" width="23.57%"><p style="text-align:center">7 (14.89%)</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="23.52%"><p style="text-align:center">GTF</p></td> 
        <td class="acenter" width="23.55%"><p style="text-align:center">6 (14.63%)</p></td> 
        <td class="acenter" width="23.55%"><p style="text-align:center">1 (16.67%)</p></td> 
        <td class="acenter" width="23.57%"><p style="text-align:center">7 (14.89%)</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="23.52%"><p style="text-align:center">ACPR</p></td> 
        <td class="acenter" width="23.55%"><p style="text-align:center">35 (85.37%)</p></td> 
        <td class="acenter" width="23.55%"><p style="text-align:center">5 (83.33%)</p></td> 
        <td class="acenter" width="23.57%"><p style="text-align:center">40 (85.11%)</p></td> 
       </tr> 
      </table>
     </table-wrap>
     <p>ETF = Early Treatment Failure; LCF = Late Clinical Failure; LPF = Late Parasitological Failure; GTF = General Therapeutic Failure; ACPR = Adequate Clinical and Parasitological Response.</p>
     <p>No cases of early treatment failure were observed. Regardless of the study site, all recorded failures were classified as late parasitological failures. The overall therapeutic efficacy was 85.11%, with site-specific rates of 85.37% in Gourcy and 83.33% in Dandé.</p>
     <p>Given the late onset of these failures, an analysis of parasite polymorphism will be necessary to differentiate between recrudescences and new infections. This will provide a more accurate estimate of the true treatment failure rate.</p>
     <p>Clinical and parasitological results by site after PCR adjustment</p>
     <p>The prevalence of treatment failure due to relapse was 12.8% (95% CI: 8.1 - 17.5) in the study population. Moreover, no significant influence of the study site on the prevalence of treatment failure was observed <xref ref-type="table" rid="table8">
       Table 8
      </xref>.</p>
     <table-wrap id="table8">
      <label>
       <xref ref-type="table" rid="table8">
        Table 8
       </xref></label>
      <caption>
       <title>
        <xref ref-type="bibr" rid="scirp.146846-"></xref>Table 8. Analysis of treatment efficacy after adjustment for PCR.</title>
      </caption>
      <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
       <tr> 
        <td class="custom-bottom-td acenter" width="25.07%"><p style="text-align:center">Location (N = 47)</p></td> 
        <td class="custom-bottom-td acenter" width="24.97%"><p style="text-align:center">Gourcy (n = 41)</p></td> 
        <td class="custom-bottom-td acenter" width="24.97%"><p style="text-align:center">Dande (n = 6)</p></td> 
        <td class="custom-bottom-td acenter" width="24.98%"><p style="text-align:center">Total</p></td> 
       </tr> 
       <tr> 
        <td class="custom-top-td acenter" width="25.07%"><p style="text-align:center">ETF</p></td> 
        <td class="custom-top-td acenter" width="24.97%"><p style="text-align:center">0</p></td> 
        <td class="custom-top-td acenter" width="24.97%"><p style="text-align:center">0</p></td> 
        <td class="custom-top-td acenter" width="24.98%"><p style="text-align:center">0</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="25.07%"><p style="text-align:center">LCF</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">0</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">0</p></td> 
        <td class="acenter" width="24.98%"><p style="text-align:center">0</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="25.07%"><p style="text-align:center">Resurgence</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">0</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">0</p></td> 
        <td class="acenter" width="24.98%"><p style="text-align:center">0</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="25.07%"><p style="text-align:center">New infections</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">0</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">0</p></td> 
        <td class="acenter" width="24.98%"><p style="text-align:center">0</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="25.07%"><p style="text-align:center">LPF</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">6 (14.6%)</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">1 (16.7%)</p></td> 
        <td class="acenter" width="24.98%"><p style="text-align:center">7 (14.9%)</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="25.07%"><p style="text-align:center">Resurgence</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">5 (12.2%)</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">1 (16.7%)</p></td> 
        <td class="acenter" width="24.98%"><p style="text-align:center">6 (12.8%)</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="25.07%"><p style="text-align:center">New infections</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">1 (2.4%)</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">0</p></td> 
        <td class="acenter" width="24.98%"><p style="text-align:center">1 (2.1%)</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="25.07%"><p style="text-align:center">GTF</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">6 (14.6%)</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">1 (16.7%)</p></td> 
        <td class="acenter" width="24.98%"><p style="text-align:center">7 (14.9%)</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="25.07%"><p style="text-align:center">ACPR</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">35 (85.4%)</p></td> 
        <td class="acenter" width="24.97%"><p style="text-align:center">5 (83.33%)</p></td> 
        <td class="acenter" width="24.98%"><p style="text-align:center">40 (85.1%)</p></td> 
       </tr> 
      </table>
     </table-wrap>
     <p>The polymorphism analysis of msp-1 and msp-2 revealed that six (6) of the seven (7) PCR-positive clinical cases were due to recrudescent parasites, while only one (1) case, detected at the Gourcy site, represented a new infection. Thus, among all treatment failures, 14.3% were reinfections and 85.7% were recurrences, a statistically significant difference (p = 0.03).</p>
     <p>When stratified by age, four (4) of the six (6) recurrences occurred in children under 5 years of age, compared to two (2) cases in children aged 5 years and above. This difference was not statistically significant (P = 0.56).</p>
     <p>Prevalence of the Pfcrt-K76T allele</p>
     <p>The prevalence of the Pfcrt 76T mutation prior to AS/AQ therapy was 48.9% (95% CI: 34.6 - 63.2) in the study population. By site, prevalence was 48.8% in Gourcy and 50% in Dandé, with no significant difference between the two locations (P = 0.70). Similarly, prevalence did not vary significantly according to age or sex (P = 0.94) (<xref ref-type="table" rid="table9">
       Table 9
      </xref>).</p>
     <table-wrap id="table9">
      <label>
       <xref ref-type="table" rid="table9">
        Table 9
       </xref></label>
      <caption>
       <title>
        <xref ref-type="bibr" rid="scirp.146846-"></xref>Table 9. Pfcrt association and clinical response to treatment.</title>
      </caption>
      <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
       <tr> 
        <td rowspan="2" class="acenter" width="19.22%"><p style="text-align:center"></p></td> 
        <td class="acenter" width="38.45%" colspan="2"><p style="text-align:center">Mutations at Pfcrt 76T</p></td> 
        <td rowspan="2" class="acenter" width="19.22%"><p style="text-align:center"></p><p style="text-align:center">Total</p></td> 
       </tr> 
       <tr> 
        <td class="custom-bottom-td custom-top-td acenter" width="19.22%"><p style="text-align:center">Present</p></td> 
        <td class="custom-bottom-td custom-top-td acenter" width="19.22%"><p style="text-align:center">Absent</p></td> 
       </tr> 
       <tr> 
        <td class="custom-top-td acenter" width="19.22%"><p style="text-align:center">GTF***</p></td> 
        <td class="custom-top-td acenter" width="19.22%"><p style="text-align:center">4 (66.7%)</p></td> 
        <td class="custom-top-td acenter" width="19.22%"><p style="text-align:center">2 (33.3%)</p></td> 
        <td class="custom-top-td acenter" width="19.22%"><p style="text-align:center">6</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="19.22%"><p style="text-align:center">RCPA</p></td> 
        <td class="acenter" width="19.22%"><p style="text-align:center">19 (46.3%)</p></td> 
        <td class="acenter" width="19.22%"><p style="text-align:center">22 (53.7%)</p></td> 
        <td class="acenter" width="19.22%"><p style="text-align:center">41</p></td> 
       </tr> 
       <tr> 
        <td class="acenter" width="19.22%"><p style="text-align:center">Total</p></td> 
        <td class="acenter" width="19.22%"><p style="text-align:center">23 (48.9%)</p></td> 
        <td class="acenter" width="19.22%"><p style="text-align:center">24 (51.1%)</p></td> 
        <td class="acenter" width="19.22%"><p style="text-align:center">47</p></td> 
       </tr> 
      </table>
     </table-wrap>
     <p>***Due to resurgence.</p>
     <p>Prevalence of mutations in subjects who failed treatment</p>
     <p>To assess whether the presence of the Pfcrt 76T mutation prior to treatment was associated with failure of the AS/AQ combination, we compared the prevalence of the mutant allele between cases of treatment failure and RCPA cases. Among the six recrudescent isolates, four (66.7%) carried the Pfcrt 76T mutation, whereas 19 of 41 (46.3%) RCPA isolates also harbored this mutation. Statistical analysis showed no significant association between the presence of the Pfcrt 76T allele and treatment failure due to parasite recrudescence (P = 0.94).</p>
    </sec>
   </sec>
   <sec id="s4">
    <title>4. DISCUSSION</title>
    <p>The therapeutic efficacy of the combination of artesunate and amodiaquine</p>
    <p>Analysis of the prevalence of failure rates for the Artesunate-Amodiaquine combination indicates that this treatment maintains a relatively high efficacy. However, our results demonstrate higher failure rates compared to those reported by other authors in the region. For instance, [<xref ref-type="bibr" rid="scirp.146846-10">
      10
     </xref>] reported a 100% efficacy rate for this combination in Bobo-Dioulasso.</p>
    <p>A study conducted in the central region revealed a failure rate of 7.94% [<xref ref-type="bibr" rid="scirp.146846-14">
      14
     </xref>]. This difference from our results could be explained by the phenomenon of fluctuation over time. Given that chemoresistance is a dynamic phenomenon that evolves over time and space, it is understandable that this failure rate increased between these two periods. In fact, our results are comparable to those published in other regions; for example, in 2004 [<xref ref-type="bibr" rid="scirp.146846-12">
      12
     </xref>], Grandesso et al. reported a failure rate of 13.49%. Results reported from Central and East Africa also indicate similar rates [<xref ref-type="bibr" rid="scirp.146846-15">
      15
     </xref>]. However, other authors have reported lower rates. Between 2000 and 2005, average cure rates of 97% [<xref ref-type="bibr" rid="scirp.146846-16">
      16
     </xref>] were observed in southern Senegal. [<xref ref-type="bibr" rid="scirp.146846-17">
      17
     </xref>] showed that ACT (AL and alternatives) remained highly effective in Mali. Similarly, [<xref ref-type="bibr" rid="scirp.146846-18">
      18
     </xref>] in Côte d’Ivoire also reported that AS-AQ and AL demonstrated clinically adequate cure rates (~95%). [<xref ref-type="bibr" rid="scirp.146846-19">
      19
     </xref>] reported that dihydroartemisinin-piperaquine (DHAP) demonstrated PCR-corrected cure rates exceeding 90% and was generally well tolerated in the Ghanaian sites where it was studied. This difference from our results could be explained by the heterogeneity of the geographical distribution of P. falciparum strains.</p>
    <p>We also found a higher failure rate in the 6- to 59-month age group compared to the 5-year-old and older age group, but this difference could be explained by the difference in the degree of immunity that changes with age [<xref ref-type="bibr" rid="scirp.146846-20">
      20
     </xref>-<xref ref-type="bibr" rid="scirp.146846-22">
      22
     </xref>]. However, this observation was not verified in the present study, as there was no statistical association between age and therapeutic failure with AS/AQ. This association could probably be established if immunogenetic studies were conducted.</p>
    <p>Prevalence of Pfcrt 76T mutations in the study population</p>
    <p>The 76T mutation of the Pfcrt gene, which encodes a transporter protein located in the digestive vacuole of Plasmodium falciparum [<xref ref-type="bibr" rid="scirp.146846-6">
      6
     </xref>], was detected in 48.9% (23/47) of samples collected prior to treatment, with a 95% CI of [34.6 - 63.2]. Although the proportion of mutant alleles varied across study sites, these differences were not statistically significant (P &gt; 0.05).</p>
    <p>A study conducted by [<xref ref-type="bibr" rid="scirp.146846-23">
      23
     </xref>] in Bobo-Dioulasso reported higher proportions than ours (61.4%). In the Anjouan Islands, where transmission appears to be significant, 88% of isolates carried the mutant profile 76T [<xref ref-type="bibr" rid="scirp.146846-24">
      24
     </xref>]. These differences could be explained by variations in circulating strains and/or temporal fluctuations of the phenomenon.</p>
    <p>Nevertheless, our findings are consistent with those of [<xref ref-type="bibr" rid="scirp.146846-25">
      25
     </xref>] in the Niger Valley, where a prevalence of 50% was reported.</p>
    <p>Since amodiaquine was used less frequently than chloroquine, these mutations were most likely selected by chloroquine pressure. Moreover, because chloroquine and amodiaquine share the same mode of action, some chloroquine-resistant mutant strains may also exhibit resistance to amodiaquine.</p>
    <p>The relationship between the presence of Pfcrt 76T mutations and prediction of clinical outcomes</p>
    <p>“In our study, the prevalence of the mutation was high among both patients who experienced parasite recrudescence and those who achieved therapeutic success. Therefore, no significant association was found between the presence of the mutation and clinical outcome (P &gt; 0.05).”</p>
    <p>Several studies have investigated the prevalence of the Pfcrt-K76T mutation as a molecular marker for assessing the effectiveness of artemisinin-based combination therapies (ACTs) in Burkina Faso in particular, and in Africa more broadly [<xref ref-type="bibr" rid="scirp.146846-26">
      26
     </xref>, <xref ref-type="bibr" rid="scirp.146846-27">
      27
     </xref>]. In addition, the Kelch13-propeller (K13) marker, which has been associated both in vivo and in vitro with resistance to artemisinin and its derivatives, requires regular monitoring [<xref ref-type="bibr" rid="scirp.146846-28">
      28
     </xref>]. This molecular marker of artemisinin resistance was first reported in 2014 and subsequently adopted by the global scientific community [<xref ref-type="bibr" rid="scirp.146846-29">
      29
     </xref>].</p>
    <p>As part of efforts to characterize K13 gene mutations across Africa, 3,257 Plasmodium falciparum isolates were collected between 2011 and 2019 from eleven malaria-endemic countries: Gambia, Sierra Leone, and Burkina Faso in West Africa; Chad, the Central African Republic, the Republic of Congo, and Equatorial Guinea in Central Africa; and Burundi, Tanzania, Rwanda, and Somalia in East Africa. Of these, 98% (3179/3257) carried the wild-type K13 allele, sometimes with synonymous (non-coding) substitutions. In total, 35 unique non-synonymous K13 mutations were identified, though only a small subset has been validated as mediators of artemisinin resistance [<xref ref-type="bibr" rid="scirp.146846-30">
      30
     </xref>].</p>
    <p>It is well established that the reduced sensitivity of P. falciparum to ACTs could compromise progress made in malaria control. Beyond K13, other genetic determinants are also implicated in resistance. Point mutations in the Pfmdr-1 gene on chromosome 5, which encodes a multidrug resistance protein, and in the Pfcg2 gene on chromosome 7, have been associated with decreased drug susceptibility [<xref ref-type="bibr" rid="scirp.146846-31">
      31
     </xref>].</p>
   </sec>
   <sec id="s5">
    <title>5. CONCLUSIONS</title>
    <p>Amodiaquine-artesunate is an artemisinin-based combination therapy that has proven effective in Burkina Faso, which supports its selection by the National Malaria Control Program for the treatment of uncomplicated malaria.</p>
    <p>Moreover, the high prevalence of the Pfcrt 76T mutation (48.9%) and the persistently high efficacy of the free combination (treatment failure rate = 12.8%) indicate that this mutation is not associated with clinical outcomes in treated patients.</p>
    <p>Future efforts to identify predictive markers of resistance to this combination should therefore focus on novel genetic markers or on combinations of several known markers.</p>
   </sec>
   <sec id="s6">
    <title>Limitations of the study</title>
    <p>Although this topic remains relevant today, this study was conducted more than twenty years ago.</p>
   </sec>
  </sec>
 </body><back>
  <ref-list>
   <title>References</title>
   <ref id="scirp.146846-ref1">
    <label>1</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     OMS (2005) Paludisme. Rapport de secretariat. n˚7.
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref2">
    <label>2</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Ministère de la Santé (2006) De l’Action Sociale et de la Famille: Direction de la médecine préventive. Programme national de lutte antipaludique au Burkina Faso, 67 p. 
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref3">
    <label>3</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Cortese, J.F., Caraballo, A., Contreras, C.E. and Plowe, C.V. (2002) Origin and Dissemination of Plasmodium falciparum Drug-Resistance Mutations in South America. The Journal of Infectious Diseases, 186, 999-1006. &gt;https://doi.org/10.1086/342946
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref4">
    <label>4</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Talisuna, A.O., Bloland, P. and D’Alessandro, U. (2004) History, Dynamics, and Public Health Importance of Malaria Parasite Resistance. Clinical Microbiology Reviews, 17, 235-254. &gt;https://doi.org/10.1128/cmr.17.1.235-254.2004
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref5">
    <label>5</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Hastings, I.M. (2004) The Origins of Antimalarial Drug Resistance. Trends in Parasitology, 20, 512-518. &gt;https://doi.org/10.1016/j.pt.2004.08.006
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref6">
    <label>6</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Fidock, D.A., Nomura, T., Talley, A.K., Cooper, R.A., Dzekunov, S.M., Ferdig, M.T., et al. (2000) Mutations in the P. falciparum Digestive Vacuole Transmembrane Protein Pfcrt and Evidence for Their Role in Chloroquine Resistance. Molecular Cell, 6, 861-871. &gt;https://doi.org/10.1016/s1097-2765(05)00077-8
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref7">
    <label>7</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Cowman, A.F., Morry, M.J., Biggs, B.A., Cross, G.A. and Foote, S.J. (1988) Amino Acid Changes Linked to Pyrimethamine Resistance in the Dihydrofolate Reductase-Thymidylate Synthase Gene of Plasmodium falciparum. Proceedings of the National Academy of Sciences, 85, 9109-9113. &gt;https://doi.org/10.1073/pnas.85.23.9109
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref8">
    <label>8</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Holmgren, G., Gil, J.P., Ferreira, P.M., Veiga, M.I., Obonyo, C.O. and Björkman, A. (2006) Amodiaquine Resistant Plasmodium falciparum Malaria in Vivo Is Associated with Selection of Pfcrt 76T and Pfmdr1 86Y. Infection, Genetics and Evolution, 6, 309-314. &gt;https://doi.org/10.1016/j.meegid.2005.09.001
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref9">
    <label>9</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Brasseur, P., Guiguemde, R., Diallo, S., Guiyedi, V., Kombila, M., Ringwald, P., et al. (1999) Amodiaquine Remains Effective for Treating Uncomplicated Malaria in West and Central Africa. Transactions of the Royal Society of Tropical Medicine and Hygiene, 93, 645-650. &gt;https://doi.org/10.1016/s0035-9203(99)90083-4
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref10">
    <label>10</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Barennes, H., Nagot, N., Valea, I., Koussoubé-Balima, T., Ouedraogo, A., Sanou, T., et al. (2004) A Randomized Trial of Amodiaquine and Artesunate Alone and in Combination for the Treatment of Uncomplicated Falciparum Malaria in Children from Burkina Faso. Tropical Medicine&amp;International Health, 9, 438-444. &gt;https://doi.org/10.1111/j.1365-3156.2004.01224.x
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref11">
    <label>11</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     D’Alessandro, U. and ter Kuile, F.O. (2006) Amodiaquine, Malaria, Pregnancy: The Old New Drug. The Lancet, 368, 1306-1307. &gt;https://doi.org/10.1016/s0140-6736(06)69532-9
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref12">
    <label>12</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Francesco, G., André, H., Sarian, K., et al. (2004) Low Efficacy of the Combination Artesurate plus Amodiaquine for Uncomplicated Falciparum Malaria among Children under 5 Year in Kailahun, Sierre-Leone.
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref13">
    <label>13</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     WHO (2003) Assessment and Monitoring of Antimalarial Drug Efficacy for the Treatment of Uncomplicated Plasmodium falciparum Malaria. &gt;http://www.who.int/malaria/docs/ProtocolWHO.pdf 
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref14">
    <label>14</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Sirimai, S.B., Tiono, A.B., Konaté, A., Diarra, A., Castelli, F., Pinoges, L., et al. (2003) Efficacy of Artesunate plus Chloroquine for the Treatment of Uncomplicated Malaria in Children in Burkina Faso: A Double-Blind, Randomized, Controlled Trial. Transactions of the Royal Society of Tropical Medicine and Hygiene, 97, 345-349. &gt;https://doi.org/10.1016/s0035-9203(03)90166-0
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref15">
    <label>15</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Adjuik, M., Agnamey, P., Babiker, A., Borrmann, S., Brasseur, P., Cisse, M., et al. (2002) Amodiaquine-Artesunate versus Amodiaquine for Uncomplicated Plasmodium falciparum Malaria in African Children: A Randomised, Multicentre Trial. The Lancet, 359, 1365-1372. &gt;https://doi.org/10.1016/s0140-6736(02)08348-4
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref16">
    <label>16</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Brasseur, P., Agnamey, P., Gaye, O., Vaillant, M., Taylor, W.R. and Olliaro, P.L. (2007) Efficacy and Safety of Artesunate plus Amodiaquine in Routine Use for the Treatment of Uncomplicated Malaria in Casamance, Southern Sénégal. Malaria Journal, 6, Article No. 150. &gt;https://doi.org/10.1186/1475-2875-6-150
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref17">
    <label>17</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Maiga, F.O., Wele, M., Toure, S.M., Keita, M., Tangara, C.O., Refeld, R.R., et al. (2021) Artemisinin-Based Combination Therapy for Uncomplicated Plasmodium falciparum Malaria in Mali: A Systematic Review and Meta-analysis. Malaria Journal, 20, Article No. 356. &gt;https://doi.org/10.1186/s12936-021-03890-0
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref18">
    <label>18</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Bédia-Tanoh, A.V., et al. (2024) Meta-Analysis of ASAQ vs AL in Côte d’Ivoire: Clinical and Parasitological Efficacy. Tropical Medicine and Infectious Disease, 9, Article No. 10.
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref19">
    <label>19</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Abuaku, B., et al. (2023) Therapeutic Efficacy of Dihydroartemisinin-Piperaquine for Uncomplicated Malaria in Ghana: A Multicentre in Vivo Study. Malaria Journal, 22, Article No. 184.
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref20">
    <label>20</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Djimdé, A., Doumbo, O.K., Cortese, J.F., Kayentao, K., Doumbo, S., Diourté, Y., et al. (2001) A Molecular Marker for Chloroquine-Resistant Falciparum Malaria. New England Journal of Medicine, 344, 257-263. &gt;https://doi.org/10.1056/nejm200101253440403
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref21">
    <label>21</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Tinto, H., Ouédraogo, J.B., Erhart, A., Van Overmeir, C., Dujardin, J., Van Marck, E., et al. (2003) Relationship between the Pfcrt T76 and the Pfmdr-1 Y86 Mutations in Plasmodium falciparum and in Vitro/in Vivo Chloroquine Resistance in Burkina Faso, West Africa. Infection, Genetics and Evolution, 3, 287-292. &gt;https://doi.org/10.1016/j.meegid.2003.08.002
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref22">
    <label>22</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Khalil, I.F., Alifrangis, M., Tarimo, D.S., Staalsø, T., Satti, G.M.H., Theander, T.G., et al. (2005) The Roles of the pfcrt 76t and pfmdr1 86y Mutations, Immunity and the Initial Level of Parasitaemia, in Predicting the Outcome of Chloroquine Treatment in Two Areas with Different Transmission Intensities. Annals of Tropical Medicine&amp;Parasitology, 99, 441-448. &gt;https://doi.org/10.1179/136485905x46441
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref23">
    <label>23</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Tinto, H., Zoungrana, E.B., Coulibaly, S.O., Ouedraogo, J.B., Traoré, M., Guiguemde, T.R., et al. (2002) Chloroquine and Sulphadoxine-Pyrimethamine Efficacy for Uncomplicated Malaria Treatment and Haematological Recovery in Children in Bobo-Dioulasso, Burkina Faso during a 3-Year Period 1998-2000. Tropical Medicine&amp;International Health, 7, 925-930. &gt;https://doi.org/10.1046/j.1365-3156.2002.00952.x
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref24">
    <label>24</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Randrianarivelojosia, M., et al. (2002) In Vitro Sensitivity of Plasmodium falciparum to Amodiaquine Compared with Other Major Antimalarials in Madagascar. Parasitologia, 44, 141-147.
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref25">
    <label>25</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Laminou, I.M., et al. (2005-2006) Réseau de surveillance de la chimiorésistance de P. falciparum et cartographie des mutations Pfcrt K76T et DhfrSer108Ans dans la Vallée du Niger.
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref26">
    <label>26</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Sondo, P., Derra, K., Diallo Nakanabo, S., Tarnagda, Z., Kazienga, A., Zampa, O., et al. (2016) Artesunate-Amodiaquine and Artemether-Lumefantrine Therapies and Selection of Pfcrt and Pfmdr1 Alleles in Nanoro, Burkina Faso. PLOS ONE, 11, e0151565. &gt;https://doi.org/10.1371/journal.pone.0151565
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref27">
    <label>27</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Ndiaye, M., Faye, B., Tine, R., Ndiaye, J.L., Lo, A., Abiola, A., et al. (2012) Assessment of the Molecular Marker of Plasmodium falciparum Chloroquine Resistance (pfcrt) in Senegal after Several Years of Chloroquine Withdrawal. The American Society of Tropical Medicine and Hygiene, 87, 640-645. &gt;https://doi.org/10.4269/ajtmh.2012.11-0709
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref28">
    <label>28</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Mukherjee, A., Daniels, R., Amaratunga, C., Woodrow, C.J., Ashley, E., Tripura, R., et al. (2014) Relationships between k13-Propeller Alleles and Artemisinin Susceptibility in Cambodian and Senegalese Plasmodium falciparum Isolates. American Journal of Tropical Medicine and Hygiene, 91, 228.
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref29">
    <label>29</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Ariey, F., Witkowski, B., Amaratunga, C., Beghain, J., Langlois, A., Khim, N., et al. (2013) A Molecular Marker of Artemisinin-Resistant Plasmodium falciparum Malaria. Nature, 505, 50-55. &gt;https://doi.org/10.1038/nature12876
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref30">
    <label>30</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Stokes, B.H., Dhingra, S.K., Rubiano, K., Mok, S., Straimer, J., Gnädig, N.F., et al. (2021) Plasmodium falciparum k13 Mutations in Africa and Asia Impact Artemisinin Resistance and Parasite Fitness. Elife, 10, e66277.
    </mixed-citation>
   </ref>
   <ref id="scirp.146846-ref31">
    <label>31</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Foote, S.J., Kyle, D.E., Martin, R.K., Oduola, A.M.J., Forsyth, K., Kemp, D.J., et al. (1990) Several Alleles of the Multidrug-Resistance Gene Are Closely Linked to Chloroquine Resistance in Plasmodium falciparum. Nature, 345, 255-258. &gt;https://doi.org/10.1038/345255a0
    </mixed-citation>
   </ref>
  </ref-list>
 </back>
</article>