<?xml version="1.0" encoding="UTF-8"?><!DOCTYPE article PUBLIC "-//NLM//DTD Journal Publishing DTD v3.0 20080202//EN" "http://dtd.nlm.nih.gov/publishing/3.0/journalpublishing3.dtd">
<article xmlns:mml="http://www.w3.org/1998/Math/MathML" xmlns:xlink="http://www.w3.org/1999/xlink" dtd-version="3.0" xml:lang="en" article-type="research article">
 <front>
  <journal-meta>
   <journal-id journal-id-type="publisher-id">
    abb
   </journal-id>
   <journal-title-group>
    <journal-title>
     Advances in Bioscience and Biotechnology
    </journal-title>
   </journal-title-group>
   <issn pub-type="epub">
    2156-8456
   </issn>
   <issn publication-format="print">
    2156-8502
   </issn>
   <publisher>
    <publisher-name>
     Scientific Research Publishing
    </publisher-name>
   </publisher>
  </journal-meta>
  <article-meta>
   <article-id pub-id-type="doi">
    10.4236/abb.2025.1610026
   </article-id>
   <article-id pub-id-type="publisher-id">
    abb-146410
   </article-id>
   <article-categories>
    <subj-group subj-group-type="heading">
     <subject>
      Articles
     </subject>
    </subj-group>
    <subj-group subj-group-type="Discipline-v2">
     <subject>
      Biomedical 
     </subject>
     <subject>
       Life Sciences
     </subject>
    </subj-group>
   </article-categories>
   <title-group>
    Cloning, Subcellular Localization and Functional Analysis of TIR-NBS Family Members in Arabidopsis Thaliana 
   </title-group>
   <contrib-group>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Jiayu
      </surname>
      <given-names>
       Zeng
      </given-names>
     </name>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Qiang
      </surname>
      <given-names>
       Lin
      </given-names>
     </name>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Xiaoju
      </surname>
      <given-names>
       Zhong
      </given-names>
     </name>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Xiuying
      </surname>
      <given-names>
       Guan
      </given-names>
     </name>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Hongbin
      </surname>
      <given-names>
       Zhang
      </given-names>
     </name>
    </contrib>
    <contrib contrib-type="author" xlink:type="simple">
     <name name-style="western">
      <surname>
       Jianzhong
      </surname>
      <given-names>
       Huang
      </given-names>
     </name>
    </contrib>
   </contrib-group> 
   <aff id="affnull">
    <addr-line>
     aDepartment of Basic Medicine, Fuzhou Medical University (Formerly Known as Fuzhou Medical College of Nanchang University), Fuzhou, China
    </addr-line> 
   </aff> 
   <pub-date pub-type="epub">
    <day>
     16
    </day> 
    <month>
     10
    </month>
    <year>
     2025
    </year>
   </pub-date> 
   <volume>
    16
   </volume> 
   <issue>
    10
   </issue>
   <fpage>
    411
   </fpage>
   <lpage>
    421
   </lpage>
   <history>
    <date date-type="received">
     <day>
      8,
     </day>
     <month>
      September
     </month>
     <year>
      2025
     </year>
    </date>
    <date date-type="published">
     <day>
      13,
     </day>
     <month>
      September
     </month>
     <year>
      2025
     </year> 
    </date> 
    <date date-type="accepted">
     <day>
      13,
     </day>
     <month>
      October
     </month>
     <year>
      2025
     </year> 
    </date>
   </history>
   <permissions>
    <copyright-statement>
     © Copyright 2014 by authors and Scientific Research Publishing Inc. 
    </copyright-statement>
    <copyright-year>
     2014
    </copyright-year>
    <license>
     <license-p>
      This work is licensed under the Creative Commons Attribution International License (CC BY). http://creativecommons.org/licenses/by/4.0/
     </license-p>
    </license>
   </permissions>
   <abstract>
    Recent studies have shown that truncated Toll/interleukin-1 receptor-NBS (TIR-NBS) protein plays a critical role in immune responses. In Arabidopsis thaliana ecotype type Col-0, the TIR-NBS family is encoded by 20 genes and one pseudogene. However, so far, our understanding of the subcellular localization and function of these TN genes is not very clear. In this article, we first conducted a brief analysis of the proteins and evolutionary tree expressed by these 20 TN genes. Furthermore, we focused on the TN genes on chromosome 1, which included 12 TN genes, TN1 to TN12, and observed different subcellular localization patterns of these proteins through fluorescence microscopy, including membrane, cytoplasmic, and/or nuclear localization, suggesting diverse roles for these proteins. Additionally, we identified four receptors, including TN2, TN9, TN11, and TN12, that can trigger visible cell death in Nicotiana benthamiana. Taken together, our study provides valuable clues for further investigating the activation mechanisms of TN family members.
   </abstract>
   <kwd-group> 
    <kwd>
     Arabidopsis
    </kwd> 
    <kwd>
      TIR-NBS
    </kwd> 
    <kwd>
      Cell Death
    </kwd> 
    <kwd>
      Nicotiana benthamiana
    </kwd>
   </kwd-group>
  </article-meta>
 </front>
 <body>
  <sec id="s1">
   <title>1. Introduction</title>
   <p>Plants rely on two-levels of innate immune systems to defend against various pathogens in nature <xref ref-type="bibr" rid="scirp.146410-1">
     [1]
    </xref>. The first level of the immune system is activated by pattern recognition receptors (PRRs) located on the plasma membrane, which can recognize conserved pathogen associated molecular patterns (PAMPs), known as pattern triggered immunity (PTI). However, some host-adapted pathogens can enter plant cells by secreting effectors that contribute to pathogen virulence, thereby interfering with plant immunity <xref ref-type="bibr" rid="scirp.146410-2">
     [2]
    </xref>. Correspondingly, plants have evolved intracellular nucleotide-binding sites (NBS) and leucine-rich repeat (LRR) domain receptors (NLRs), also known as resistance (R) proteins, which activate the second level of the immune system called effector triggered immunity (ETI) by directly or indirectly recognizing these effectors. Compared to PTI, ETI typically responds stronger and faster, accompanied by hypersensitive responses (HR), which is programmed cell death at the site of infection <xref ref-type="bibr" rid="scirp.146410-3">
     [3]
    </xref>.</p>
   <p>Generally speaking, a typical plant NLR protein contains a specific N-terminal domain, a conserved NBS domain, and a highly variable C-terminal LRR domain. The N-terminal domain are typically coiled-coil (CC) domain, Toll/interleukin receptor (TIR) domain, or RESISTANCE TO POWDERY MILDEW 8 (RPW8)-like domain. Therefore, according to different N-terminal domains, NLRs can be roughly divided into three subfamilies: CC-NBS-LRR (CNL), TIR-NBS-LRR (TNL), and RPW8-NBS-LRR (RNL) <xref ref-type="bibr" rid="scirp.146410-4">
     [4]
    </xref>. Besides, plants also contain some truncated NLR receptors. For example, 21 truncated TIR-NBS (TN) proteins lacking the C-terminal LRR domain have been identified in the Arabidopsis thaliana ecological type Col-0 <xref ref-type="bibr" rid="scirp.146410-4">
     [4]
    </xref>. An increasing number of studies indicated that TN proteins also play a crucial role in plant immunity. Such as, the gain-of-function mutant of TN1, also known as CHILLING SENSITIVE 1 (CHS1), exhibits cold sensitivity at low temperatures, yet the cold sensitivity phenotype of chs1-2 mutant at low temperatures counts on the full-length TNL protein SUPPRESSOR OF chs1-2, 3 (SOC3) <xref ref-type="bibr" rid="scirp.146410-5">
     [5]
    </xref>. Further experiments revealed that SOC3 can interact with TN1 and TN2 respectively to monitor the homeostasis of Arabidopsis E3 ubiquitin ligase SENESCENCE-ASSOCIATED E3 UBIQUITIN LIGASE1 (SAUL1). Specifically, the excessive accumulation of SAUL1 is monitored by the SOC3-TN2 pair, meanwhile the disappearance of SAUL1 is guarded by the SOC3-CHS1 pair <xref ref-type="bibr" rid="scirp.146410-6">
     [6]
    </xref>. Ectopic expression of the TN2-TIR domain causes cell death in N. benthamiana. The autoimmune responses in exo70B1 mutants are caused by the activation of TN2, and co-expression of EXO70B1 and TN2 can inhibit the TN2-triggered cell death in N. benthamiana, suggesting that TN2 may monitor the presence or absence of EXO70B1 <xref ref-type="bibr" rid="scirp.146410-7">
     [7]
    </xref> <xref ref-type="bibr" rid="scirp.146410-8">
     [8]
    </xref>. Furthermore, TN2 associates with CALCIUM-DEPENDENT PROTEIN KINASE 5 (CPK5) and stabilizes its kinase activity <xref ref-type="bibr" rid="scirp.146410-9">
     [9]
    </xref>. The loss of function of TN8 and TN11 genes results in increased susceptibility to Pseudomonas syringae pv. tomato (Pto) strain DC3000 <xref ref-type="bibr" rid="scirp.146410-10">
     [10]
    </xref>. Additionally, TN13 is necessary to resistance against Pto DC3000 lacking the effectors AvrPto or AvrptoB <xref ref-type="bibr" rid="scirp.146410-11">
     [11]
    </xref>.</p>
   <p>However, there have been no systematic studies published on the subcellular localization and function of TN receptors. In this article, we first conducted a brief analysis of the proteins and evolutionary tree expressed by these 20 TN genes. Furthermore, we focused on the TN genes on chromosome 1, which included 12 TN genes, TN1 to TN12, and observed different subcellular localization patterns of these proteins through fluorescence microscopy, including membrane, cytoplasmic, and/or nuclear localization, suggesting diverse roles for these proteins. Additionally, we identified four receptors, including TN2, TN9, TN11, and TN12, that can trigger visible cell death in N. benthamiana. Taken together, our study provides valuable clues for further investigating the activation mechanisms of TN family members.</p>
  </sec><sec id="s2">
   <title>2. Materials and Methods</title>
   <sec id="s2_1">
    <title>2.1. Plant Materials and Growth Conditions</title>
    <p>Arabidopsis thaliana and N. benthamiana were cultivated in a plant greenhouse at 25˚C with 16 hours of light exposure, and regularly supplemented with Hoagland nutrient solution. This article employed about 4 weeks old N. benthamiana for transient expression analysis.</p>
   </sec>
   <sec id="s2_2">
    <title>2.2. Plasmid Construction</title>
    <p>We use cDNA from wild-type Arabidopsis leaves as initial template. Conditions for the PCR amplifications were: 35 cycles of a 15 second denaturation step at 95˚C, annealing at 53˚C - 60˚C for 15 seconds, and extension at 72˚C for 80 seconds. Then, we separately recovered the above fragments and cloned them into the modified pUC19 (containing attL1 and attL2 feature sequences). After extracting the plasmid, DNA sequencing was performed, and finally the correct plasmid was ligated to the expression vector pEreyGate101 fused with the YFP-HA tag using gateway technology. Subsequently, transfer the expression plasmid containing the TN gene into Agrobacterium tumefaciens strain GV3101 by electroporation.</p>
   </sec>
   <sec id="s2_3">
    <title>2.3. Agrobacterium Tumefaciens-Mediated Transient Expression Assay</title>
    <p>Agrobacteria carrying the constructs were cultivated overnight in LB medium containing Rifampicin and kanamycin. The Agrobacteria cells were centrifuged and resuspended in infiltration buffer to an OD<sub>600</sub> of 0.8, and incubated at room temperature for 1 hour. The abaxial sides of N. benthamiana leaves were infiltrated with the suspension and cultured in a dark greenhouse for 24 hours, after which they were moved to a growth chamber with a 16 hours photoperiod.</p>
   </sec>
   <sec id="s2_4">
    <title>2.4. Subcellular Localization Observation</title>
    <p>The images were observed on the abaxial sides of leaves at 28/40 hours post target protein expression with a fluorescence microscope. YFP fluorescence was excited at 514 nm.</p>
   </sec>
   <sec id="s2_5">
    <title>2.5. Sequence Alignment and Phylogenetic Analysis</title>
    <p>The evolutionary history was inferred using the Neighbor-Joining method and the respective evolutionary analyses were conducted using MEGA-X. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree. The evolutionary distances were computed using the Poisson correction method and are in the units of the number of amino acid substitutions per site. This analysis involved 20 amino acid sequences. All ambiguous positions were removed for each sequence pair (pairwise deletion option).</p>
   </sec>
   <sec id="s2_6">
    <title>2.6. Gene Accession Number</title>
    <p>Sequence data for the genes described in this article can be found in TAIR under the following accession numbers: TN1 (CHS1) (AT1G17610), TN2 (AT1G17615), TN3 (AT1G66090), TN4 (AT1G72850), TN5 (AT1G72870), TN6 (AT1G72890), TN7 (AT1G72900), TN8 (AT1G72910), TN9 (AT1G72920), TN10 (AT1G72930), TN11 (AT1G72940), TN12 (AT1G72950), TN13 (AT3G04210), TN14 (AT4G04110), TN15 (AT4G09420), TN16 (AT4G16990), TN17 (AT4G23440), TN18 (AT5G40090), TN20 (AT5G48780), TN21 (AT5G56220).</p>
   </sec>
  </sec><sec id="s3">
   <title>3. Results</title>
   <sec id="s3_1">
    <title>3.1. TN Proteins Basic Physicochemical Properties and Evolutionary Tree Analysis</title>
    <table-wrap id="table1">
     <label>
      <xref ref-type="table" rid="table1">
       Table 1
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.146410-"></xref>Table 1. The protein data of the TIR-NBS receptors involved in this article.</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td custom-top-td acenter" width="18.81%"><p style="text-align:center">Protein Name</p></td> 
       <td class="custom-bottom-td custom-top-td acenter" width="19.23%"><p style="text-align:center">Gene Number</p></td> 
       <td class="custom-bottom-td custom-top-td acenter" width="11.08%"><p style="text-align:center">Length</p></td> 
       <td class="custom-bottom-td custom-top-td acenter" width="25.23%"><p style="text-align:center">Molecular Weight</p></td> 
       <td class="custom-bottom-td custom-top-td acenter" width="25.64%"><p style="text-align:center">Isoelectric Point</p></td> 
      </tr> 
      <tr> 
       <td class="custom-top-td acenter" width="18.81%"><p style="text-align:center">TN1 (CHS1)</p></td> 
       <td class="custom-top-td acenter" width="19.23%"><p style="text-align:center">AT1G17610</p></td> 
       <td class="custom-top-td acenter" width="11.08%"><p style="text-align:center">420 aa</p></td> 
       <td class="custom-top-td acenter" width="25.23%"><p style="text-align:center">~47 KDa</p></td> 
       <td class="custom-top-td acenter" width="25.64%"><p style="text-align:center">6.15</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN2</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT1G17615</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">380 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~43 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">8.54</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN3</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT1G66090</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">429 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~48 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">7.55</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN4</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT1G72850</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">422 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~48 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">5.16</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN5</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT1G72870</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">512 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~59 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">6.44</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN6</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT1G72890</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">487 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~57 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">10.03</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN7</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT1G72900</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">363 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~41 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">8.19</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN8</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT1G72910</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">380 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~43 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">9.22</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN9</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT1G72920</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">275 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~32 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">9.88</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN10</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT1G72930</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">176 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~20 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">7.63</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN11</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT1G72940</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">371 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~42 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">9.39</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN12</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT1G72950</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">379 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~44 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">8.63</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN13</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT3G04210</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">531 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~60 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">9.73</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN14</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT4G04110</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">239 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~28 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">9.74</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN15</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT4G09420</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">457 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~51 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">6.04</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN16</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT4G16990</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">796 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~91 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">8.41</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN17</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT4G23440</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">964 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~109 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">9.81</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN18 (CHL1)</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT5G40090</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">459 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~52 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">5.26</p></td> 
      </tr> 
      <tr> 
       <td class="acenter" width="18.81%"><p style="text-align:center">TN20</p></td> 
       <td class="acenter" width="19.23%"><p style="text-align:center">AT5G48780</p></td> 
       <td class="acenter" width="11.08%"><p style="text-align:center">639 aa</p></td> 
       <td class="acenter" width="25.23%"><p style="text-align:center">~73 KDa</p></td> 
       <td class="acenter" width="25.64%"><p style="text-align:center">8.58</p></td> 
      </tr> 
      <tr> 
       <td class="custom-bottom-td acenter" width="18.81%"><p style="text-align:center">TN21</p></td> 
       <td class="custom-bottom-td acenter" width="19.23%"><p style="text-align:center">AT5G56220</p></td> 
       <td class="custom-bottom-td acenter" width="11.08%"><p style="text-align:center">973 aa</p></td> 
       <td class="custom-bottom-td acenter" width="25.23%"><p style="text-align:center">~108 KDa</p></td> 
       <td class="custom-bottom-td acenter" width="25.64%"><p style="text-align:center">8.68</p></td> 
      </tr> 
     </table>
    </table-wrap>
    <p>Previous studies have proclaimed that in Arabidopsis Col-0, the TIR-NBS (TN) family is encoded by 20 genes and one pseudogene (TN19) <xref ref-type="bibr" rid="scirp.146410-4">
      [4]
     </xref>. We cloned 20 TN genes from Arabidopsis and designated as TN1-TN21. The physiological and biochemical properties of these proteins were characterized, and the general information for the 20 TN genes is shown in <xref ref-type="table" rid="table1">
      Table 1
     </xref>. The length of these TN proteins ranged from 176 to 973 amino acids, with predicted molecular weights of 20 kDa to 108 kDa. The theoretical isoelectric point of these TN proteins ranged from 5.16 to 10.03.</p>
    <p>To explore the phylogenetic relationships of these TNs, phylogenetic analysis was carried out. The results indicated that TNs with similar sequences were clustered on the same branch, such as TN2 and TN6; TN9 and TN11. However, TNs with lower sequence identities were clustered on the different branches (<xref ref-type="fig" rid="fig1">
      Figure 1
     </xref>).</p>
    <fig id="fig1" position="float">
     <label>Figure 1</label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.146410-"></xref>Figure 1. Phylogenetic analysis of the deduced amino acid sequences of the designed TN proteins.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/7302224-rId19.jpeg?20251016022252" />
    </fig>
   </sec>
   <sec id="s3_2">
    <title>3.2. Diversity of Subcellular Localization of TN Receptors</title>
    <p>Following, we focus on the 12 TN genes located on chromosome 1, namely TN1 to TN12. The primer sequences used for molecular cloning were listed in <xref ref-type="table" rid="table2">
      Table 2
     </xref>.</p>
    <table-wrap id="table2">
     <label>
      <xref ref-type="table" rid="table2">
       Table 2
      </xref></label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.146410-"></xref>Table 2. Primers used for cloning and transcript amplification in this study.</title>
     </caption>
     <table class="MsoTableGrid custom-table" border="0" cellspacing="0" cellpadding="0"> 
      <tr> 
       <td class="custom-bottom-td custom-top-td acenter" width="18.00%"><p style="text-align:center">Primer Name</p></td> 
       <td class="custom-bottom-td custom-top-td acenter" width="82.00%"><p style="text-align:center">Sequence (5’-...- 3’)</p></td> 
      </tr> 
      <tr> 
       <td class="custom-top-td aleft" width="18.00%"><p style="text-align:left">NotI-TN1-F</p></td> 
       <td class="custom-top-td aleft" width="82.00%"><p style="text-align:left">CTCCGCGGCCGCCACCATGTCTACTTCTTATTCTTTTTTGTTGGC</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">ASCI-TN1-R</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">GGTCGGCGCGCCCTCTTTGGGATGCTTCCACGATATC</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">NotI-TN2-F</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">CTCCGCGGCCGCCACCATGTATTCATCATCGTCTTCTTCTTC</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">ASCI-TN2-R</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">GGTCGGCGCGCCCAGAAGATTCAGTCCCGGATATAG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">NotI-TN3-F</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">CTCCGCGGCCGCCACCATGGCTGCATCTACTTCTTCTTC</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">ASCI-TN3-R</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">GGTCGGCGCGCCCTACAAAATCAGCCAGAGACACTAG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">NotI-TN4-F</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">CTCCGCGGCCGCCACCATGTCTTCATCCTCCAAATTTGAAG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">ASCI-TN4-R</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">GGTCGGCGCGCCCATCATCACTCAAGAGAATAAATGATGTG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">NotI-TN5-F</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">CTCCGCGGCCGCCACCATGGCTTCTTCTTCCTCCTCATC</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">ASCI-TN5-R</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">GGTCGGCGCGCCCAAGTGACATGATATATGAAGGTGAATATTC</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">NotI-TN6-F</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">CTCCGCGGCCGCCACCATGAACACGATCTTTAAAAAATTATCCTG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">ASCI-TN6-R</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">GGTCGGCGCGCCCAATGAATTTGTTGTGAACCGTC</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">NotI-TN7-F</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">CTCCGCGGCCGCCACCATGTCTTCTGCTACTGCGACTTATAAC</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">ASCI-TN7-R</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">GGTCGGCGCGCCCTATATACAAAGCCCACTCGAACG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">NotI-TN8-F</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">CTCCGCGGCCGCCACCATGTCTTCTCATACTGCAACTAAG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">ASCI-TN8-R</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">GGTCGGCGCGCCCAACTAAATCTGTCACTTTCCCATAAC</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">NotI-TN9-F</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">CTCCGCGGCCGCCACCATGTCTTCTCCTACTGCGACTAAG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">ASCI-TN9-R</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">GGTCGGCGCGCCCCTCAGTTTTAAAAGAGTGATGTGATC</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">NotI-TN10-F</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">CTCCGCGGCCGCCACCATGTCTTCTCATACTGCAACTAAG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">ASCI-TN10-R</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">GGTCGGCGCGCCCTATTGTTGCATAAATCGTCTTCTTG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">NotI-TN11-F</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">CTCCGCGGCCGCCACCATGACTTCTCCTACTGCGACTAAG</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">ASCI-TN11-R</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">GGTCGGCGCGCCCACCAGATCTACCACTTAGACAACC</p></td> 
      </tr> 
      <tr> 
       <td class="aleft" width="18.00%"><p style="text-align:left">NotI-TN12-F</p></td> 
       <td class="aleft" width="82.00%"><p style="text-align:left">CTCCGCGGCCGCCACCATGTCAGATTCTTCAAACACCCTC</p></td> 
      </tr> 
      <tr> 
       <td class="custom-bottom-td aleft" width="18.00%"><p style="text-align:left">ASCI-TN12-R</p></td> 
       <td class="custom-bottom-td aleft" width="82.00%"><p style="text-align:left">GGTCGGCGCGCCCACCTGATCTACCACATATACAACC</p></td> 
      </tr> 
     </table>
    </table-wrap>
    <p>It is widely believed that subcellular localization of genes is crucial for understanding their cellular functions. To determine the subcellular localization of these TN receptors in planta, we created TNs tagged with yellow fluorescent protein (YFP) reporter at their C-terminus (e.g. TN2-YFP) under the control of the CaMV 35S promoter and transiently expressed them in N. benthamiana leaves using agroinfiltration. The results of fluorescence microscopy observation indicated that there are similarities and differences in the subcellular localization of TNs proteins (<xref ref-type="fig" rid="fig2">
      Figure 2
     </xref>). For example, TN1 and TN2 are mainly distributed in the cytoplasm in the form of cytoplasmic aggregates, with a small amount of fluorescence appearing on the plasma membrane, but it cannot be ruled out that the latter is formed by the bright particle background in the cytoplasm. Moreover, TN3, TN9 and TN10 demonstrated nuclear and cytoplasmic localization, while TN8 and TN11 were plasma membrane localized. Thus, TN proteins were localized to distinct, diverse cellular locations, suggesting diverse roles for these proteins.</p>
    <fig id="fig2" position="float">
     <label>Figure 2</label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.146410-"></xref>Figure 2. Transient overexpression of TN proteins in N. benthamiana leaves. TN8 and TN11 proteins show membrane localization. TN3, TN9 and TN10 show nuclear and cytoplasmic localization pattern in N. benthamiana. Transient overexpression of TN1 and TN2 show cytoplasmic aggregates and cytoplasmic localization. Bars = 20 μm.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/7302224-rId20.jpeg?20251016022252" />
    </fig>
   </sec>
   <sec id="s3_3">
    <title>3.3. Transient Overexpression of the TN Genes in N. Benthamiana Results in Cell Death Responses</title>
    <p>We next sought to investigate the potential function of these genes using transient assays, knowing that transient overexpression of R genes may induce spontaneous HR <xref ref-type="bibr" rid="scirp.146410-12">
      [12]
     </xref>. The recombinant TN receptors (TN1-TN12) fused to a YFP-HA tag at the C-terminus was expressed under the control of 35S promoter, and 35:YFP-HA as a negative control. The results of immunoblotting showed comparable levels of fusion protein expressed (data not shown). Transient Agrobacterium tumefaciens-mediated overexpression of Arabidopsis TN proteins in N. benthamiana resulted in HR, a cell death phenotype, for four (TN2, TN9, TN11, and TN12) out of 12 TN genes tested. The other 8 TN genes tested with transient overexpression in N. benthamiana did not display any visible phenotypes (<xref ref-type="fig" rid="fig3">
      Figure 3
     </xref>). Therefore, some members of the TN protein family can trigger cell death via ectopic expression, similar to previous reports that used N-terminal domains of the TNL genes RPS4 and RPP1A <xref ref-type="bibr" rid="scirp.146410-13">
      [13]
     </xref> <xref ref-type="bibr" rid="scirp.146410-14">
      [14]
     </xref>.</p>
    <fig id="fig3" position="float">
     <label>Figure 3</label>
     <caption>
      <title>
       <xref ref-type="bibr" rid="scirp.146410-"></xref>Figure 3. Transient overexpression of Arabidopsis TN genes in N. benthamiana results in partial cell death response. The constitutive promoter drives the transient expression of the TN proteins in N. benthamiana (OD600 = 0.8). The white solid circle represents obvious cell death. The white dashed circle indicates no visible cell death. The symbol (+) refers to the severity of cell death. The photo was taken 72 hours after infecting N. benthamiana.</title>
     </caption>
     <graphic mimetype="image" position="float" xlink:type="simple" xlink:href="https://html.scirp.org/file/7302224-rId21.jpeg?20251016022253" />
    </fig>
   </sec>
  </sec><sec id="s4">
   <title>4. Conclusion</title>
   <p>In this article, we focused on analyzing the subcellular localization and function of 12 TN receptors (TN1-TN12) derived from Arabidopsis, confirming that TN receptors have diverse cellular localization, including cytoplasm, cell membrane, nucleus, etc. Additionally, we observed that transient expression of four TN proteins, including TN2, TN9, TN11, and TN12, can trigger significant cell death in Nicotiana benthamiana leaves. Subsequent focus would be on screening the interacting proteins of these receptors, especially full-length TNL or CNL receptors, to observe whether these TNs need to interact with full-length NLRs receptors to mediate defense responses.</p>
  </sec><sec id="s5">
   <title>5. Discussion</title>
   <p>We have demonstrated that the localization of 12 designed TNs from Arabidopsis is not entirely identical (<xref ref-type="fig" rid="fig2">
     Figure 2
    </xref>), but we cannot rule out the possibility that TNs may have other subcellular localization. According to reports, some NBS-LRR proteins, such as MLA10, N, and RPS4, can relocate to the nucleus after activation <xref ref-type="bibr" rid="scirp.146410-13">
     [13]
    </xref> <xref ref-type="bibr" rid="scirp.146410-15">
     [15]
    </xref> <xref ref-type="bibr" rid="scirp.146410-16">
     [16]
    </xref>. Therefore, studying whether TNs receptors can be repositioned would help analyze the activation mechanism of these proteins. Coincidentally, animal NBS-LRR has also been observed in different subcellular locations, requiring similar partners to maintain pre-activation ability and can be repositioned during activation to participate in various signaling complexes. Mammalian CIITA NBS-LRR receptors function in the nucleus <xref ref-type="bibr" rid="scirp.146410-17">
     [17]
    </xref>. NOD2 exists on the plasma membrane and recruits downstream partners to the membrane; the mutation of its LRR causes NOD2 to appear cytoplasmic and non-functional <xref ref-type="bibr" rid="scirp.146410-18">
     [18]
    </xref>. NOD1 and NOD2 recruit autophagic components locally at the plasma membrane site of bacterial infection, while common NOD2 variants associated with Crohn’s disease fail to do so <xref ref-type="bibr" rid="scirp.146410-19">
     [19]
    </xref>. These studies indicate that mammalian NBS-LRRs are located at different positions in the cell before activation and can dynamically relocate, and their cellular localization affects downstream functions. The sum of data on intracellular immune receptors of NBS-LRR in plants and animals is consistent with the conceptual role of NBS-LRR protein as a cell homeostasis monitor, which studies a wide range of cellular defense mechanisms through various subcellular addresses.</p>
   <p>Out of 12 TN genes tested for transient overexpression in N. benthamiana, four of the TN genes induced macroscopic cell death responses (<xref ref-type="fig" rid="fig3">
     Figure 3
    </xref>). Induction of a localized cell death has been demonstrated previously in N. benthamiana when an R gene is transiently overexpressed in the absence of a corresponding Avr protein <xref ref-type="bibr" rid="scirp.146410-12">
     [12]
    </xref>. Cell death induced in response to the transient overexpression of TNL genes was shown in the cases of RPP1A and RPS4 <xref ref-type="bibr" rid="scirp.146410-13">
     [13]
    </xref> <xref ref-type="bibr" rid="scirp.146410-14">
     [14]
    </xref>. Therefore, the TIR domain is shared between TN and TNL proteins and may have a common role in triggering cell death.</p>
  </sec><sec id="s6">
   <title>Funding</title>
   <p>This study was funded by Science and Technology Research Project of Jiangxi Provincial Department of Education (GJJ2403304 and GJJ218112), and School-level Science and Technology Project of Fuzhou Medical University (fykj202201).</p>
  </sec><sec id="s7">
   <title>NOTES</title>
   <p>*Corresponding author.</p>
  </sec>
 </body><back>
  <ref-list>
   <title>References</title>
   <ref id="scirp.146410-ref1">
    <label>1</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Jones, J.D.G. and Dangl, J.L. (2006) The Plant Immune System. Nature, 444, 323-329. &gt;https://doi.org/10.1038/nature05286
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref2">
    <label>2</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Yu, X.Q., Niu, H.Q., Liu, C., Wang, H.L., Yin, W. and Xia, X. (2024) PTI‐ETI Synergistic Signal Mechanisms in Plant Immunity. Plant Biotechnology Journal, 22, 2113-2128.
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref3">
    <label>3</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Coll, N.S., Epple, P. and Dangl, J.L. (2011) Programmed Cell Death in the Plant Immune System. Cell Death&amp;Differentiation, 18, 1247-1256. &gt;https://doi.org/10.1038/cdd.2011.37
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref4">
    <label>4</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Wang, W., Feng, B., Zhou, J. and Tang, D. (2020) Plant Immune Signaling: Advancing on Two Frontiers. Journal of Integrative Plant Biology, 62, 2-24. &gt;https://doi.org/10.1111/jipb.12898
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref5">
    <label>5</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zhang, Y., Wang, Y., Liu, J., Ding, Y., Wang, S., Zhang, X., et al. (2017) Temperature‐dependent Autoimmunity Mediated by Chs1 Requires Its Neighboring TNL Gene soc3. New Phytologist, 213, 1330-1345. &gt;https://doi.org/10.1111/nph.14216
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref6">
    <label>6</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Liang, W., van Wersch, S., Tong, M. and Li, X. (2018) TIR‐NB‐LRR Immune Receptor SOC3 Pairs with Truncated TIR‐NB Protein CHS1 or TN2 to Monitor the Homeostasis of E3 Ligase saul1. New Phytologist, 221, 2054-2066. &gt;https://doi.org/10.1111/nph.15534
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref7">
    <label>7</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Zhao, T., Rui, L., Li, J., Nishimura, M.T., Vogel, J.P., Liu, N., et al. (2015) A Truncated NLR Protein, TIR-NBS2, Is Required for Activated Defense Responses in the Exo70b1 Mutant. PLOS Genetics, 11, e1004945. &gt;https://doi.org/10.1371/journal.pgen.1004945
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref8">
    <label>8</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Wang, W., Liu, N., Gao, C., Rui, L. and Tang, D. (2019) The Pseudomonas Syringae Effector AVRPTOB Associates with and Ubiquitinates Arabidopsis Exocyst Subunit EXO70B1. Frontiers in Plant Science, 10, Article 1027. &gt;https://doi.org/10.3389/fpls.2019.01027
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref9">
    <label>9</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Liu, N., Hake, K., Wang, W., Zhao, T., Romeis, T. and Tang, D. (2017) Calcium-Dependent Protein Kinase5 Associates with the Truncated NLR Protein TIR-NBS2 to Contribute to EXO70B1-Mediated Immunity. The Plant Cell, 29, 746-759. &gt;https://doi.org/10.1105/tpc.16.00822
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref10">
    <label>10</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Nasim, Z., Fahim, M., Gawarecka, K., Susila, H., Jin, S., Youn, G., et al. (2020) Role of AT1G72910, AT1G72940, and ADR1-LIKE 2 in Plant Immunity under Nonsense-Mediated mRNA Decay-Compromised Conditions at Low Temperatures. International Journal of Molecular Sciences, 21, Article 7986. &gt;https://doi.org/10.3390/ijms21217986
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref11">
    <label>11</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Roth, C., Lüdke, D., Klenke, M., Quathamer, A., Valerius, O., Braus, G.H., et al. (2017) The Truncated NLR Protein TIR‐NBS13 Is a Mos6/Importin‐α3 Interaction Partner Required for Plant Immunity. The Plant Journal, 92, 808-821. &gt;https://doi.org/10.1111/tpj.13717
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref12">
    <label>12</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Huang, J., Wu, X., Sun, K. and Gao, Z. (2021) Structure and Function Analysis of a CC-NBS-LRR Protein AT1G12290. Biochemical and Biophysical Research Communications, 534, 206-211. &gt;https://doi.org/10.1016/j.bbrc.2020.11.111
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref13">
    <label>13</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Wirthmueller, L., Zhang, Y., Jones, J.D.G. and Parker, J.E. (2007) Nuclear Accumulation of the Arabidopsis Immune Receptor RPS4 Is Necessary for Triggering Eds1-Dependent Defense. Current Biology, 17, 2023-2029. &gt;https://doi.org/10.1016/j.cub.2007.10.042
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref14">
    <label>14</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Michael Weaver, L., Swiderski, M.R., Li, Y. and Jones, J.D.G. (2006) The Arabidopsis thaliana TIR‐NB‐LRR R‐Protein, RPP1A; Protein Localization and Constitutive Activation of Defence by Truncated Alleles in Tobacco and Arabidopsis. The Plant Journal, 47, 829-840. &gt;https://doi.org/10.1111/j.1365-313x.2006.02834.x
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref15">
    <label>15</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Shen, Q., Saijo, Y., Mauch, S., Biskup, C., Bieri, S., Keller, B., et al. (2007) Nuclear Activity of MLA Immune Receptors Links Isolate-Specific and Basal Disease-Resistance Responses. Science, 315, 1098-1103. &gt;https://doi.org/10.1126/science.1136372
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref16">
    <label>16</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Caplan, J.L., Mamillapalli, P., Burch-Smith, T.M., Czymmek, K. and Dinesh-Kumar, S.P. (2008) Chloroplastic Protein NRIP1 Mediates Innate Immune Receptor Recognition of a Viral Effector. Cell, 132, 449-462. &gt;https://doi.org/10.1016/j.cell.2007.12.031
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref17">
    <label>17</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Cressman, D.E., Chin, K., Taxman, D.J. and Ting, J.P. (1999) A Defect in the Nuclear Translocation of CIITA Causes a Form of Type II Bare Lymphocyte Syndrome. Immunity, 10, 163-171. &gt;https://doi.org/10.1016/s1074-7613(00)80017-5
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref18">
    <label>18</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Lé;cine, P., Esmiol, S., Mé;tais, J., Nicoletti, C., Nourry, C., McDonald, C., et al. (2007) The NOD2-RICK Complex Signals from the Plasma Membrane. Journal of Biological Chemistry, 282, 15197-15207. &gt;https://doi.org/10.1074/jbc.m606242200
    </mixed-citation>
   </ref>
   <ref id="scirp.146410-ref19">
    <label>19</label>
    <mixed-citation publication-type="other" xlink:type="simple">
     Travassos, L.H., Carneiro, L.A.M., Ramjeet, M., Hussey, S., Kim, Y., Magalhães, J.G., et al. (2009) Nod1 and Nod2 Direct Autophagy by Recruiting ATG16L1 to the Plasma Membrane at the Site of Bacterial Entry. Nature Immunology, 11, 55-62. &gt;https://doi.org/10.1038/ni.1823
    </mixed-citation>
   </ref>
  </ref-list>
 </back>
</article>